spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 30 August 2006
doi: 10.1242/dev.02575


Development 133, 3939-3948 (2006)
Published by The Company of Biologists 2006


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.02575v1
133/19/3939    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaheen, L.
Right arrow Articles by Fares, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaheen, L.
Right arrow Articles by Fares, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Suppression of the cup-5 mucolipidosis type IV-related lysosomal dysfunction by the inactivation of an ABC transporter in C. elegans

Lara Schaheen, Greg Patton and Hanna Fares*

Department of Molecular and Cellular Biology, Life Sciences South Room 531, University of Arizona, Tucson, AZ 85721, USA.

* Author for correspondence (e-mail: fares{at}email.arizona.edu)

Accepted 8 August 2006


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mutations in MCOLN1, which encodes the protein mucolipin 1, result in the lysosomal storage disease mucolipidosis Type IV. Studies on human mucolipin 1 and on CUP-5, the Caenorhabditis elegans ortholog of mucolipin 1, have shown that these proteins are required for lysosome biogenesis/function. Loss of CUP-5 results in a defect in lysosomal degradation, leading to embryonic lethality. We have identified a mutation in the ABC transporter MRP-4 that rescues the degradation defect and the corresponding lethality, owing to the absence of CUP-5. MRP-4 localizes to endocytic compartments and its levels are elevated in the absence of CUP-5. These results indicate that the lysosomal degradation defect is exacerbated in some cells because of the accumulation of MRP-4 in lysosomes rather than the loss of CUP-5 per se. We also show that under some conditions, loss of MRP-4 rescues the embryonic lethality caused by the loss of the cathepsin L protease, indicating that the accumulation of ABC transporters may be a more general mechanism whereby an initial lysosomal dysfunction is more severely compromised.

Key words: C. elegans, CUP-5, Mucolipidosis Type IV, ABC Transporter, MRP-4


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mucolipidosis Type IV is a neurodegenerative disease that is characterized by two classes of symptoms (Altarescu et al., 2002Go; Bach, 2001Go). The first class, which includes corneal clouding and achlorhydria is due to the accumulation of large lipid-rich vacuoles in the respective tissues. The second class, which includes psychomotor retardation, is due to neuronal cell death. The gene responsible for this disease encodes the protein human mucolipin 1, which belongs to the `transient receptor potential' family of proteins (Bargal et al., 2000Go; Bassi et al., 2000Go; Sun et al., 2000Go). Human mucolipin 1 functions as a non-selective cation channel, the activity of which is modulated by pH (LaPlante et al., 2002Go; Raychowdhury et al., 2004Go).

The C. elegans CUP-5 protein is the ortholog of human mucolipin 1 (Fares and Greenwald, 2001bGo). Mutations in cup-5 result in the appearance of large vacuoles and the absence of lysosomal degradation in various cell types because of a defect in lysosome biogenesis (Fares and Greenwald, 2001bGo; Hersh et al., 2002Go; Treusch et al., 2004Go). The large vacuoles are hybrids of late endosomes and lysosomes and represent the terminal endocytic compartments, at least in scavenger cells called coelomocytes (Treusch et al., 2004Go). In cup-5 null embryos, the degradation of yolk and of membrane proteins is significantly delayed, particularly in developing intestinal cells (Schaheen et al., 2006Go). As in other tissues, this defect is accompanied by an expansion in the size of the terminal compartment. Furthermore, this leads to ectopic apoptosis, to developmental abnormalities and ultimately to organism death primarily because of the developmental defects (Hersh et al., 2002Go; Schaheen et al., 2006Go).

We describe in this study the identification and the characterization of a suppressor of the lysosomal defect and the lethality of cup-5(null) worms. The suppressor, MRP-4, is a member of the ATP-binding cassette (ABC) transporter superfamily that is widely distributed in prokaryotes and eukaryotes (Bauer et al., 1999Go; Cheong et al., 2006Go; Dean et al., 2001Go; Holland and Holland, 2005Go; Sheps et al., 2004Go). ABC transporters bind ATP and use the energy to transport various molecules, including drugs, toxins, peptides and lipid derivatives across the membrane of various cellular compartments. This family of proteins contain several transmembrane helices and ATP-binding domains typically containing three conserved Walker domains, and have been implicated in various physiological processes, including pleiotropic drug and heavy metal resistance and membrane trafficking (Dean et al., 2001Go; Holland and Holland, 2005Go).


