|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online August 25, 2006
doi: 10.1242/10.1242/dev.02517


1 Stem Cell Research Institute, Dibit, H. San Raffaele, Via Olgettina 58, 20132
Milan, Italy.
2 Istituto Pasteur-Fondazione Cenci Bolognetti, Dipartimento di Istologia ed
Embriologia Medica, Universita di Roma `La Sapienza', Via A. Scarpa 14, 00161
Rome, Italy.
3 Zoology Department, Trinity College, Dublin 2, Ireland.
4 Department of Developmental Biology, CNRS URA 2578, Pasteur Institute, 25 Rue
du Dr Roux, 75724 Paris Cedex 15, France.
5 Department of Histology, Microbiology and Medical Biotechnology, University of
Padua, 35131 Padua, Italy.
6 Department of Biology, University of Milan, Via Celoria, 20133 Milan,
Italy.
Authors for correspondence (e-mail:
ugo.borello{at}ucsf.edu;
cossu.giulio{at}hsr.it)
Accepted 3 July 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Myogenic induction, Myf5 activation, Wnt, ß-catenin, Frizzled, Sonic Hedgehog, Gli, Ep enhancer
| INTRODUCTION |
|---|
|
|
|---|
Specification of somite cell fate depends upon paracrine factors secreted
by adjacent tissues, such as the neural tube, notochord, surface ectoderm and
lateral mesoderm. Sonic hedgehog (Shh) and Wnts have been investigated in
detail as candidate molecules, although other signaling molecules, such as
Noggin and Bmp (Reshef et al.,
1998
), and intra-cellular effectors, such as Creb
(Chen et al., 2005
), also play
an important role in orchestrating the activation of myogenesis. Currently it
is still unclear whether these molecules instruct naive cells, amplify a pool
of committed progenitors and/or prevent their death
(Borycki and Emerson, Jr, 2000
;
Cossu and Borello, 1999
). We
have previously shown in explant experiments that Wnt1, produced in the dorsal
neural tube, induces myogenesis through the preferential activation of
Myf5, whereas Wnt7a or Wnt6, produced in the dorsal ectoderm,
preferentially activates Myod
(Tajbakhsh et al., 1998
). To
dissect the molecular events that lead to Myf5 activation during
development, a detailed analysis of the regulatory regions influencing
Myf5 expression has been performed
(Buchberger et al., 2003
;
Carvajal et al., 2001
;
Hadchouel et al., 2003
;
Hadchouel et al., 2000
;
Summerbell et al., 2000
;
Teboul et al., 2002
). The
Myf5 locus demonstrates complex regulation: different enhancer
modules were isolated that recapitulate the expression of Myf5 in
different domains of the developing embryo and at different stages of
development. The epaxial enhancer (Ep) is necessary and sufficient for the
expression of a lacZ reporter gene in the epaxial domain of the newly
formed somites where Myf5 is first expressed
(Summerbell et al., 2000
;
Teboul et al., 2002
). The
activity of this enhancer has been reported to depend on a consensus binding
sequence for Gli transcription factors, which transduces the Shh signal. In a
Shh null background, this enhancer was shown to be inactive,
suggesting that Shh is necessary for activation through the Ep enhancer
(Gustafsson et al., 2002
).
However, other results (Teboul et al.,
2003
) indicated that the Gli site in the enhancer is involved in
the maintenance, rather than the initiation, of Ep enhancer activity. The
effect of Shh on epaxial activation of the Myf5 gene has also been
examined in the Shh-/- mutant
(Borycki et al., 1999
;
Kruger et al., 2001
), again
with differing interpretations as to the effect on epaxial myogenesis.
Analysis of Gli mutant embryos supports the view that Gli factors
that respond to Shh signaling are involved in activation
(McDermott et al., 2005
).
Here, we report a series of experiments designed to examine the role of the
Wnt canonical pathway in myogenic determination in the somite, and the
interaction between Wnt and Shh signaling in this event. By refining the
expression analysis of potential players in canonical Wnt signaling, and by
using a combination of transfection assays, explant cultures and in vivo
analysis, we demonstrate direct regulation of Myf5 by canonical Wnt
signaling. Furthermore, we show that direct activation is mediated by binding
of the Tcf-Lef/ß-catenin complex to the Myf5 epaxial enhancer
and to a newly identified element upstream of this enhancer. The binding of
the Tcf-Lef/ß-catenin complex and Gli1 to the extended Ep (EpExt)
enhancer cooperatively activates the transcription of a reporter gene.
Furthermore, deletion of the Tcf/Lef sites and the Gli site present in the
enhancer abolishes activity in vivo. These results elucidate the molecular
mechanism of the cooperative activation of Myf5 by Wnt and Shh that
is observed in explant culture
(Munsterberg et al., 1995
;
Tajbakhsh et al., 1998
).
| MATERIALS AND METHODS |
|---|
|
|
|---|
Explants and infections
Embryos were dated taking day E0.5 as the morning of detection of the
maternal vaginal plug. For most experiments, embryos at E9.5 (20 to 24
somites) were isolated in PBS.
The explant cultures were performed as described
(Borello et al., 1999b
;
Tajbakhsh et al., 1998
). In
some experiments, somites were cultured in the presence of clones of C3H10T1/2
(ATCC number: CCL-226) previously selected for high-level expression of
Frizzled truncated proteins (tested by western blot with an anti-HA antibody).
Fz1
N (amino acids 1 to 237), Fz6
N (amino acids 1 to 163) and
Fz7
N (amino acids 1 to 185) were cloned in the pCDNA3.1 (Invitrogen)
expression vector in frame with an HA epitope sequence at the 3' end.
The Frzb1 construct was as previously described
(Borello et al., 1999b
). The
tissue explants were seeded on a layer of C3H10T1/2 cells, to which they
adhered within 10 minutes, and the dishes were then carefully transferred to
the incubator. Control experiments with C3H10T1/2 cells transfected with the
expression vector pCDNA3.1 alone had shown that C3H10T1/2 cells did not alter
the extent of myogenic differentiation under these conditions.
