|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 30 August 2006
doi: 10.1242/dev.02551
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Pathology and Immunology, Washington University School of
Medicine, 660 S. Euclid Avenue, St Louis, MO 63110, USA.
2 Center for Developmental Biology, University of Texas Southwestern Medical
Center, Dallas, TX 75390-9133, USA.
3 Howard Hughes Medical Institute, Washington University School of Medicine, 660
S. Euclid Avenue, St Louis, MO 63110, USA.
* Author for correspondence (kmurphy{at}pathology.wustl.edu)
Accepted 26 July 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Wnt, ES cell, Mesoderm
| INTRODUCTION |
|---|
|
|
|---|
Among these signaling pathways, the precise mechanism of Wnt signaling in
promoting specific programs of gene expression is least clear. Wnt activity is
generally thought to induce target genes directly via the
ß-catenin-dependent conversion of TCF family transcription factors from a
repressive to an active state (Eastman and
Grosschedl, 1999
). Alternatively, it has been proposed that Wnt
signaling possesses little intrinsic capacity to activate gene expression, but
rather functions in part by modifying or stabilizing the effector activity of
other factors (Arias and Hayward,
2006
). In mice that lack Tcf3, for example, embryos
develop expanded and duplicated axial mesodermal structures, consistent with
the suggestion that Wnt signaling during anteroposterior axis formation acts
to relieve basal repression of posterior genes, allowing their further
activation by secondary signals (Merrill
et al., 2004
).
Canonical Wnt signaling is absolutely required for primitive streak
formation. Mice deficient in the canonical ligand Wnt3, in the Wnt
co-receptors Lrp5/6 or in the intracellular effector of canonical Wnt
signaling, ß-catenin, all fail to develop a primitive streak and lack
mesoderm (Huelsken et al.,
2000
; Kelly et al.,
2004
; Liu et al.,
1999
). Despite this clear role of Wnt signaling during early
embryogenesis in vivo, no requirement for Wnt signaling in regulating
analogous stages of ES cell differentiation has been described
(Keller, 2005
). However, a
role for Wnt signaling in ES cell-derived germ layer induction has been
suggested by studies showing that Wnt signaling can induce expression of at
least one primitive streak gene and can antagonize neuronal differentiation
(Arnold et al., 2000
;
Aubert et al., 2002
).
Although embryos possess defined axes that orient the embryonic and
extra-embryonic tissues, and generate gradients of morphogen activity, ES
cells differentiate without discernible axes and lack tissue components such
as extra-embryonic ectoderm required for gastrulation in vivo. Nonetheless,
differentiating ES cells are considered to approximate the differentiating
epiblast and are capable of generating derivatives of all three embryonic germ
layers (Keller, 2005
).
Together, these properties enable examination of the mechanisms of signaling
pathways during discrete developmental transitions in the absence of
asymmetric embryonic structures and signaling centers
(Johansson and Wiles, 1995
;
Kubo et al., 2004
;
Li et al., 2004
). We therefore
sought to characterize the actions of Wnt signaling in regulating features of
in vitro ES cell differentiation that may be analogous to primitive streak
formation in vivo.
In this study, we report that the requirement for canonical Wnt signaling during germ layer induction in vivo is maintained in the ES cell model of this developmental transition. Specifically, inhibition of endogenous Wnt activity completely blocks expression of primitive streak-, EMT-, endoderm- and mesoderm-associated genes, and abrogates functional development of mature mesodermal lineages. We find that a stabilized form of ß-catenin is alone insufficient to promote primitive streak-associated gene expression. Instead, our results suggest that Wnt signaling may function cooperatively to regulate responsiveness to Bmp and/or Nodal signaling during germ layer induction.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ATG resistance
gene targeted to the Hprt locus.
For differentiation, ES cells were plated in suspension at
1.5x104 cells/ml in either serum-containing medium (SCM: IMDM
with 10% FCS, NEAA, L-glutamine, NaPyruvate, Pen/Strep and 2-mercaptoethanol)
or serum-free medium (SRM), where FCS was replaced with 10% Knockout Serum
Replacement (Invitrogen), and supplemented where indicated with recombinant
human (rh) Bmp2 (5 ng/ml), rhBmp4 (5 ng/ml), recombinant mouse (rm) Fgf8 (10
ng/ml), rhFgfb (10 ng/ml), rm cripto (100 ng/ml), rmNodal (5 ng/ml),
rhTGFß1 (5 ng/ml), rmFst (50 ng/ml), rmFz1/Fc (500 ng/ml), rmFz2/Fc (500
ng/ml), rmFz7/Fc (500 ng/ml), rmFz8/Fc (500 ng/ml), noggin/Fc (500 ng/ml),
rhSfrp1 (200 ng/ml), all purchased from R&D Systems. Recombinant DKK1 was
either purchased from R&D Systems or prepared by transient transfection of
293F/T cells. Except where indicated, recombinant Dkk1-His was added at
1x, defined as the concentration required to inhibit generation of
Flk1-expressing cells in SCM through day 5 (
160-200 ng/ml, depending on
batch; see Fig. S1A in the supplementary material).
Hematopoietic colony assays were initiated at day 6. Embryoid bodies were
dissociated enzymatically using trypsin/EDTA (0.05%/0.02%) and inoculated into
semisolid medium containing Scf, Epo, Il3 and Il6 (M3434; Stem Cell
Technologies). Based on characteristic colony morphology and developmental
kinetics, we enumerated primitive erythroid and definitive hematopoietic
colonies at day 12 and day 16, respectively
(Kyba et al., 2003
). To
analyze differentiation of cardiomyocytes, embryoid bodies were transferred at
day 4 of differentiation in SCM to gelatinized plates in SRM and assayed for
lineage-specific gene expression at between day 6 and day 8
(Kouskoff et al., 2005
).