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
C. elegans strains and methods
Standard methods were used for genetic analysis (Brenner, 1974Go). Transgenic integrated lines were made by bombardment of unc-119(ed3) worms using pHD137 as a co-bombardment marker (Praitis et al., 2001Go). RNAi was done by the feeding method as previously described (Timmons and Fire, 1998Go). Markers used were: pgp-2(gk114) I (Nunes et al., 2005Go); cup-5(ar465) III (Fares and Greenwald, 2001bGo); cup-5(zu223) III (Hersh et al., 2002Go); unc-36(e251) III (closely linked to cup-5) (Brenner, 1974Go; Fares and Greenwald, 2001aGo; Fares and Greenwald, 2001bGo); unc-69(e587) III (Brenner, 1974Go); ced-9(n1950n2161) III (Gumienny et al., 1999Go); rme-2((b1008) IV (Grant and Hirsh, 1999Go); cpl-1(ok360) V (Britton and Murray, 2004Go); rme-1(b1045) V (Grant et al., 2001Go); cup-10(ar479) V (Dang et al., 2003Go); rme-6(b1018) X (Sato et al., 2005Go); bIs1[VIT-2::GFP; pRF4] (which expresses a fusion of the worm YP170 protein VIT-2 to GFP) (Grant and Hirsh, 1999Go); cdIs77[GFP::LGG-1; unc-119(+)-pmyo-2::GFP] X (which expresses GFP-LGG-1 in all cells and GFP in the pharynx) (Schaheen et al., 2006Go); nT1[qIs51] IV, V (is a dominant balancer) (Siegfried et al., 2004Go); and qC1 (a balancer chromosome that suppresses recombination between cup-5 and unc-36) (Graham and Kimble, 1993Go). cup-5(zu223) unc-36(e251) worms bearing various transgenes were isolated from qC1-balanced parent heterozygotes; the eggs from these homozygous progeny were analyzed in the various assays. unc-69(e587) ced-9(n1950n2161) worms were isolated from qC1-balanced parent heterozygotes; the eggs from these homozygous progeny were analyzed. cpl-1(ok360) worms were identified as progeny that did not express GFP in the pharynx from cpl-1(ok360)/nt1[qIs51] heterozygotes; the eggs from these homozygous progeny were analyzed.

Identification of mrp-4(cd8)
We mutagenized cup-5(zu223) unc-36(e251)/qC1; arIs37 hermaphrodites with EMS as previously described (Brenner, 1974Go). We then picked 239 F1 wild-type progeny (predicted to be heterozygous for new mutations) to separate plates. From each of these 239 plates, we picked 12 Unc F2 progeny and screened for viable F3 Unc progeny. These were backcrossed four times to wild-type worms to confirm the suppression and to remove background mutations. We identified the single cd8 allele in this screen.

We mapped cd8 between stp156 and stp72 on chromosome X using sequence-tagged site (sTs) mapping, as previously described (Fares and Greenwald, 2001aGo; Williams et al., 1992Go). To determine the actual mutated gene, we used an RNAi screen of all the genes on chromosome X that would rescue the embryonic lethality of cup-5(zu223) unc-36(e251). We only identified one gene, mrp4, that mapped between stp156 and stp72, and that phenocopied the suppression by the cd8 allele. Sequencing of the open reading frame in cd8 worms confirmed the presence of a mutation. Furthermore, we could reverse the suppression of mrp-4(cd8); cup-5(zu223) unc-36(e251) by expressing wild type mrp-4 from a transgenic array.

Methylpyruvate feeding
Methylpyruvate (Sigma, St Louis, MO) was added to the NGM medium at a concentration of 14 mM before the plates were poured. In addition, OP50 was spun down and resuspended in a 14 mM solution of methylpyruvate before seeding the plates.