Lentiviral vectors were prepared as described
(Bonci et al., 2003
;
Dull et al., 1998
;
Follenzi et al., 2000
). Dp and
C ß-catenin, and CRE cDNAs were subcloned in the
pRRLsin.PPT.CMV.NTRiresGFPpre plasmid using pENV instead of VSVG as an
envelope protein for Dp and
C ß-catenin lentiviral vectors. The Dp
and
C ß-catenin virus titers were 1x106 plaque
forming units (PFU)/ml and the purified CRE titer was 5x109
PFU/ml. Control experiments indicated that, at the titer used, viral infection
of somite and PSM explants did not induce cell death as measured by TUNEL
assay (data not shown). After 6 hours of culture, the explants were infected
with a multiplicity of infection (MOI) of 100 in RPMI/15% FCS overnight and 2
nM recombinant N-Shh was added (Incardona
et al., 2000
). The N-Shh recombinant protein was titrated on
explants to determine a concentration that induced Myf5-positive cells. The
following day the medium was changed and recombinant N-Shh was added at a
final concentration of 2 nM. The explants were cultured for a total of 3 days.
The significance of the data was verified using Student's t-test,
considering P<0.05 as a significant value.
Cell transfection and luciferase assay
NIH3T3 cells (ATCC number: CRL-1658) were transfected with Lipofectamine
Plus reagent (Invitrogen) with the expression vector for the full-length cDNA
of mouse Lef1-HA, ß-catenin (gifts of Dr Grosschedl, Max Planck Institute
of Immunology, Germany), Tcf3 (gift of Dr Piccolo, University of Padua,
Italy), Gli1 and human GLI3 (gifts of Dr Sasaki, Center for Developmental
Biology, RIKEN, Japan), together with the enhancer fragments (see
Fig. 6B), cloned in the pGL3
vector (Promega) with the TK minimal promoter upstream of the firefly
luciferase gene. The vector phRL-TK (Promega) was co-transfected for
normalization. The cells were transfected in OPTIMEM (Promega) following the
manufacturer's instructions and then cultured in DMEM/10% FCS. Twenty-four
hours after the transfection the cells were harvested in lysis buffer
(Promega), and the luciferase and renilla luciferase activities were measured
using the Dual Luciferase protocol (Promega). Reporter gene activities shown
are the ratio of the average values of the reporter plus the indicated factors
and the reporter alone, obtained from at least ten independent
experiments.
Electrophoretic mobility shift assay (EMSA)
For this assay, Lef1-HA cDNA was cloned in the pCDNA3.1 vector and used as
template for Lef1 protein obtained in vitro using the T7 TNT-coupled
transcription/translation system (Promega). Translation efficiency was
analyzed by western blotting with an anti-HA antibody. DNA probes used were
complementary pairs of synthetic oligonucleotides derived from the EpExt
enhancer: TBF1-2-3 (CCTCTCTTTCTTTGTTTCTTTCTTTGTTTCTTTCTTTGTTTCTTTCT), TBF4
(CAAAAGAATTCTTTGTTCATTTC) and TBF5 (TCATGTAAAAGTCAAAGGGAACCAAA).
DNA fragments were labeled by fill-in with Klenow enzyme and
[
-32P]dCTP (3000 Ci/mmol). In the competition assays, a
100-fold excess of unlabeled TBF1-2-3, TBF4 and TBF5, or TBF1-2-3mut
(CCTCTCTTTAAATCTTTCTTTAAATCTTTTAAATCTTTCTTTAAATCTTTCTTCTTTCT), TBF4mut
(CAAAAGAATTAAATCTTCTTCTTCATTTC) and TBF5mut (TCATGTAAAAGTTATTAAGAACCAA),
oligonucleotides were added during the preincubation. For DNA binding, 5 µl
of the TNT samples and 5 fmol of radiolabeled probe were combined in 10 mM
Hepes/NaOH (pH 7.9), 50 mM NaCl, 5 mM EDTA, 1 mM DTT, 5% glycerol and 10
µg/ml of poly(dI:dC), and incubated on ice for 30 minutes. Samples were
resolved on a 6% polyacrylamide gel in 0.5xTris-Borate-EDTA and detected
by autoradiography.
Immunocytochemistry
Immunocytochemistry on cultured cells was performed as described previously
(Borello et al., 1999a
;
Brabletz et al., 2001
;
Tajbakhsh et al., 1998
), using
the following antibodies: MAb anti-ß-galactosidase (1:100; Promega), MAb
anti-CRE (1:200; Covance), MAb anti-Myf5 (undiluted; Santa Cruz), MAb anti-HA
(1:200; Covance), MAb anti-ß-catenin (1:50; Signal Transduction) and MAb
anti-Myc (undiluted; a gift of F. Tato, University of Rome, Italy).
Whole-mount in situ hybridization (WHISH)
Embryos were prepared for WHISH as previously described
(Borello et al., 1999b
).
Stained embryos were embedded in 25% gelatin and cut with a cryostat (Leica)
at 15 µm. Photographs of whole-mount stained embryos were taken with a
Leica stereomicroscope and section photographs were taken with a Leica DIC
microscope.
Optical projection tomography (OPT)
Embryos selected for 3D imaging were embedded in 1% low-melting point
agarose in water, dehydrated in methanol and cleared in Murray's clear (1:2
mixture of benzyl alcohol and benzyl benzoate). They were then scanned in an
OPT apparatus and 3D reconstructions of the data produced as described by
Sharpe et al. (Sharpe et al.,
2002
). The reconstructions were analysed using programs produced
by the Edinburgh Mouse Atlas Project
(http://genex.hgu.mrc.ac.uk).