Generation of A2lox.sbcat, A2lox.TOPFlash and A2lox.FOPFlash ES cell lines
A2lox.sßcat
A 2363 bp PCR product was generated using the following primers: bcat-F,
GACAATGGCTACTCAAGCTGACCTGA; bcat-R, CCTAAAGGACGATTTACAGGTCAGTATCAAA. DMSO (5%
Sigma), 1 M Betaine (Sigma) and cDNA prepared from day 5 embryoid bodies was
ligated into the pGEM®-T Easy Vector (Promega) to generate the plasmid
Teasy-bcat. Four point mutations were introduced by serial application of
Quick Change Mutagenesis (Stratagene) using the following primers to generate
Teasy-sbcat: F1, ATGCTGGAATCCATGCTGGTGCCACCACCACAGCTCCTT; R1,
CACCAGCATGGATTCCAGCATCCAAGTAAGACTGCTGC; F2, GGTGCCACCGCCACAGCTCCTGCCCTGAGTG;
R2, CTTGCCACTCAGGGCAGGAGCTGTGGCGGTGG. A PCR product generated using the
primers bcat-F and bcat-R and Teasy-sbcat was phosphorylated using T4PNK and
ligated into the plasmid SmaI-digested p2lox-empty to generate
p2lox.sbcat. After targeting to A2lox ES cells, A2lox.sbcat clones were
evaluated for capacity to activate SUPER8XTOPFlash reporter activity, and
promote cell growth and viability upon doxycycline induction (see Fig. S2 in
the supplementary material).
A2lox.TOPFlash and A2lox.FOPFlash
A NotI/BamH1 digested fragment from
SUPER8xTOPFlash, a gift from Randall T. Moon (University of Washington),
was blunted and ligated into blunted NotI-cut p2lox-empty resulting
in the plasmid p2lox-TOPFlash. After targeting to A2lox ES cells, the locus
consisted of TRE followed by a polyA site, a transcriptional pause, eight
multimerized Tcf/Lef-binding sites, firefly luciferase and 2 polyA signals.
The plasmid p2lox-FOPFlash was generated similarly.
Recombinant Dkk1-His
A PCR product generated using the primers 5'H3Dkk1
(CCAAAGCTTCGGAGATGATGGTTGTGTG) and 3'Age1Dkk1
(GCAACCGGTGTGTCTCTGGCAGGTGTGGA) and cDNA from day 4 embryoid bodies was
digested with HindIII and AgeI and ligated into
HindIII- and AgeI-digested pcDNA4-myc-hisA to generate a
C-terminal 6His tag in frame with full length Dkk1. The resulting plasmid,
pcDNA-Dkk1-his, was transfected into 293F/T cells (Invitrogen) using
Ca2PO4 precipitation. Supernatants from transfected
cells were adjusted to pH 8.0 by the addition of 1/3 volume of 1x Ni-NTA
binding buffer and then purified on Ni-NTA HisBind resin (Novagen). Purified
Dkk1-his was dialyzed against two changes of PBS, and was shown to consist
predominantly of a closely spaced doublet
(Mr=35x103) that was recognized by an
antibody to penta-His (Qiagen) on Western analysis (Fig. S1E,F). Activity of
purified Dkk1-his was confirmed by ability to inhibit SUPER8xTOPFlash
reporter activity. Dkk1-his and commercially available Dkk1 were further
demonstrated to display no substantial cytotoxic effects.
Immunofluorescence
For EMT analysis, cells were transferred at day 4 to plates containing
gelatinized cover slips in SRM. Adherent colonies were fixed and stained
directly on coverslips, non-adherent embryoid bodies were stained in solution
before placement on coverslips. For analysis of neuronal differentiation,
cells were washed at day 4 and resuspended in SCM, plated in SRM onto
fibronectin-coated slides at day 9 and analyzed at day 13. For staining, cells
were fixed in 2% formaldehyde in PBS before blocking with 1% BSA/0.5% saponin
in PBS for 1 hour at room temperature. Primary and secondary antibody staining
steps were performed for 1 hour at room temperature. Primary antibodies:
-E-cadherin (20 µg/ml, Zymed),
-fibronectin (2.5 µg/ml, BD
Transduction Laboratories),
-ßIII-tubulin (TuJ1, 5 µg/ml,
R&D Systems), and
-nestin (Rat-401, 1 µg/ml, developed by S.
Hockfield, obtained from DSHB, developed under auspices of NICHD, maintained
by University of Iowa). Secondary antibodies: FITC F(ab')2
-rat IgG, Cy3
-mouse IgG, Cy2
-mouse IgG2a and Cy3
-mouse IgG1 (3 µg/ml, Jackson ImmunoResearch Laboratories). Nuclear
staining was performed using Hoechst 33342 (2 µg/ml, Molecular Probes).
After staining, cells were washed, mounted on glass slides and imaged on a
Nikon Eclipse E800 microscope.
Gene expression analysis
A CustomExpress Advantage 100-2187 format gene with 11 µM feature size
(Affymetrix) was designed based on dynamic gene expression during 4 days of ES
cell differentiation in SCM as detected using MOE430_2.0 arrays (Affymetrix).
The custom array was validated by comparison with MOE430_2.0 using equivalent
cRNA inputs. Biotinylated cRNA was prepared from total RNA per manufacturer's
protocol. Total RNA (3 µg) was used to generate first-strand cDNA using a
T7-oligo(dT) primer. After second-strand synthesis, in vitro transcription was
performed using biotinylated dUTP and dCTP and hybridized to custom arrays per
manufacturer's recommendation using Affymetrix GeneChip Instrument System.
Data were normalized and expression values modeled using DNA-Chip Analyzer
(Li and Hung, 2001
;
Li and Wong, 2001
).