TUNEL assay
The TUNEL assay was carried out as previously described (Schaheen et al., 2006Go).

LysoTracker red staining
LysoTracker Red (Invitrogen, Carlsbad, CA) was added to the NGM medium at a concentration of 50 nM before the plates were poured. In addition, OP50 was spun down and resuspended in a 50 nM solution of LysoTracker Red before seeding the plates.

Nile Red staining
Worms and eggs were incubated in a 0.06 mg/ml solution of Nile Red (Invitrogen, Carlsbad, CA) for 1 hour. These were then washed once with M9 and once with 1 mM levamisole before imaging.

Measuring viability
Adult worms were allowed to lay eggs overnight at 20°C. The adults were then removed and the percentage of eggs that hatched after one day was determined at 20°C. The percentage of hatched eggs that developed to adults was determined after 2 more days at 20°C. Each experiment was repeated five times and at least 90 eggs were counted in each case. The results represent the average of these experiments and the bars represent standard deviations.

Measurements and statistical methods
To determine sizes of compartments, confocal images of embryos were opened using Adobe Photoshop (Adobe Systems, San Jose, CA) and analyzed without any modification. At least 50 discrete intracellular structures from several embryos were selected and the number of pixels included was determined. The reported values reflect the average surface areas of the highlighted structures and the standard deviations (1 pixel is approximately 0.01 µm2).

To quantitate intensity of MRP-4::GFP or Nile Red staining, confocal images of embryos were opened using ImageJ software (National Institutes of Health, Bethesda, MD) and analyzed without any modification. At least 50 discrete intracellular structures from several embryos were selected and the integrated density (mean intensity divided by area) was determined. The reported values reflect the average integrated densities of the highlighted structures and the standard deviations.

Student's t-test was used to compare average measurements from two samples using a two-tailed distribution (Tails=2) and a two-sample unequal variance (Type=2).

The bars on the charts represent standard deviations.

cDNA sequencing
We sequenced the mrp-4 cDNA clone yk86a11. We also used 5' RACE to identify the 5' end of the mrp-4 mRNA (Roche, Indianapolis, IN). These results confirmed the predicted splicing pattern of mrp-4.

Molecular methods
Standard methods were used for the manipulation of recombinant DNA (Sambrook et al., 1989Go). Polymerase chain reaction (PCR) was done using the Expand Long Template PCR System (Boehringer Manheim, Manheim, Germany), according to the manufacturer's instructions. All other enzymes were from New England Biolabs (Beverly, MA) unless otherwise indicated. The transcriptional fusion of the mrp-4 promoter to GFP was made by PCR amplifying 3 kb of genomic sequences upstream of F21G4.2 using the forward primer (5' CACACAGCATGCCACACATCTATTAGGAATGTG 3') and the reverse primer (5' CACACAACCGGTCCGTATCTTCTCTCCTTATTTCG 3'). The resulting PCR product was digested with SphI and AgeI and subcloned into the same sites of pPD95.75. The MRP-4::GFP translational fusion was made by PCR amplifying 8.1 kb of genomic sequences using the forward primer (5' CACACAGCATGCCATTCGTATATATCCTCC 3') and the reverse primer (5' CACACAACCGGTATGAGGCCAGCGCGTTTGGCCATTGAGTAG 3'). The resulting PCR product was digested with SphI and AgeI and subcloned into the same sites of pPD95.75. This results in GFP fused to the C terminus of MRP-4 under the control of 2.7 kb of genomic sequences upstream of the F21G4.2 start codon. The plasmid pHD137 carries both wild type unc-119 and pmyo-2::GFP and was made by subcloning the 2.7 kb SphI-ApaI fragment from pPD118.33 into the XhoI-ApaI sites of plasmid MM106B after blunt-ending with T4 DNA Polymerase (Praitis et al., 2001Go).