Generation and analysis of transgenic embryos
The EpExt and the Ep constructions were created by subcloning the EpExt and
the Ep enhancers (Fig. 5),
respectively, into pHGBnlacZ, which contains the nlacZ reporter gene
driven by the human ß-globin minimal promoter obtained from the
plasmid BGZ40 (Yee and Rigby,
1993
). The construction
Ep was obtained by deleting the
TBF4 and TBF5 sites from the Ep enhancer
(Fig. 5). In the
Ep
construction, the Gli site was mutated [GACCACCAA to GACtgCagA;
(Gustafsson et al., 2002
)] to
make the
EpGm plasmid. Finally, in the
EpGT/Lm plasmid, the
non-consensus Tcf/Lef site (Fig.
5, dashed line) was deleted using as template the
EpGm
plasmid.
Plasmid fragment purification was carried out as described
(Kelly et al., 1995
).
Transgenic embryos were generated by the microinjection of purified plasmid
DNA into fertilized (C57BL/6JxSJL) F2 eggs at a concentration of about
1ng/µl using standard techniques (Hogan
et al., 1994
). Injected eggs were re-implanted the same day or the
day after the injection into outbred pseudo-pregnant foster mothers. Embryos
were recovered at E9.5 days of gestation in most cases. Transient transgenic
embryos were dated by taking the day of re-implantation as E0.5. Their age was
estimated more precisely by counting the number of somites. Embryos were
dissected in PBS, fixed in 4% paraformaldehyde for 10 minutes, rinsed three
times in PBS and stained in X-gal solution
(Tajbakhsh et al., 1996
) at
37°C overnight.
DNA was prepared from X-gal-negative embryos and analyzed by PCR, using
nlacZ primers. X-gal-stained embryos were examined as whole mounts or
after cryostat sectioning into 10 µm sections, as described previously
(Kelly et al., 1995
).
Table 1 summarizes the number
of transgenic embryos and the transgene expression obtained with the different
constructs.
|
| RESULTS |
|---|
|
|
|---|
|
|
This analysis, however, shows only the localization of mRNA for Wnt
effectors and does not indicate activity of the relative protein products. To
address this, we analyzed a Wnt/ß-catenin reporter mouse, BAT-gal, in
which Tcf/ß-catenin binding sites regulate expression of the
lacZ gene (Maretto et al.,
2003
). Staining for ß-galactosidase activity in such mice
provides a means of detecting read-out of active canonical Wnt signaling.
Staining of E9.5 embryos showed extensive reporter gene activity
(Fig. 2H). Given the stability
of the ß-galactosidase protein, we also analyzed lacZ mRNA
expression in these embryos by in situ hybridisation, to reveal more precisely
the dynamics of reporter activation. This analysis showed that the reporter
gene is strongly expressed in newly formed somites but only faintly in the PSM
(Fig. 2I). Sections of E9.5
embryos showed that ß-galactosidase expression
(Fig. 2J) and activity
(Fig. 2K) was localized
predominantly in the epaxial lip of the somite. A modified immunohistochemical
method to detect ß-catenin protein
(Brabletz et al., 2001
)
confirmed the accumulation of nuclear ß-catenin in cells of the epaxial
lip and the dermomyotome (Fig.
2L). Interestingly, the nuclear effector of the Shh pathway
Gli1 was expressed in the epaxial domain of the newly formed somites
but not in the PSM (Fig. 2M-O),
suggesting simultaneous and co-localized expression of Wnt/ß-catenin and
Shh/Gli pathway components in the newly formed somites.
Taken together with our previous analysis of the frizzled receptor genes, these data show localization of pathway effectors compatible with a role for canonical Wnt signaling in myogenic determination. Furthermore, they show that expression of Lef1 is high in the PSM where ß-catenin is not highly expressed and where the BAT-gal reporter gene is essentially silent. This opens the possibility that Lef1 alone might exert an inhibitory effect on target genes of the canonical Wnt pathway in this region when not complexed with ß-catenin.
Overexpression of an activated form of ß-catenin activates Myf5 transcription
ß-catenin accumulation in the nucleus is a necessary step for the
activation of canonical Wnt target gene transcription. A constitutively active
form of ß-catenin (Dp) was produced by mutating the Gsk3 phosphorylation
sites; this mutated form of the protein cannot be marked for degradation by
Gsk3 phosphorylation even in the absence of a canonical Wnt signal. It
therefore accumulates in the nucleus (Hsu
et al., 1998
). We infected PSM and somite explants of E9.5 embryos
(Myf5nlacZ/+) with a lentiviral vector expressing this
mutated form of ß-catenin. We used the lentiviral system because it was
found to be the most efficient system with which to deliver nuclear factors in
embryonic cells (data not shown). Cells infected with the lentiviral vector
could be identified by the expression of green fluorescent protein (GFP)
(Fig. 3B,E), and activation of
the Myf5 locus was monitored by immunolabeling with an
anti-ß-galactosidase antibody (Fig.
3C,F). We found that somite explants showed a significant increase
in the number of ß-galactosidase-positive cells after infection of the
vector expressing activated ß-catenin
(Fig. 3D-F,H), whereas PSM did
not (Fig. 3A-C,G). When the
infected explants were cultured in the presence of recombinant Shh,
Myf5-positive cells appeared in the PSM and their total number was
increased in the somites (Fig.