To evaluate expression of individual genes, RNA was prepared using RNeasy Kits (Qiagen) and cDNA synthesized using Superscipt III (Invitrogen). PCR analysis was performed using Taq Polymerase (Promega) and the following primers: Anp (F, TTGGCTTCCAGGCCATATTG; R, AAGAGGGCAGATCTATCGGA); Evx1 (F, CTCTGGCCAAGGGCAACCTAGTAG; R, CATGTAGGTGTAGAAGGCAGGGTCG); Gapdh (F, TGCCCCCATGTTTGTGATG; R, TGTGGTCATGAGCCCTTCC); Gata1 (F, CATTGGCCCCTTGTGAGGCCAGAGA; R, ACCTGATGGAGCTTGAAATAGAGGC); Gata4 (F, AAGGCAGAGAGTGTGTCAATTGTGG; R, TGGTAGTCTGGCAGTTGGCACAG); Hand1 (F, AAGACTCTGCGCCTGGCTACCA; R, CGCCCTTTAATCCTCTTCTCGC); Mef2c (F, AGCAAGAACACGATGCCATC; R, GAAGGGGTGGTGGTACGGTC); Mesp1 (F, TCCCTCATCTCCGCTCTTCAGC; R, GGTTGGAATGGTACAGTCTGGATGAG); Mixl1 (F, AGTTGCTGGAGCTCGTCTTCCG; R, CTCTGAGAACCAGATGTGCAGACG); Myh6 (F, GGAAGAGTGAGCGGCGCATCAAGG; R, CTGCTGGAGAGGTTATTCCTCG); Myh7 (F, GCCAACACCAACCTGTCCAAGTTC; R, TGCAAAGGCTCCAGGTCTGAGGGC); Myl2 (F, GCCAAGAAGCGGATAGAAGG; R, CTGTGGTTCAGGGCTCAGTC); Myl7 (F, CAGACCTGAAGGAGACCT; R, GTCAGCGCAAACAGTTGC); Nkx2-5 (F, CAAGTGCTCTCCTGCTTTCCCA; R, GCTCGTAGACCTGCGCCTGC); Tal1 (F, ATTGCACACACGGGATTCTG; R, GAATTCAGGGTCTTCCTTAG); Tbx5 (F, GGAGCCTGATTCCAAAGACA; R, TTCAGCCACAGTTCACGTTC); Wnt3 (F, GGACTTGCAATGTCACCTCCCA; R, TGGATCCAGCCGCACAATCTAC); Wnt8a (F, GACCATGGGACACTTGTTAATGCTGTG; R, ACGTGAATTTGGTGGTGGTGTTACC); Pax6 (F, CCATCTTTGCTTGGGAAATCCG; R, GCTTCATCCGAGTCTTCTCCGTTAG); Pax7 (F, AATGGCCTGTCTCCTCAGGT; R, TCTCCTGGCTTGATGGAGTC); Sox2 (F, GAAGGGGAGAGATTTTCAAAGAGATACAAG; R, CCAGATCTATACATGGTCCGATTCCC); En1 (F, AAGTTCCCGGAACACAACCCTG; R, ATAGCGGTTTGCCTGGAACTCC).
|
-Flk1 (Avas12a1,
eBioscience). Data were acquired on a FACS Calibur (Becton Dickinson) and
analyzed using FloJo (Tree Star). Flk1 staining was determined using an
isotype control.
Luciferase assays: transient transfections
A2lox or A2lox.sßcat cells were transfected with pRL-CMV (Promega) and
either SUPER8xTOPFlash or SUPER8xFOPFlash reporter plasmids and
distributed to plates in SRM. After 4 hours, cells were left unstimulated or
activated with either LiCl (20 mM) or doxycycline (1 µg/ml) for 18 hours.
Firefly luciferase counts were normalized for renilla luciferase activity and
averaged between triplicate wells.
| RESULTS |
|---|
|
|
|---|
Induction of ligand expression and reporter activity may depend directly or indirectly on factors present in serum or instead be part of an intrinsic developmental program. To distinguish between these two possibilities, we evaluated SUPER8xTOPFlash reporter activity in ES cells differentiating in serum-free conditions (Fig. 1C). Similar to ES cells differentiated in SCM, Wnt reporter activity increased gradually during the first 4 days of serum-free differentiation and the canonical ligands Wnt3 and Wnt8a are both expressed at day 3 (not shown). These data suggest that Wnt activity during early ES cell differentiation is independent of extrinsic serum-derived factors and is initiated by either cell autonomous mechanisms or by intercellular signals present as cells aggregate in suspension.
Ligand-restricted temporally specific Wnt signaling is required for generation of Flk1+ mesoderm
As Wnt activity is required for germ layer formation in vivo, we asked
whether canonical Wnt signaling is required for the analogous processes during
ES cell differentiation. To assess early mesoderm formation, we determined the
frequency of cells expressing Flk1, a VEGF receptor expressed by multipotent
mesoderm cells (Ema et al.,
2006
). In SCM alone, we find that Flk1 is expressed transiently,
beginning at day 3, peaking on day 4 and declining thereafter
(Fig. 2A). Addition of the
Bmp2/4/7 inhibitor Noggin reduced the frequency of Flk1+ cells by
50% (Fig. 2A), as
previously reported (Park et al.,
2004
). By contrast, addition of Dkk1 completely inhibited
generation of Flk1-expressing cells throughout differentiation
(Fig. 2A), suggesting a strict
requirement for Wnt signaling at some point prior to mesoderm induction.
|
We next asked whether the requirement for Wnt activity during early ES cell differentiation is temporally restricted. To identify the window of time during which Wnt signaling is required for subsequent generation of Flk1+ cells, we added Dkk1 at progressively later timepoints following initiation of differentiation in SCM (Fig. 2C). When Dkk1 was added at day 0, day 1.0 or day 1.5, generation of Flk1+ cells by day 4 was inhibited completely. Inhibition was reduced to 80% when Dkk1 was added at day 2 and was negligible when added at day 2.5 or afterwards, indicating that generation of Flk1-expressing cells by day 4 requires Wnt signaling before day 2.5. These results, considered with the kinetics of Wnt ligand expression, suggest that Wnt signaling between day 1.5 and day 2.5 is required for generation of Flk1+ mesoderm.