Microscopy
Adult worms were allowed to lay eggs for one day on the NGM plates, sometimes supplemented with LysoTracker Red. Embryos were placed in M9 buffer for imaging. Confocal images were taken with a Nikon PCM 2000, using HeNe 543 nm excitation for the red dye and argon 488 nm for the green dye. Exactly the same exposure and magnification was used to capture the embryos from different strains that expressed the same marker.

Immunofluorescence staining of embryos using the IBF-2 antibody MH33 were done as previously described (Bossinger et al., 2004Go). Immunofluorescence staining of embryos using antibodies against RME-2 was done as previously described (Britton and Murray, 2004Go). Immunofluorescence staining of embryos using the LIN-12 antibody was done as previously described (Hermann et al., 2000Go). Exactly the same exposure and magnification was used to capture the embryos from different strains stained with the same antibodies.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification and molecular characterization of a suppressor of cup-5(null) lethality
We identified a mutation in the ABC Transporter MRP-4 that suppressed the embryonic lethality of cup-5(zu223)-null worms (see Materials and methods). mrp-4(cd8) single mutant worms were similar to wild-type worms in terms of the viability and the survival of laid eggs (Fig. 1A-C). In contrast to cup-5(zu223) worms that laid almost 100% dead eggs, 89±8% of mrp-4(cd8); cup-5(zu223) embryos hatched. Of the embryos that hatched, 73±14% developed to adults. However, only 27±9% of the adults were fertile, probably because the lysosomal defect resulting from the absence of CUP-5 in some tissues is not rescued by mrp-4(cd8). These results indicate that mutations in mrp-4 efficiently suppress the lethality because of the absence of CUP-5.

A phylogenetic analysis of the 60 predicted ABC Transporters in worms classified MRP-4 as an ABCC Transporter. This subfamily includes the human multidrug resistance proteins MRP1 to MRP-6; MRP-4 is most similar in sequence to human MRP1 and MRP3 (Sheps et al., 2004Go). Sequence analysis of cDNA clones identified an SL1 splice leader sequence 43 nucleotides before the predicted start codon (Krause and Hirsh, 1987Go) (Fig. 1D). MRP-4 is predicted to be 1573 amino acids long and to contain two ATP-binding cassettes. The cd8 mutation results in an early stop codon right before the first intron of the gene and is therefore predicted to be a null allele (Fig. 1D).


Figure 1
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Suppression of cup-5(zu223) by mrp-4(cd8). (A) Percentage of laid embryos of the indicated genotypes that hatched. (B) Percentage of hatched embryos of the indicated genotypes that developed into adults. (C) Percentage of adults of the indicated genotypes that were fertile. Normal media (white bars), media that included 14 mM methylpyruvate (mPvy; gray bars). (D) Sequence of mrp-4 showing the position of the SL1 trans-splice site, the translation initiation codon and open reading frame of the first exon (uppercase), and the sequence change in the cd8 mutant allele. The complete sequence of MRP-4 is available from GenBank (Accession Number NP_509658).

 


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2. mrp-4(cd8) suppresses the receptor degradation defect and the developmental defect of cup-5(zu223). Confocal micrographs of `1.5-fold' embryos of the indicated genotypes immunostained for the detection of RME-2, LIN-12 or IFB-2. Images of embryos stained with the same antibody were taken with the same exposure and magnification. All strains also carried the array. The outlines of the embryos are drawn. Scale bar: 10 µm.

 
mrp-4(cd8) rescues the lysosomal degradation defects of cup-5(zu223)
We wanted to determine whether the suppression of the cup-5(zu223) lethality by mrp-4(cd8) was due to the restoration of lysosomal function. We used quantitative fluorescence measurements instead of western blots for this analysis because the defect in cup-5(zu223) embryos is confined to specific stages of embryonic development (Schaheen et al., 2006Go). We also focused on developing intestinal cells at these embryonic stages because we can unambiguously identify intestinal (and pharyngeal) cells in cup-5(zu223) embryos based on position and morphology in the embryos. We see clear suppression of the lysosomal defects and we see clear MRP-4 expression only in this tissue (see below).