3G,H). A ß-catenin form, with the same mutations in the Gsk3
phosphorylation sites as DP, which lacks in addition the transcriptional
activation domain (
C), was used to abolish the
Wnt/ß-catenin-mediated transcriptional activation. Myf5
expression was seen in the presence of Shh alone and was similar to the level
seen with stabilized ß-catenin in somites
(Fig. 3H, Dp). This further
implicates ß-catenin transcriptional activity, together with Shh
signaling, in the regulation of Myf5 expression, and shows that
somite explants respond to stabilized ß-catenin alone. By contrast, PSM
explants only respond when Shh is present. ß-catenin has virtually no
effect alone, possibly because of the repressor activity of Gli3 at this stage
in the absence of Shh (McDermott et al.,
2005
). In somite explants, Gli proteins have responded to Shh and
Myf5 is already activated, so the situation is rather different.
|
|
Analysis of the epaxial enhancer sequence
To examine the molecular basis of the role of Wnt/ß-catenin in
Myf5 activation, we analyzed transcriptional control sequences of the
Myf5 locus for Tcf/Lef binding sites. Previous work on the
Myf5 locus demonstrated that it is under a complex regulation
(Buchberger et al., 2003
;
Hadchouel et al., 2003
;
Hadchouel et al., 2000
;
Summerbell et al., 2000
;
Teboul et al., 2002
).
Different enhancer modules recapitulate the expression of Myf5 in
different domains and at different stages of the developing embryo. One of
these enhancers (named Ep) drives the expression of a lacZ reporter
gene in the epaxial domain of newly formed somites where Myf5 is
first expressed (Summerbell et al.,
2000
; Teboul et al.,
2002
). The Ep sequence (Fig.
5A) shows a motif (TBF4) that matches the Tcf/Lef consensus
(A/T)(A/T)CAAAG. At the 3' end, another element (TBF5) has a single
mismatch with a C instead of the first A/T of the Tcf/Lef binding consensus
core. In addition, further analysis of the surrounding genomic sequence
revealed three additional Tcf/Lef consensus sites (TBF1-TBF3) with an
intersite spacing of 10 base pairs located upstream of the Ep enhancer
(Fig. 5A). We have named the
extended Ep enhancer, including the upstream potential binding sites
TBF1-TBF3, EpExt.
The significance of these Tcf/Lef consensus sequences as potential targets of the Wnt/ß-catenin pathway was first investigated by in vitro binding of Lef1. In an electrophoretic mobility shift assay, recombinant Lef1, tagged with the HA epitope (specifically recognized by an anti-HA antibody), bound efficiently to labeled oligonucleotides representing each of the putative target sites. The three closely linked binding sites (TBF1-TBF3) were assayed with a single oligonucleotide. The specificity of binding was confirmed by competition for Lef1 binding by excess unlabeled oligonucleotide, and by the failure of an oligonucleotide containing a mutated binding site to compete (Fig. 5B).
To analyze the ability of the Tcf/Lef binding sites within the extended Ep
enhancer to drive reporter gene activity in response to Lef1 and
ß-catenin, we transfected NIH3T3 fibroblasts with ß-catenin and Lef1
expression constructs, together with reporter constructs driven by various
regions of the EpExt enhancer (Fig.
6A,B). Co-expression of ß-catenin and Lef1 enhanced the
expression of the luciferase gene driven by all tested Ep and EpExt enhancers
possessing Tcf/Lef binding sites, when compared with the activity of the TK
minimal promoter alone (Fig.
6A). The fragments containing only Tcf/Lef binding sites
(
1-3) were activated by the Lef1/ß-catenin complex, but to a
lesser extent than the more complete enhancers. Fragment
4, containing
the TBF5 Tcf/Lef binding site and the Gli site, had an intermediate activity.
Surprisingly, the fragment containing the isolated Gli site alone (
5)
mediated some transcriptional activity. This low activity might be due to
inefficient binding of the Lef1/ß-catenin complex to a non-consensus site
identified in the fragment, under the conditions of this assay
(Fig. 5A, dashed line; data not
shown).
|
To investigate cooperation of the Wnt/ß-catenin and Shh/Gli pathways
at the transcriptional level, we compared the transcriptional activity of the
Ep enhancer containing the Gli binding site (GBF)
(Gustafsson et al., 2002
;
Teboul et al., 2003
) to the
EpExt enhancer described here that presents additional binding sites for
canonical Wnt mediators (Figs
5,
6). In this assay system, we
co-expressed different combinations of: (1) either stabilized (Dp) or
dominant-negative ß-catenin (
C); (2) either Lef1 or a
dominant-negative form of Lef1 [Lef1 lacking the ß-catenin binding domain
(Tutter et al., 2001
)]; and
(3) either Gli1 or Gli3, mediators of the Shh pathway. Gli1 was reported to
activate Shh target genes, whereas Gli3 was shown to repress the transcription
of some target genes (Ruiz i Altaba,
1999
) and notably represses Myf5 in the absence of Shh
(McDermott et al., 2005
).
Fig. 6C,D shows that in
transfected NIH3T3 cells the combined effect of Wnt and Shh effectors is
additive through the Ep enhancer but is clearly synergistic through EpExt. To
further investigate the dynamics of co-operation between Wnt and Shh pathways
in regulating Myf5, we co-transfected combinations of positive or
negative mediators of each pathway (Fig.
6E,F). Again, the EpExt was more responsive to changes in the
balance of contributory factors. Although the effect of inhibiting one or the
other pathway on the Ep construct was small, a large reduction in
transactivation was seen through EpExt. Another interesting difference between
the two constructs was the effect of mutating ß-catenin and Lef1. With a
Lef1 dominant-negative mutant (N-terminal deletion) and Gli1, the enhancer
activity is reduced almost to basal level. This Lef1 dominant-negative mutant
was demonstrated to act as a strong repressor of the Wnt/ß-catenin
pathway (Billin et al., 2000
).
By contrast, the effect of a dominant-negative mutation in ß-catenin
(
C) was significantly less, indicating that either the
Lef1/ß-catenin complex or Gli are not sufficient to transactivate the
enhancers when acting alone. Again this effect was more exaggerated with the
EpExt construct (Fig. 6F).