Canonical Wnt signaling is required for expression of genes associated with primitive streak, EMT, endoderm and mesoderm
We next sought to identify genes whose expression is Wnt dependent during
ES cell differentiation. We analyzed gene expression by custom DNA
microarrays, containing
1600 probe sets, at various times of
differentiation in SCM with or without addition of Dkk1
(Fig. 3). No differences in
gene expression between conditions were observed before day 2 of
differentiation. Beginning at day 2, significant differences emerged. Notably,
the first genes inhibited by Dkk1 treatment were largely associated with the
embryonic primitive streak (see Table S1 in the supplementary material).
Specifically, brachyury (T), Mixl1 and Evx1 each
failed to be induced in the presence of Dkk1
(Fig. 3A) and are each first
expressed in the early primitive streak-stage embryo
(Dush and Martin, 1992
;
Rivera-Perez and Magnuson,
2006
; Robb et al.,
2000
). In addition, genes associated with subsequent events in
embryogenesis were affected by Dkk1 treatment. Genes reflective of
epithelial-mesenchymal transition (Snai1, Fn1 and Cdh2)
(Fig. 3B)
(Barrallo-Gimeno and Nieto,
2005
), mes/endoderm (Gsc, Sox17, Foxa2)
(Fig. 3C)
(Yasunaga et al., 2005
) and
mesoderm (Mesp1, Nrp1, Pdgfra)
(Fig. 3D) all required Wnt
signaling for their expression. Expression of the ES cell-associated genes
Zfp42 and Socs3 was diminished with identical kinetics with
or without Dkk1, indicating that Dkk1 had no effect on the earliest steps of
ES cell differentiation. Together, these gene expression data suggest that
Dkk1 treatment causes a global block at the ES cell equivalent of primitive
streak formation. When analyzed at later timepoints (day 6-8), a reciprocal
increase in expression of neuroectoderm-associated genes was detected by
RT-PCR after treatment with Dkk1 from day 0-4
(Fig. 4A), consistent with the
previously described role for Wnt signaling in antagonizing neural development
(Aubert et al., 2002
). When
examined by immunofluorescence at day 13, cultures treated with Dkk1 (days
0-4) possess cells expressing neuronal ßIII-tubulin, Nestin or
Pax6, reflective of enhanced commitment to the neural/neuronal
lineage (Fig. 4B-D).
Canonical Wnt signaling is required for generation of ES cell-derived mesoderm
As mesodermal genes failed to be expressed with Dkk1 treatment, we asked
whether early Wnt signaling is formally required for generation of mature
mesodermal lineages from ES cells. As Wnt signaling has functionally distinct
roles at different points in early embryogenesis
(Robb and Tam, 2004
), we
limited Dkk1 treatment to the first 4 days of differentiation for each
long-term assay. To quantitate hematopoietic potential under different
conditions, ES cells were differentiated in SCM alone or with either Dkk1 or
Noggin/Fc for the first 4 days. Cells were subsequently allowed to
differentiate an additional 2 days in the absence of inhibitors, and then
evaluated for hematopoietic precursor frequency at day six by methylcellulose
colony-forming assays (Fig.
5A). Early treatment with Noggin/Fc reduced the frequency of
hematopoietic precursors at day 6, consistent with the known role for Bmp
signaling in extra-embryonic mesoderm development and hematopoiesis
(Snyder et al., 2004
;
Winnier et al., 1995
).
Treatment with Dkk1 for 4 days, however, completely inhibited the generation
of hematopoietic precursors at day 6 (Fig.
5A), consistent with the loss of mesoderm associated gene
expression described above (Fig.
3). We also examined expression of the transcription factors
Gata1 and Tal1, each important for hematopoietic development
(Baron and Fraser, 2005
). In
SCM alone, expression of Gata1 and Tal1
(Fig. 5B) is readily detected
by RT-PCR at day 6, when colony forming assays were initiated. Whereas
treatment with Noggin/Fc caused a slight reduction in expression of these
genes, Dkk1 treatment completely inhibited their expression
(Fig. 5B). These findings are
consistent with the interpretation that Wnt and Bmp signaling act either at
different times or by distinct mechanisms to affect the hematopoietic
competence of differentiating ES cells.
|
|
|
Stabilized ß-catenin is not sufficient to induce primitive streak gene expression
To determine whether canonical Wnt signaling alone is sufficient to direct
expression of primitive streak genes, we generated an ES cell line bearing a
doxycycline-inducible form of a stabilized ß-catenin (A2lox.sßcat)
(Fig. 6). We introduced point
mutations at each of the four N-terminal GSK3ß phosphorylation sites of
ß-catenin (S33A, S37A, T41A, S45A), rendering the encoded protein
refractory to basal degradation and constitutively localized to the nucleus
where it can exert its function as a transactivator
(Yost et al., 1996
). In cells
lacking the transgenic ß-catenin, treatment with LiCl, but not
doxycycline, induced activity of the SUPER8xTOPFlash luciferase reporter
(Fig. 6A). In transgenic ES
cells, however, doxycycline-induced stabilized ß-catenin stimulated
SUPER8xTOPFlash activity to levels equal to LiCl treatment, indicating
that the mutant ß-catenin is functionally active. Reporter activity was
specific in all cases as the negative control SUPER8xFOPFlash reporter
was unaffected by either doxycycline or LiCl treatment.
To evaluate directly the capacity of ß-catenin-dependent
transactivation to induce a program of primitive streak gene expression, we
induced expression of the transgenic, stabilized ß-catenin at day 1 of
serum-free differentiation, corresponding to the time of onset of
SUPER8xTOPFlash reporter activity under normal conditions. As endogenous
canonical Wnt ligands are induced in these conditions (not shown), all
cultures were treated with Dkk1 throughout the experiment in order to ensure
the specificity of our analysis. At day 3.5 of differentiation, we examined
specific gene expression by RT-PCR (Fig.
6B). Expression of brachyury was detected at low levels in
untreated, serum-free conditions, as previously reported
(Park et al., 2004
), and was
extinguished by treatment with Dkk1 (Fig.
6B), consistent with the requirement for Wnt signaling found in
SCM (Fig. 3). Importantly, we
find that neither brachyury nor Evx1 expression was restored by
stabilized ß-catenin across a broad range of doxycycline
concentrations.