We had previously shown that the degradation of at least two membrane proteins, the yolk receptor RME-2 and the signaling protein LIN-12 is delayed in cup-5(zu223) embryos (Fig. 2) (Schaheen et al., 2006Go). By contrast, mrp-4(cd8); cup-5(zu223) embryos show normal degradation of RME-2 and of LIN-12 (Fig. 2).

We also checked the lysosomal degradation of a soluble protein. Yolk, and its associated proteins, is first endocytosed by oocytes and degraded by embryonic cells during development. During embryonic morphogenesis, yolk is secreted by all cells into the perivitelline space and is subsequently endocytosed by developing intestinal cells where it is stored in lysosomes (Bossinger and Schierenberg, 1996Go). At this stage in wild-type embryos, we can visualize the localization of yolk using a fusion of the yolk protein YP170 to GFP (Grant and Hirsh, 1999Go): all of the YP170::GFP compartments stain with LysoTracker Red (Fig. 3A) (Schaheen et al., 2006Go). We had previously shown that following this step, endocytosed YP170 accumulates in LysoTracker Red-staining expanded `lysosomes' in cup-5(zu223) embryos (Fig. 3A) (Schaheen et al., 2006Go). By contrast, 100% of the embryonic intestinal cells in both mrp-4(cd8) and mrp-4(cd8); cup-5(zu223) had normal-sized YP170-containing and LysoTracker Red-staining lysosomes (Fig. 3A,B). The average surface areas of YP170::GFP/LysoTracker Red-staining compartments in confocal sections were 1.03±0.37 µm2 (wild type), 1.03±0.23 µm2 (mrp-4), 4.21±2.45 µm2 (cup-5) and 1.26±0.5 µm2 (mrp-4; cup-5). The sizes of these compartments are essentially the same between wild type and mrp-4 (P 0.97), and between mrp-4 and mrp-4; cup-5 (P 0.16), but significantly different between wild type and cup-5 cells (P 0.0003). The borders of the YP170::GFP-staining compartments in all strains remains the same irrespective of exposure time, indicating that it is not an artifact caused by the saturation of the signal.


Figure 3
View larger version (67K):
[in this window]
[in a new window]
 
Fig. 3. mrp-4(cd8) suppresses yolk degradation and lipid accumulation defects of cup-5(zu223). (A) Confocal micrographs of `comma' stage embryos laid by hermaphrodites carrying the YP170::GFP transgene (green in merge) and grown on plates containing LysoTracker Red (red in merge). All images of the same marker were taken with the same exposure and at the same magnification. Arrows indicate staining of intestinal cells. (B) Quantitation of the surface area of the YP170::GFP/LysoTracker Red granules in intestinal cells shown in A. One pixel is ~0.01 µm2. (C) Confocal micrographs of `1.5-fold' stage embryos laid by the indicated hermaphrodites carrying the GFP::LGG-1 transgene. Long arrows indicate staining of intestinal cells. This transgene also carries a marker that expresses GFP in pharyngeal cells (short arrows). All images were taken with the same exposure and at the same magnification. (D) Confocal micrographs of wild-type, mrp-4(cd8), cup-5(zu223) or mrp-4(cd8); cup-5(zu223) `comma' stage embryos stained using the TUNEL assay to detect DNA-strand breaks. The average number of TUNEL-staining bodies in each strain is indicated at the top of each panel. (E) Confocal micrographs of `1.5 fold' stage embryos laid by hermaphrodites carrying the YP170::GFP transgene (green in merge) and stained for Nile Red (red in merge). All images of the same marker were taken with the same exposure and at the same magnification. Arrows indicate staining of intestinal cells. (F) Quantitation of the intensity per surface area of the Nile Red granules in intestinal cells shown in E. Scale bars: 10 µm in all images. The alleles in all panels are mrp-4(cd8) and cup-5(zu223).