These data suggest that, in vitro, Wnt/ß-catenin regulates the
Shh-mediated transcriptional activation of the enhancer through two
alternative Lef1 conformations: Lef1 bound to DNA and complexed with
ß-catenin acting as a cooperative factor for Gli-mediated transcriptional
activation, or Lef1 bound to DNA without ß-catenin acting as a repressor
of Gli1 activation. This hypothesis is also supported by the finding that
Lef1
N repression is partly reverted by TSA and valproic acid (data not
shown), inhibitors of the HDAC proteins that were demonstrated to form a
complex with Lef1 alone to block transcription at the DNA level
(Billin et al., 2000
), a
process implicated in muscle development
(Iezzi et al., 2002
;
Nervi et al., 2001
). These
results suggest that Lef1, complexed with co-repressors, can strongly inhibit
the transcriptional activity of the EpExt enhancer; however, when complexed
with an active form of ß-catenin, Lef1 strongly activates transcription
through cooperation with Gli1.
|
Ep (
5), which has the 5' and 3' ends deleted,
removing Tcf/Lef consensus sites. Transgene expression was reduced but still
present (Fig. 7C) in these
embryos. When the Gli site was mutated in
EpGm, activity was mainly
undetectable in somites at E9.5, apart from a few labeled cells
(Fig. 7D), although at earlier
stages (7 or 17 somite embryos) more labeled cells were present in some
embryos (see Table 1). This
suggests that in this truncated Ep enhancer the Gli site may be less important
initially. This sequence contains a non-consensus Tcf/Lef site
(Fig. 5A, dashed line). When
both this site and the Gli site were mutated (
EpGT/Lm), no
ß-galactosidase-positive cells were detected in the somites
(Fig. 7E). This demonstrates
that canonical Wnt signaling plays a crucial role in the expression of the Ep
enhancer in the embryo. | DISCUSSION |
|---|
|
|
|---|
90%).
Expression of a stabilized form of ß-catenin induced Myf5
activation in explants of somites but not of PSM.
|
Wnt and Shh converge on the same epaxial enhancer
To investigate the mechanism of Wnt/ß-catenin in Myf5
activation, we analyzed the early epaxial enhancer where a Gli site regulates
transcription (Gustafsson et al.,
2002
; McDermott et al.,
2005
; Teboul et al.,
2002
). This region contains two canonical Tcf/Lef binding sites,
as well as three additional sites at the 5' end, described in this
paper. In our assay, all these sites were able to bind Lef1 specifically and
mediated Lef/ß-catenin transcriptional activation in transiently
transfected non-myogenic cells.
In the extended Myf5 enhancer EpExt, a dominant-negative form of
Lef1 strongly inhibits transcriptional activation, supporting the notion that
integrity of the Lef/ß-catenin complex is essential in this context.
Although deletion analysis revealed a similar level of activation for the
different Tcf/Lef binding sites, co-expression of a constitutively active
ß-catenin gene and Gli revealed a striking synergistic effect on
the extended epaxial enhancer in comparison with the epaxial enhancer, where
the effect was additive. This is in keeping with previous observations on the
co-operative effects of Wnt and Shh signaling in explant cultures
(Munsterberg et al., 1995
;
Tajbakhsh et al., 1998
). We
suggest that the role of the additional Tcf/Lef binding sites of the EpExt
enhancer is to finely tune the Shh signal during the activation of
Myf5. The alternative binding of Lef1 complexed with either Groucho
repressor factors or with the activator ß-catenin may induce
conformational changes in the region of the EpExt enhancer, allowing Gli
factors to bind to DNA only when ß-catenin is part of the complex. This
mechanism of co-regulation was demonstrated for the Cdx1 promoter,
where the specificity of transcriptional activation is generated by TCF4E,
inducing a promoter topology compatible with the binding of a
transcriptionally active multiprotein complex
(Hecht and Stemmler, 2003
). In
transgenic embryos, we observed that lacZ expression under the
control of the EpExt enhancer was more restricted to the epaxial domain of the
somite, whereas the Ep enhancer directed broader transgene expression in the
dermomyotome (Teboul et al.,
2002
). This suggests that the EpExt element may provide the
correct balance of elements to ensure Myf5 activation in an
appropriately restricted domain. Furthermore, deletion analysis demonstrated
that both the Tcf/Lef sites and the Gli site play a role in the expression of
the transgene, in keeping with the explant and cell culture experiments.
Our results show that, in the absence of both the Gli and the Tcf/Lef
binding sites that we have identified, activation does not occur, indicating
that both of these signaling pathways are necessary for the onset of
myogenesis in the epaxial domain of the somite. Deletion of a non-consensus
Tcf/Lef site immediately adjacent to the Gli site was necessary to completely
abolish the basal level of transcription observed both in vitro
(Fig. 6A,
5) and in vivo
(Fig. 7D,E). Other sub-optimal
Tcf/Lef consensus sites that we have not analysed may also contribute to
activation of the enhancer by Wnts. However, our results indicate that a
threshold level of Tcf/ß-catenin input is necessary for activation, and
that epaxial expression of the transgene is optimal in the presence of more
than one site, together with the Gli binding sequence.
A unifying model for Myf5 activation in the epaxial domain of newly formed somites
The data reported in this work, together with previous reports, allows us
to propose a relatively simple model for the activation of Myf5 by
Gli and Lef/ß-catenin-mediated signaling in newly formed somites. We do
not suggest that this working model is complete; other unidentified factors
may also contribute to this system. Indeed, in vivo, the Gli site in the
epaxial enhancer may respond to other signals
(Teboul et al., 2003
). In the
absence of both Shh and Gli3, epaxial Myf5 expression is observed,
suggesting that Gli activity, required for expression, may depend on other
signal pathways (McDermott et al.,
2005
), which may involve Wnt signaling.
We suggest that in the PSM in the absence or presence of a low level of ß-catenin, Lef1 and/or other Tcfs act as transcriptional repressors, or at least fail to support full transcriptional activity. At the onset of somitogenesis, the activation of Gli1-mediated signal together with the Wnt/ß-catenin pathway leads to the correct activation of Myf5 transcription in the epaxial domain.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Anakwe, K., Robson, L., Hadley, J., Buxton, P., Church, V.,
Allen, S., Hartmann, C., Harfe, B., Nohno, T., Brown, A. M. et al.