Effects of soluble factors on mesoderm generation in the presence of Dkk1
As Wnt signaling does not promote primitive streak gene expression
autonomously (Fig. 6), we
hypothesized that it may function cooperatively to coordinate transcriptional
responses to other signaling pathways. We therefore evaluated whether strong
activation of other signaling pathways could by-pass the functional
requirement for early Wnt signaling in later mesoderm development. For this
analysis, we examined nine secreted factors that act in pathways important for
primitive streak formation in vivo or are expressed during early ES cell
differentiation (data not shown). In these experiments, factors were added for
the first 4 days in the presence of Dkk1, at which time all cultures were
washed and redistributed to longer term mesodermal differentiation assays in
SCM alone (Fig. 7A-C).
|
As Wnt signaling was required for the expression of primitive streak-associated genes (Fig. 3), we asked whether either Bmp4 or cripto were capable of inducing primitive streak genes in the presence of Dkk1. ES cells were differentiated in SCM in the presence of Dkk1 alone or Dkk1 combined with either Bmp4 or cripto (Fig. 7D). Bmp4, but not cripto, was able to restore Wnt-dependent expression of the primitive streak genes T, Mixl1, Evx1 and Mesp1 at days 3 and 4 of differentiation, indicating the rescue of mesoderm development by Bmp4 treatment occurred via normal developmental pathways.
Wnt and Bmp pathways act cooperatively to coordinate primitive streak-associated gene expression
As addition of Bmp4 was able to bypass the requirement for Wnt signaling
during germ layer induction (Fig.
7), we asked whether these pathways act cooperatively to regulate
primitive streak gene expression. To test this, we determined brachyury
expression levels at day 3.5 of differentiation in serum-free conditions in
the presence of Bmp and/or Dkk1 at increasing concentrations
(Fig. 8A). Without Dkk1,
brachyury expression increased in a dose-dependent manner in response to Bmp4
treatment. At low concentrations of Bmp4, only a small amount of Dkk1 was
required to extinguish brachyury expression. By contrast, at higher
concentrations of Bmp4, increasing amounts of Dkk1 were required to exert the
same inhibitory effect. Importantly, Bmp4 activity was unable to overcome
saturating concentrations of Dkk1, suggesting an absolute requirement for Wnt
signaling in primitive streak gene expression, including brachyury
(Fig. 8A), Mixl1 and
Evx1 (not shown).
To test further whether Wnt signaling can synergize with Bmp activity, we compared brachyury expression in differentiating A2lox.sßcat cells with and without Dkk1, and treated with varying concentrations of Bmp4 and/or doxycycline (Fig. 8B). As before, Bmp4 treatment strongly induced brachyury expression and was sensitive to intermediate concentrations of Dkk1. Though induction of stabilized ß-catenin displayed no effect by itself (Fig. 6B), doxycycline treatment did increase brachyury expression when combined with Bmp4 (Fig. 8B). At low dose of Bmp4, brachyury expression was extinguished by Dkk1 and not restored by doxycycline. However, at higher concentrations of Bmp4, brachyury expression was markedly increased in a ß-catenin-dependent manner (Fig. 7B). These results suggest that ß-catenin and Bmp4 either act directly to regulate primitive streak gene expression or indirectly by inducing other factors that direct expression of these genes. As Bmp4 has been shown to regulate Nodal activity in vivo, we measured Nodal expression under these conditions (Fig. 8B). In the absence of Bmp4, we detect a low level of Nodal expression that remains unaffected by Dkk1 or by stabilized ß-catenin. However, addition of Bmp4 induced expression of Nodal, especially under conditions of enforced Wnt activity.
| DISCUSSION |
|---|
|
|
|---|
In this study, we demonstrate a requirement for Wnt signaling during the earliest steps of mesendodermal differentiation of ES cells. Specifically, during ES cell differentiation, canonical Wnt signaling is required for the expression of genes associated with the primitive streak and gastrulation in vivo, including brachyury, Mixl1 and Evx1. Consistent with this finding, genes affiliated with lineages developing subsequent to gastrulation in vivo (mesoderm and endoderm), as well as genes reflective of cell biological changes occurring normally during gastrulation (EMT), all fail to be expressed in the absence of Wnt activity. Furthermore, we demonstrate formally that mature mesodermal lineages, which depend in vivo on Wnt signaling and development of the primitive streak, also fail to develop in vitro in the absence of Wnt activity. In particular, ES cells deprived of early Wnt signaling failed to generate hemogenic and cardiomyogenic mesoderm in long-term assays. Taken together, these data reflect a crucial dependence on Wnt signaling for the initiation of a global program of development during primary germ layer induction in vitro.
|
There are divergent views of how Wnt signaling regulates gene expression.
In some cases, Wnt pathway activation could act autonomously and directly to
induce target gene expression through the ß-catenin-dependent conversion
of repressive TCF transcription factors to an active state
(Logan and Nusse, 2004
). In
others, it has been suggested that Wnt signaling instead functions to regulate
the threshold or stability of gene transcription induced by other pathways
(Arias and Hayward, 2006
).
Recent studies in fly and mouse, for example, suggest that Wnt signaling or
ß-catenin stabilization can function principally to regulate thresholds
and stabilize gene expression induced secondary signals
(Cox and Baylies, 2005
;
Lowry et al., 2005
).
|
Our study does not distinguish between the direct and indirect actions of
the Wnt and Bmp pathways. For example, it is possible that Bmp4 functions
indirectly to influence primitive streak gene expression by first inducing
Nodal and/or cripto (Beck et al.,
2002
). Consistent with this possibility, we show that Bmp
signaling alone can increase Nodal expression and that stabilized
ß-catenin augments Nodal expression synergistically with Bmp.