 
We also measured the average intensity per unit area (integrated density) of the YP170::GFP-staining compartments (Fig. 3A). The resulting measurements, 0.283±0.202 (wild type), 0.287±0.245 (mrp-4), 2.206±0.421 (cup-5), 0.414±0.205 (mrp-4; cup-5), indicate that the accumulation of YP170::GFP due to loss of CUP-5 is largely suppressed in the absence of MRP-4. The measurements are essentially the same between wild type and mrp-4 (P 0.97), and between mrp-4 and mrp-4; cup-5 (P 0.28), but significantly different between wild type and cup-5 cells (P 8.2x10-10). These results indicate that MRP-4 is not required for the uptake of YP170::GFP by developing intestinal cells. Furthermore, the loss of MRP-4 rescues both the degradation defect and the `lysosome' expansion defects caused by the absence of CUP-5.

mrp-4(cd8) rescues the developmental defects of cup-5(zu223)
If lysosomal function is restored, then we expected that developing intestinal cells of mrp-4(cd8); cup-5(zu223) embryos would no longer show evidence of starvation (Schaheen et al., 2006Go). Indeed, in all of the mrp-4(cd8); cup-5(zu223) embryos, intestinal cells no longer activate autophagy to the same extent as cup-5(zu223) embryos, as determined by the fluorescence intensity using a GFP::LGG-1 (MAP-LC3 ortholog) reporter (Melendez et al., 2003Go; Schaheen et al., 2006Go) (Fig. 3C, large arrows). This rescue is specific to intestinal cells, as we still see increased GFP::LGG-1 staining in other cells and is consistent with the intestine-specific expression of MRP-4 (Fig. 3C, see below). Consistent with this result, mrp-4(cd8); cup-5(zu223) embryos, like cup-5(zu223) single mutants, still show increased apoptosis relative to wild type (Fig. 3D) (Gonzalez-Polo et al., 2005Go; Lum et al., 2005Go; Takacs-Vellai et al., 2005Go). We do not know whether the exacerbation of the lysosomal defect in tissues other than intestinal cells of cup-5(zu223) embryos is due to the accumulation of another ABC transporter or whether it is due to distinct mechanisms.

Providing mrp-4(cd8); cup-(zu223) worms with methylpyruvate, a membrane-permeable TCA substrate, slightly enhanced the number of hatched eggs (97±3%; P 0.07) but had no effect on the viability of hatched eggs (70±18%; P 0.8) or the sterility of the adults (21±12%; P 0.27) (Fig. 1A-C). This is in agreement with previous results that showed that methylpyruvate suppresses the autophagy and apoptosis defects but only partially rescues embryonic and does not rescue larval lethality of cup-5(zu223) worms by suppressing ectopic apoptosis (Fig. 1A,B) (Schaheen et al., 2006Go). The major cause of lethality of cup-5(zu223) embryos is developmental defects, including premature expression of the pmyo-2::GFP pharyngeal reporter and abnormalities in intestinal tissue architecture, based on the abnormal localization of the junctional intermediate filament protein IBF-2, in 100% of cup-5(zu223) embryos: these are not rescued by methylpyruvate (Schaheen et al., 2006Go). In contrast to methylpyruvate, none of the mrp-4(cd8); cup-5(zu223) show either one of these developmental defects (Fig. 2, Fig. 3C, small arrows). Thus, restoration of lysosomal function of cup-5(zu223) embryos is associated with suppression of developmental defects and with embryonic and larval survival.

MRP-4 is required for the transport of lipophilic compounds that accumulate in the large vacuoles of cup-5(zu223) embryos
Cells from individuals with mucolipidosis Type IV accumulate lipids in large vacuoles (Bargal and Bach, 1997Go; Chen et al., 1998Go; Jansen et al., 2001Go). We therefore asked whether cup-5(zu223) embryonic intestinal cells also accumulate lipids in large vacuoles and whether this was linked to the presence of MRP-4. Conjugates of lipophilic compounds with glutathione are preferred physiological substrates for human MRP1, MRP2 and MRP6 (Hirohashi et al., 1999Go; Jedlitschky and Keppler, 2002Go; Konig et al., 1999Go; Leier et al., 1996Go; Leier et al., 1994Go; Zeng et al., 2000Go). We therefore stained embryos with the lipophilic membrane-permeable dye Nile Red to determine whether there is an increase in lipid stores in embryos. Nile Red diffuses across membranes and fluoresces when it complexes with lipids (Bossinger and Schierenberg, 1996Go; Greenspan et al., 1985Go). We again used quantitative fluorescence measurements instead of biochemical assays because the defect in cup-5(zu223) embryos is confined to specific stages of embryonic development (Schaheen et al., 2006Go).