(2003). Wnt signalling regulates myogenic differentiation in the
developing avian wing. Development
130,3503
-3514.
Austin, T. W., Solar, G. P., Ziegler, F. C., Liem, L. and
Matthews, W. (1997). A role for the Wnt gene family in
hematopoiesis: expansion of multilineage progenitor cells.
Blood 89,3624
-3635.
Billin, A. N., Thirlwell, H. and Ayer, D. E.
(2000). Beta-catenin-histone deacetylase interactions regulate
the transition of LEF1 from a transcriptional repressor to an activator.
Mol. Cell. Biol. 20,6882
-6890.
Bonci, D., Cittadini, A., Latronico, M. V., Borello, U., Aycock, J. K., Drusco, A., Innocenzi, A., Follenzi, A., Lavitrano, M., Monti, M. G. et al. (2003). `Advanced' generation lentiviruses as efficient vectors for cardiomyocyte gene transduction in vitro and in vivo. Gene Ther. 10,630 -636.[CrossRef][Medline]
Borello, U., Buffa, V., Sonnino, C., Melchionna, R., Vivarelli, E. and Cossu, G. (1999a). Differential expression of the Wnt putative receptors Frizzled during mouse somitogenesis. Mech. Dev. 89,173 -177.[CrossRef][Medline]
Borello, U., Coletta, M., Tajbakhsh, S., Leyns, L., De Robertis, E. M., Buckingham, M. and Cossu, G. (1999b). Transplacental delivery of the Wnt antagonist Frzb1 inhibits development of caudal paraxial mesoderm and skeletal myogenesis in mouse embryos. Development 126,4247 -4255.[Abstract]
Borycki, A. G. and Emerson, C. P., Jr (2000). Multiple tissue interactions and signal transduction pathways control somite myogenesis. Curr. Top. Dev. Biol. 48,165 -224.[Medline]
Borycki, A. G., Brunk, B., Tajbakhsh, S., Buckingham, M., Chiang, C. and Emerson, C. P., Jr (1999). Sonic hedgehog controls epaxial muscle determination through Myf5 activation. Development 126,4053 -4063.[Abstract]
Boutros, M., Paricio, N., Strutt, D. I. and Mlodzik, M. (1998). Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94,109 -118.[CrossRef][Medline]
Brabletz, T., Jung, A., Reu, S., Porzner, M., Hlubek, F.,
Kunz-Schughart, L. A., Knuechel, R. and Kirchner, T. (2001).
Variable beta-catenin expression in colorectal cancers indicates tumor
progression driven by the tumor environment. Proc. Natl. Acad. Sci.
USA 98,10356
-10361.
Brandon, C., Eisenberg, L. M. and Eisenberg, C. A.
(2000). WNT signaling modulates the diversification of
hematopoietic cells. Blood
96,4132
-4141.
Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P., Sommer, L., Boussadia, O. and Kemler, R. (2001). Inactivation of the ß-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128,1253 -1264.[Abstract]
Buchberger, A., Nomokonova, N. and Arnold, H. H.
(2003). Myf5 expression in somites and limb buds of mouse embryos
is controlled by two distinct distal enhancer activities.
Development 130,3297
-3307.
Carvajal, J. J., Cox, D., Summerbell, D. and Rigby, P. W. (2001). A BAC transgenic analysis of the Mrf4/Myf5 locus reveals interdigitated elements that control activation and maintenance of gene expression during muscle development. Development 128,1857 -1868.[Abstract]
Chen, A. E., Ginty, D. D. and Fan, C. M. (2005). Protein kinase A signalling via CREB controls myogenesis induced by Wnt proteins. Nature 433,317 -322.[CrossRef][Medline]
Cossu, G. and Borello, U. (1999). Wnt signaling and the activation of myogenesis in mammals. EMBO J. 18,6867 -6872.[CrossRef][Medline]
Dickinson, M. E., Krumlauf, R. and McMahon, A. P. (1994). Evidence for a mitogenic effect of Wnt-1 in the developing mammalian central nervous system. Development 120,1453 -1471.[Abstract]
Dorsky, R. I., Sheldahl, L. C. and Moon, R. T. (2002). A transgenic Lef1/beta-catenin-dependent reporter is expressed in spatially restricted domains throughout zebrafish development. Dev. Biol. 241,229 -237.[CrossRef][Medline]
Dull, T., Zufferey, R., Kelly, M., Mandel, R. J., Nguyen, M.,
Trono, D. and Naldini, L. (1998). A third-generation
lentivirus vector with a conditional packaging system. J.
Virol. 72,8463
-8471.
Follenzi, A., Ailles, L. E., Bakovic, S., Geuna, M. and Naldini, L. (2000). Gene transfer by lentiviral vectors is limited by nuclear translocation and rescued by HIV-1 pol sequences. Nat. Genet. 25,217 -222.[CrossRef][Medline]
Galceran, J., Farinas, I., Depew, M. J., Clevers, H. and
Grosschedl, R. (1999). Wnt3a-/-like
phenotype and limb deficiency in
Lef1-/-Tcf1-/- mice. Genes
Dev. 13,709
-717.
Geetha-Loganathan, P., Nimmagadda, S., Prols, F., Patel, K., Scaal, M., Huang, R. and Christ, B. (2005). Ectodermal Wnt-6 promotes Myf5-dependent avian limb myogenesis. Dev. Biol. 288,221 -233.[CrossRef][Medline]
Gunhaga, L., Marklund, M., Sjodal, M., Hsieh, J. C., Jessell, T. M. and Edlund, T. (2003). Specification of dorsal telencephalic character by sequential Wnt and FGF signaling. Nat. Neurosci. 7,701 -707.