Further experiments beyond the scope of this study should resolve the role of
Nodal in ES cell-derived germ layer induction. In fact, comprehensive
analysis of the mechanisms underlying this process will depend on a rigorous
dissection of the simultaneous actions of at least three signaling pathways
(Wnt/Nodal/Bmp) and their transcriptional targets. Though the ES cell
differentiation model system does not recapitulate the intricate signaling
topology of the intact embryo, these data do suggest that these cells possess
a functional responsiveness and requirement for Wnt signaling that mirrors
that observed in vivo. As such, our findings suggest that ES cells may provide
a useful and experimentally tractable model system to define complex signaling
interactions at the cellular and molecular levels.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/19/3787/DC1
| REFERENCES |
|---|
|
|
|---|
Arias, A. M. and Hayward, P. (2006). Filtering
transcriptional noise during development: concepts and mechanisms.
Nat. Rev. Genet. 7,34
-44.[CrossRef][Medline]
Arnold, S. J., Stappert, J., Bauer, A., Kispert, A., Herrmann,
B. G. and Kemler, R. (2000). Brachyury is a target gene of
the Wnt/[beta]-catenin signaling pathway. Mech. Dev.
91,249
-258.[CrossRef][Medline]
Aubert, J., Dunstan, H., Chambers, I. and Smith, A.
(2002). Functional gene screening in embryonic stem cells
implicates Wnt antagonism in neural differentiation. Nat.
Biotechnol. 20,1240
-1245.[CrossRef][Medline]
Baron, M. H. and Fraser, S. T. (2005). The
specification of early hematopoiesis in the mammal. Curr. Opin.
Hematol. 12,217
-221.[CrossRef][Medline]
Barrallo-Gimeno, A. and Nieto, M. A. (2005).
The Snail genes as inducers of cell movement and survival: implications in
development and cancer. Development
132,3151
-3161.
Beck, S., Le Good, J. A., Guzman, M., Ben Haim, N., Roy, K.,
Beermann, F. and Constam, D. B. (2002). Extraembryonic
proteases regulate Nodal signalling during gastrulation. Nat Cell
Biol. 4,981
-985.[CrossRef][Medline]
Cox, V. T. and Baylies, M. K. (2005).
Specification of individual Slouch muscle progenitors in Drosophila requires
sequential Wingless signaling. Development
132,713
-724.
Dush, M. K. and Martin, G. R. (1992). Analysis
of mouse Evx genes: Evx-1 displays graded expression in the primitive streak.
Dev. Biol. 151,273
-287.[CrossRef][Medline]
Eastman, Q. and Grosschedl, R. (1999).
Regulation of LEF-1/TCF transcription factors by Wnt and other signals.
Curr. Opin. Cell Biol.
11,233
-240.[CrossRef][Medline]
Ema, M., Takahashi, S. and Rossant, J. (2006).
Deletion of selection cassette but not cis-acting elements in targeted
Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal
progenitors. Blood 107,111
-117.
Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W.
and Bujard, H. (1995). Transcriptional activation by
tetracyclines in mammalian cells. Science
268,1766
-1769.
Hsieh, J. C., Rattner, A., Smallwood, P. M. and Nathans, J.
(1999). Biochemical characterization of Wnt-frizzled interactions
using a soluble, biologically active vertebrate Wnt protein. Proc.
Natl. Acad. Sci. USA 96,3546
-3551.
Huang, H. C. and Klein, P. S. (2004). The
Frizzled family: receptors for multiple signal transduction pathways.
Genome Biol. 5,234
.[CrossRef][Medline]
Huelsken, J., Vogel, R., Brinkmann, V., Erdmann, B., Birchmeier,
C. and Birchmeier, W. (2000). Requirement for beta-catenin in
anterior-posterior axis formation in mice. J. Cell
Biol. 148,567
-578.
Johansson, B. M. and Wiles, M. V. (1995).
Evidence for involvement of activin A and bone morphogenetic protein 4 in
mammalian mesoderm and hematopoietic development. Mol. Cell.
Biol. 15,141
-151.[Abstract]
Keller, G. (2005). Embryonic stem cell
differentiation: emergence of a new era in biology and medicine.
Genes Dev. 19,1129
-1155.
Kelly, O. G., Pinson, K. I. and Skarnes, W. C.
(2004). The Wnt co-receptors Lrp5 and Lrp6 are essential for
gastrulation in mice. Development
131,2803
-2815.
Kemp, C., Willems, E., Abdo, S., Lambiv, L. and Leyns, L.
(2005). Expression of all Wnt genes and their secreted
antagonists during mouse blastocyst and postimplantation development.
Dev. Dyn. 233,1064
-1075.[CrossRef][Medline]
Kouskoff, V., Lacaud, G., Schwantz, S., Fehling, H. J. and
Keller, G. (2005). Sequential development of hematopoietic
and cardiac mesoderm during embryonic stem cell differentiation.
Proc. Natl. Acad. Sci. USA
102,13170
-13175.
Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy,
M., Woo, S., Fehling, H. J. and Keller, G. (2004).
Development of definitive endoderm from embryonic stem cells in culture.
Development 131,1651
-1662.
Kyba, M., Perlingeiro, R. C., Hoover, R. R., Lu, C. W., Pierce,
J. and Daley, G. Q. (2003). Enhanced hematopoietic
differentiation of embryonic stem cells conditionally expressing Stat5.
Proc. Natl. Acad. Sci. USA
100,11904
-11910.
Lawson, K. A. (1999). Fate mapping the mouse
embryo. Int. J. Dev. Biol.
43,773
-775.[Medline]
Lawson, K. A., Meneses, J. J. and Pedersen, R. A.
(1991). Clonal analysis of epiblast fate during germ layer
formation in the mouse embryo. Development
113,891
-911.[Abstract]
Li, C. and Hung, W. W. (2001). Model-based
analysis of oligonucleotide arrays: model validation, design issues and
standard error application. Genome Biol.
2, RESEARCH0032.
Li, C. and Wong, W. H. (2001). Model-based
analysis of oligonucleotide arrays: expression index computation and outlier
detection. Proc. Natl. Acad. Sci. USA
98, 31-36.
Li, L., Arman, E., Ekblom, P., Edgar, D., Murray, P. and Lonai,
P. (2004). Distinct GATA6- and laminin-dependent mechanisms
regulate endodermal and ectodermal embryonic stem cell fates.