Gustafsson, M. K., Pan, H., Pinney, D. F., Liu, Y., Lewandowski,
A., Epstein, D. J. and Emerson, C. P., Jr (2002). Myf5 is a
direct target of long-range Shh signaling and Gli regulation for muscle
specification. Genes Dev.
16,114
-126.
Hadchouel, J., Tajbakhsh, S., Primig, M., Chang, T. H., Daubas, P., Rocancourt, D. and Buckingham, M. (2000). Modular long-range regulation of Myf5 reveals unexpected heterogeneity between skeletal muscles in the mouse embryo. Development 127,4455 -4467.[Abstract]
Hadchouel, J., Carvajal, J. J., Daubas, P., Bajard, L., Chang,
T., Rocancourt, D., Cox, D., Summerbell, D., Tajbakhsh, S., Rigby, P. W. et
al. (2003). Analysis of a key regulatory region upstream of
the Myf5 gene reveals multiple phases of myogenesis, orchestrated at each site
by a combination of elements dispersed throughout the locus.
Development 130,3415
-3426.
Hecht, A. and Stemmler, M. P. (2003).
Identification of a promoter-specific transcriptional activation domain at the
C terminus of the Wnt effector protein T-cell factor 4. J. Biol.
Chem. 278,3776
-3785.
Hogan, B., Costantini, F. and Lacy, E. (1994). Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Hsu, S. C., Galceran, J. and Grosschedl, R.
(1998). Modulation of transcriptional regulation by LEF-1 in
response to Wnt-1 signaling and association with beta-catenin. Mol.
Cell. Biol. 18,4807
-4818.
Huelsken, J. and Birchmeier, W. (2001). New aspects of Wnt signaling pathway in higher vertebrates. Curr. Opin. Genet. Dev. 11,547 -553.[CrossRef][Medline]
Iezzi, S., Cossu, G., Nervi, C., Sartorelli, V. and Puri, P.
L. (2002). Stage-specific modulation of skeletal myogenesis
by inhibitors of nuclear deacetylases. Proc. Natl. Acad. Sci.
USA 99,7757
-7762.
Ikeya, M., Lee, S. M., Johnson, J. E., McMahon, A. P. and Takada, S. (1997). Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389,966 -970.[CrossRef][Medline]
Incardona, J. P., Gaffield, W., Lange, Y., Cooney, A., Pentchev, P. G., Liu, S., Watson, J. A., Kapur, R. P. and Roelink, H. (2000). Cyclopamine inhibition of Sonic hedgehog signal transduction is not mediated through effects on cholesterol transport. Dev. Biol. 224,440 -452.[CrossRef][Medline]
Kardon, G., Harfe, B. D. and Tabin, C. J. (2003). A Tcf4-positive mesodermal population provides a prepattern for vertebrate limb muscle patterning. Dev. Cell 5,937 -944.[CrossRef][Medline]
Kelly, R., Alonso, S., Tajbakhsh, S., Cossu, G. and Buckingham,
M. (1995). Myosin light chain 3F regulatory sequences confer
regionalized cardiac and skeletal muscle expression in transgenic mice.
J. Cell Biol. 129,383
-396.
Kruger, M., Mennerich, D., Fees, S., Schafer, R., Mundlos, S. and Braun, T. (2001). Sonic hedgehog is a survival factor for hypaxial muscles during mouse development. Development 128,743 -752.[Abstract]
Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R. and Moon, R. T. (2000). The Wnt/Ca2+ pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet. 16,279 -283.[CrossRef][Medline]
Lallemand, Y., Luria, V., Haffner-Krausz, R. and Lonai, P. (1998). Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res. 7,105 -112.[CrossRef][Medline]
Lisovsky, M., Itoh, K. and Sokol, S. Y. (2002). Frizzled receptors activate a novel JNK-dependent pathway that may lead to apoptosis. Curr. Biol. 12, 53-58.[CrossRef][Medline]
Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P.,
Broccoli, V., Hassan, A. B., Volpin, D., Bressan, G. M. and Piccolo, S.
(2003). Mapping Wnt/beta-catenin signaling during mouse
development and in colorectal tumors. Proc. Natl. Acad. Sci.
USA 100,3299
-3304.
McDermott, A., Gustafsson, M., Elsam, T., Hui, C. C., Emerson,
C. P., Jr and Borycki, A. G. (2005). Gli2 and Gli3 have
redundant and context-dependent function in skeletal muscle formation.
Development 132,345
-357.
Miller, J. R., Hocking, A. M., Brown, J. D. and Moon, R. T. (1999). Mechanism and function of signal transduction by the Wnt/beta-catenin and Wnt/Ca2+ pathways. Oncogene 18,7860 -7872.[CrossRef][Medline]
Moon, R. T., Brown, J. D. and Torres, M. (1997). WNTs modulate cell fate and behavior during vertebrate development. Trends Genet. 13,157 -162.[CrossRef][Medline]
Munsterberg, A. E. and Lassar, A. B. (1995). Combinatorial signals from the neural tube, floor plate and notochord induce myogenic bHLH gene expression in the somite. Development 121,651 -660.[Abstract]
Munsterberg, A. E., Kitajewski, J., Bumcrot, D. A., McMahon, A.
P. and Lassar, A. B. (1995). Combinatorial signaling by Sonic
hedgehog and Wnt family members induces myogenic bHLH gene expression in the
somite. Genes Dev. 9,2911
-2922.
Muroyama, Y., Fujihara, M., Ikeya, M., Kondoh, H. and Takada,
S. (2002). Wnt signaling plays an essential role in neuronal
specification of the dorsal spinal cord. Genes Dev.
16,548
-553.
Nervi, C., Borello, U., Fazi, F., Buffa, V., Pelicci, P. G. and
Cossu, G. (2001). Inhibition of histone deacetylase activity
by trichostatin A modulates gene expression during mouse embryogenesis without
apparent toxicity. Cancer Res.
61,1247
-1249.
Nordstrom, U., Jessell, T. M. and Edlund, T. (2002). Progressive induction of caudal neural character by graded Wnt signaling. Nat. Neurosci. 5, 525-532.[CrossRef][Medline]
Pandur, P., Maurus, D. and Kuhl, M. (2002). Increasingly complex: new players enter the Wnt signaling network. BioEssays 24,881 -884.[CrossRef][Medline]
Reshef, R., Maroto, M. and Lassar, A. B.
(1998). Regulation of dorsal somitic cell fates: BMPs and Noggin
control the timing and pattern of myogenic regulator expression.
Genes Dev. 12,290
-303.
Reya, T., Duncan, A. W., Ailles, L., Domen, J., Scherer, D. C., Willert, K., Hintz, L., Nusse, R. and Weissman, I. L. (2003). A role for Wnt signalling in self-renewal of haematopoietic stem cells. Nature 423,409 -414.[CrossRef][Medline]
Ruiz i Altaba, A. (1999). Gli proteins encode context-dependent positive and negative functions: implications for development and disease. Development 126,3205 -3216.[Abstract]
Schmidt, M., Tanaka, M. and Munsterberg, A. (2000). Expression of (beta)-catenin in the developing chick myotome is regulated by myogenic signals. Development 127,4105 -4113.[Abstract]
Sharpe, J., Ahlgren, U., Perry, P., Hill, B., Ross, A.,
Hecksher-Sorensen, J., Baldock, R. and Davidson, D. (2002).
Optical projection tomography as a tool for 3D microscopy and gene expression
studies. Science 296,541
-545.
Summerbell, D., Ashby, P. R., Coutelle, O., Cox, D., Yee, S. and Rigby, P. W. (2000). The expression of Myf5 in the developing mouse embryo is controlled by discrete and dispersed enhancers specific for particular populations of skeletal muscle precursors. Development 127,3745 -3757.[Abstract]
Tajbakhsh, S., Bober, E., Babinet, C., Pournin, S., Arnold, H. and Buckingham, M. (1996). Gene targeting the myf-5 locus with nlacZ reveals expression of this myogenic factor in mature skeletal muscle fibres as well as early embryonic muscle. Dev. Dyn. 206,291 -300.[CrossRef][Medline]
Tajbakhsh, S., Borello, U., Vivarelli, E., Kelly, R., Papkoff, J., Duprez, D., Buckingham, M. and Cossu, G. (1998). Differential activation of Myf5 and MyoD by different Wnts in explants of mouse paraxial mesoderm and the later activation of myogenesis in the absence of Myf5. Development 125,4155 -4162.[Abstract]
Teboul, L., Hadchouel, J., Daubas, P., Summerbell, D.,
Buckingham, M. and Rigby, P. W. (2002). The early epaxial
enhancer is essential for the initial expression of the skeletal muscle
determination gene Myf5 but not for subsequent, multiple phases of somitic
myogenesis. Development
129,4571
-4580.
Teboul, L., Summerbell, D. and Rigby, P. W.
(2003). The initial somitic phase of Myf5 expression requires
neither Shh signaling nor Gli regulation. Genes Dev.
17,2870
-2874.
Tutter, A. V., Fryer, C. J. and Jones, K. A.
(2001). Chromatin-specific regulation of LEF-1-beta-catenin
transcription activation and inhibition in vitro. Genes
Dev. 15,3342
-3354.
Wagner, J., Schmidt, C., Nikowits, W., Jr and Christ, B. (2000). Compartmentalization of the somite and myogenesis in chick embryos are influenced by wnt expression. Dev. Biol. 228,86 -94.[CrossRef][Medline]
Wodarz, A. and Nusse, R. (1998). Mechanisms of Wnt signaling in development. Annu. Rev. Cell Dev. Biol. 14,59 -88.[CrossRef][Medline]
Yamanaka, H., Moriguchi, T., Masuyama, N., Kusakabe, M., Hanafusa, H., Takada, R., Takada, S. and Nishida, E. (2002). JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates. EMBO Rep. 3, 69-75.[CrossRef][Medline]
Yee, S. P. and Rigby, P. W. (1993). The
regulation of myogenin gene expression during the embryonic development of the
mouse. Genes Dev. 7,1277
-1289.
This article has been cited by other articles:
![]() |
G. Messina and G. Cossu The origin of embryonic and fetal myoblasts: a role of Pax3 and Pax7 Genes & Dev., April 15, 2009; 23(8): 902 - 905. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Hutcheson, J. Zhao, A. Merrell, M. Haldar, and G. Kardon Embryonic and fetal limb myogenic cells are derived from developmentally distinct progenitors and have different requirements for {beta}-catenin Genes & Dev., April 15, 2009; 23(8): 997 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lagha, T. Sato, L. Bajard, P. Daubas, M. Esner, D. Montarras, F. Relaix, and M. Buckingham Regulation of Skeletal Muscle Stem Cell Behavior by Pax3 and Pax7 Cold Spring Harb Symp Quant Biol, November 6, 2008; (2008) sqb.2008.73.006v1. [Abstract] [PDF] |
||||
![]() |
A. Perez-Ruiz, Y. Ono, V. F. Gnocchi, and P. S. Zammit {beta}-catenin promotes self-renewal of skeletal-muscle satellite cells J. Cell Sci., May 1, 2008; 121(9): 1373 - 1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Alvarez-Medina, J. Cayuso, T. Okubo, S. Takada, and E. Marti Wnt canonical pathway restricts graded Shh/Gli patterning activity through the regulation of Gli3 expression Development, January 15, 2008; 135(2): 237 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Buchberger, D. Freitag, and H.-H. Arnold A homeo-paired domain-binding motif directs Myf5 expression in progenitor cells of limb muscle Development, March 15, 2007; 134(6): 1171 - 1180. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||