Development 131,5277
-5286.
Liu, P., Wakamiya, M., Shea, M. J., Albrecht, U., Behringer, R.
R. and Bradley, A. (1999). Requirement for Wnt3 in vertebrate
axis formation. Nat. Genet.
22,361
-365.[CrossRef][Medline]
Logan, C. Y. and Nusse, R. (2004). The WNT
signaling pathway in development and disease. Annu. Rev. Cell Dev.
Biol. 20,781
-810.[CrossRef][Medline]
Lowry, W. E., Blanpain, C., Nowak, J. A., Guasch, G., Lewis, L.
and Fuchs, E. (2005). Defining the impact of
{beta}-catenin/Tcf transactivation on epithelial stem cells. Genes
Dev. 19,1596
-1611.
Mao, B., Wu, W., Davidson, G., Marhold, J., Li, M., Mechler, B.
M., Delius, H., Hoppe, D., Stannek, P., Walter, C. et al.
(2002). Kremen proteins are Dickkopf receptors that regulate
Wnt/[beta]-catenin signalling. Nature
417,664
-667.[CrossRef][Medline]
Merrill, B. J., Pasolli, H. A., Polak, L., Rendl, M.,
Garcia-Garcia, M. J., Anderson, K. V. and Fuchs, E. (2004).
Tcf3: a transcriptional regulator of axis induction in the early embryo.
Development 131,263
-274.
Morkel, M., Huelsken, J., Wakamiya, M., Ding, J., van de
Wetering, M., Clevers, H., Taketo, M. M., Behringer, R. R., Shen, M. M. and
Birchmeier, W. (2003). {beta}-Catenin regulates Cripto- and
Wnt3-dependent gene expression programs in mouse axis and mesoderm formation.
Development 130,6283
-6294.
Park, C., Afrikanova, I., Chung, Y. S., Zhang, W. J., Arentson,
E., Fong, G. h., Rosendahl, A. and Choi, K. (2004). A
hierarchical order of factors in the generation of FLK1- and SCL-expressing
hematopoietic and endothelial progenitors from embryonic stem cells.
Development 131,2749
-2762.
Ranganath, S., Ouyang, W., Bhattarcharya, D., Sha, W. C., Grupe,
A., Peltz, G. and Murphy, K. M. (1998). GATA-3-dependent
enhancer activity in IL-4 gene regulation. J. Immunol.
161,3822
-3826.
Rivera-Perez, J. A. and Magnuson, T. (2006).
Primitive streak formation in mice is preceded by localized activation of
Brachyury and Wnt3. Dev. Biol.
288,363
-371.
Robb, L. and Tam, P. P. L. (2004). Gastrula
organiser and embryonic patterning in the mouse. Semin. Cell Dev.
Biol. 15,543
-554.[CrossRef][Medline]
Robb, L., Hartley, L., Begley, C. G., Brodnicki, T. C.,
Copeland, N. G., Gilbert, D. J., Jenkins, N. A. and Elefanty, A. G.
(2000). Cloning, expression analysis, and chromosomal
localization of murine and human homologues of a Xenopus mix gene.
Dev. Dyn. 219,497
-504.[CrossRef][Medline]
Rossant, J. and Tam, P. P. L. (2004). Emerging
asymmetry and embryonic patterning in early mouse development. Dev.
Cell 7,155
-164.[CrossRef][Medline]
Snyder, A., Fraser, S. T. and Baron, M. H.
(2004). Bone morphogenetic proteins in vertebrate hematopoietic
development. J. Cell. Biochem.
93,224
-232.[CrossRef][Medline]
Tam, P. P. L. and Behringer, R. R. (1997).
Mouse gastrulation: the formation of a mammalian body plan. Mech.
Dev. 68,3
-25.[CrossRef][Medline]
Tam, P. P., Kanai-Azuma, M. and Kanai, Y.
(2003). Early endoderm development in vertebrates: lineage
differentiation and morphogenetic function. Curr. Opin. Genet.
Dev. 13,393
-400.[CrossRef][Medline]
Thiery, J. P. and Sleeman, J. P. (2006).
Complex networks orchestrate epithelial-mesenchymal transitions.
Nat. Rev. Mol. Cell Biol.
7, 131-142.[CrossRef][Medline]
Veeman, M. T., Slusarski, D. C., Kaykas, A., Louie, S. H. and
Moon, R. T. (2003). Zebrafish Prickle, a modulator of
noncanonical Wnt/Fz signaling, regulates gastrulation movements.
Curr. Biol. 13,680
-685.[CrossRef][Medline]
Winnier, G., Blessing, M., Labosky, P. A. and Hogan, B. L.
(1995). Bone morphogenetic protein-4 is required for mesoderm
formation and patterning in the mouse. Genes Dev.
9,2105
-2116.
Yasunaga, M., Tada, S., Torikai-Nishikawa, S., Nakano, Y.,
Okada, M., Jakt, L. M., Nishikawa, S., Chiba, T., Era, T. and Nishikawa, S.
I. (2005). Induction and monitoring of definitive and
visceral endoderm differentiation of mouse ES cells. Nat.
Biotechnol. 23,1542
-1550.[CrossRef][Medline]
Yost, C., Torres, M., Miller, J. R., Huang, E., Kimelman, D. and
Moon, R. T. (1996). The axis-inducing activity, stability,
and subcellular distribution of beta-catenin is regulated in Xenopus embryos
by glycogen synthase kinase 3. Genes Dev.
10,1443
-1454.
Zambrowicz, B. P., Imamoto, A., Fiering, S., Herzenberg, L. A.,
Kerr, W. G. and Soriano, P. (1997). Disruption of overlapping
transcripts in the ROSA beta geo 26 gene trap strain leads to widespread
expression of beta-galactosidase in mouse embryos and hematopoietic cells.
Proc. Natl. Acad. Sci. USA
94,3789
-3794.
Related articles in Development:
This article has been cited by other articles:
![]() |
P. Wang, C. Lin, E. R. Smith, H. Guo, B. W. Sanderson, M. Wu, M. Gogol, T. Alexander, C. Seidel, L. M. Wiedemann, et al. Global Analysis of H3K4 Methylation Defines MLL Family Member Targets and Points to a Role for MLL1-Mediated H3K4 Methylation in the Regulation of Transcriptional Initiation by RNA Polymerase II Mol. Cell. Biol., November 15, 2009; 29(22): 6074 - 6085. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kikuchi, M. Fukuda, T. Ito, M. Inoue, T. Yokoi, S. Chiku, T. Mitsuyama, K. Asai, T. Hirose, and Y. Aizawa Transcripts of unknown function in multiple-signaling pathways involved in human stem cell differentiation Nucleic Acids Res., August 1, 2009; 37(15): 4987 - 5000. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakanishi, A. Kurisaki, Y. Hayashi, M. Warashina, S. Ishiura, M. Kusuda-Furue, and M. Asashima Directed induction of anterior and posterior primitive streak by Wnt from embryonic stem cells cultured in a chemically defined serum-free medium FASEB J, January 1, 2009; 23(1): 114 - 122. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Cheng, T. L. Huber, V. C. Chen, P. Gadue, and G. M. Keller Numb mediates the interaction between Wnt and Notch to modulate primitive erythropoietic specification from the hemangioblast Development, October 15, 2008; 135(20): 3447 - 3458. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sumi, N. Tsuneyoshi, N. Nakatsuji, and H. Suemori Defining early lineage specification of human embryonic stem cells by the orchestrated balance of canonical Wnt/{beta}-catenin, Activin/Nodal and BMP signaling Development, September 1, 2008; 135(17): 2969 - 2979. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-C. Tranchevent, R. Barriot, S. Yu, S. Van Vooren, P. Van Loo, B. Coessens, B. De Moor, S. Aerts, and Y. Moreau ENDEAVOUR update: a web resource for gene prioritization in multiple species Nucleic Acids Res., July 1, 2008; 36(suppl_2): W377 - W384. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gaulden and J. F. Reiter Neur-ons and neur-offs: regulators of neural induction in vertebrate embryos and embryonic stem cells Hum. Mol. Genet., April 15, 2008; 17(R1): R60 - R66. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Cole, S. E. Johnstone, J. J. Newman, M. H. Kagey, and R. A. Young Tcf3 is an integral component of the core regulatory circuitry of embryonic stem cells Genes & Dev., March 15, 2008; 22(6): 746 - 755. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. K. Williamson, D. L. Smith, D. Blinco, R. D. Unwin, S. Pearson, C. Wilson, C. Miller, L. Lancashire, G. Lacaud, V. Kouskoff, et al. Quantitative Proteomics Analysis Demonstrates Post-transcriptional Regulation of Embryonic Stem Cell Differentiation to Hematopoiesis Mol. Cell. Proteomics, March 1, 2008; 7(3): 459 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xie, S. Tranguch, X. Jia, H. Zhang, S. K. Das, S. K. Dey, C. J. Kuo, and H. Wang Inactivation of nuclear Wnt-{beta}-catenin signaling limits blastocyst competency for implantation Development, February 15, 2008; 135(4): 717 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Zhang, J. Li, Z. Tan, C. Wang, T. Liu, L. Chen, J. Yong, W. Jiang, X. Sun, L. Du, et al. Short-term BMP-4 treatment initiates mesoderm induction in human embryonic stem cells Blood, February 15, 2008; 111(4): 1933 - 1941. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hayward, T. Kalmar, and A. Martinez Arias Wnt/Notch signalling and information processing during development Development, February 1, 2008; 135(3): 411 - 424. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Woll, J. K. Morris, M. S. Painschab, R. K. Marcus, A. D. Kohn, T. L. Biechele, R. T. Moon, and D. S. Kaufman Wnt signaling promotes hematoendothelial cell development from human embryonic stem cells Blood, January 1, 2008; 111(1): 122 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Bakre, A. Hoi, J. C. Y. Mong, Y. Y. Koh, K. Y. Wong, and L. W. Stanton Generation of Multipotential Mesendodermal Progenitors from Mouse Embryonic Stem Cells via Sustained Wnt Pathway Activation J. Biol. Chem., October 26, 2007; 282(43): 31703 - 31712. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kwon, J. Arnold, E. C. Hsiao, M. M. Taketo, B. R. Conklin, and D. Srivastava Canonical Wnt signaling is a positive regulator of mammalian cardiac progenitors PNAS, June 26, 2007; 104(26): 10894 - 10899. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ueno, G. Weidinger, T. Osugi, A. D. Kohn, J. L. Golob, L. Pabon, H. Reinecke, R. T. Moon, and C. E. Murry From the Cover: Biphasic role for Wnt/beta-catenin signaling in cardiac specification in zebrafish and embryonic stem cells PNAS, June 5, 2007; 104(23): 9685 - 9690. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Vijayaragavan and M. Bhatia Early cardiac development: A Wnt beat away PNAS, June 5, 2007; 104(23): 9549 - 9550. [Full Text] [PDF] |
||||
![]() |
Y. Liu, M. Asakura, H. Inoue, T. Nakamura, M. Sano, Z. Niu, M. Chen, R. J. Schwartz, and M. D. Schneider Sox17 is essential for the specification of cardiac mesoderm in embryonic stem cells PNAS, March 6, 2007; 104(10): 3859 - 3864. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Singh, F.-Q. Li, T. Hamazaki, H. Kasahara, K.-I. Takemaru, and N. Terada Chibby, an Antagonist of the Wnt/{beta}-Catenin Pathway, Facilitates Cardiomyocyte Differentiation of Murine Embryonic Stem Cells Circulation, February 6, 2007; 115(5): 617 - 626. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Naito, I. Shiojima, H. Akazawa, K. Hidaka, T. Morisaki, A. Kikuchi, and I. Komuro Developmental stage-specific biphasic roles of Wnt/beta-catenin signaling in cardiomyogenesis and hematopoiesis PNAS, December 26, 2006; 103(52): 19812 - 19817. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||