In wild-type developing intestinal cells, Nile Red stains intracellular compartments that only occasionally overlap with the YP170::GFP-stained compartments. This indicates that Nile Red-staining lipids are mostly absent from the lysosomes of developing intestinal cells in wild-type embryos (Fig. 3E,F). The average integrated density (ID), which represents intensity per unit area of Nile Red-stained compartments is 0.03±0.017. mrp-4(cd8) results in a noticeable decrease in Nile Red staining (ID=0.004±0.0014; P 0.004, relative to wild type) and which, as in wild type, only occasionally overlaps with YP170::GFP (Fig. 3E,F). This indicates that MRP-4 probably transports the Nile Red-staining lipophilic substrates into endosomes/lysosomes.

cup-5(zu223) results in a substantial increase in Nile Red staining (ID=0.091±0.024; P 0.006, relative to wild type) (Fig. 3E,F). All of the enlarged compartments that contain YP170::GFP also stain for Nile Red. However, some Nile Red-stained compartments do not contain YP170::GFP (Fig. 3E). This indicates that the maturing and terminal endocytic compartments in cup-5(zu223) embryonic cells accumulate Nile Red-staining lipids. This increase in Nile Red staining is mostly due to MRP-4 activity, as opposed to the lack of CUP-5 function, as it is largely absent in mrp-4(cd8); cup-5(zu223) embryos (ID=0.0032±0.0019; P 0.004, relative to wild type; P 0.41, relative to mrp-4) (Fig. 3E,F).

MRP-4 is expressed in developing intestinal cells and accumulates in cup-5(zu223) embryos
To determine the expression pattern of MRP-4, we fused 3 kb of mrp-4 promoter that includes sequences up to the next gene to GFP. The introns in mrp-4 are small and unlikely to include important regulatory elements. This transcriptional reporter showed that mrp-4 is expressed in developing intestinal cells at all stages of development, which is consistent with earlier reports (Zhao et al., 2004Go) (Fig. 4A). This suggests that intestinal defects contribute significantly to the death of embryos lacking CUP-5. This is also consistent with the high incidence of sterility in rescued mrp-4(cd8); cup-5(zu223) embryos and with the lack of rescue of the lysosomal defect in cup-5(ar465) and cup-5(zu223) coelomocytes by mrp-4(cd8), although we do not know yet whether these defects are due to elevated levels of another ABC transporter (Fares and Greenwald, 2001bGo; Treusch et al., 2004Go; Xue and Horvitz, 1997Go) (H.F., unpublished).


Figure 4
View larger version (48K):
[in this window]
[in a new window]
 
Fig. 4. Functional complementation of mrp-4(cd8) and localization of MRP-4::GFP. (A) Confocal micrographs of `1.5-fold' stage embryo or adult hermaphrodites expressing a transcriptional fusion of the mrp-4 promoter to GFP. (B) Percent of embryos that hatch and percent of hatched embryos that develop to adults in the indicated strains. (C) Confocal micrographs of `1.5-fold' stage embryos laid by hermaphrodites carrying the MRP-4::GFP transgene (green in merge) and grown on plates containing LysoTracker Red (red in merge). All images of the same marker were taken with the same exposure and at the same magnification. (D) Quantitation of the surface area of the LysoTracker Red granules in intestinal cells shown in C. Wild-type and cup-5(zu223) values are included for comparison. One pixel is ~0.01 µm2. (E) Confocal micrographs of `1.5 fold' stage embryos laid by hermaphrodites carrying the MRP-4::GFP transgene (green in merge) and stained with Nile Red (red in merge). All images of the same marker were taken with the same exposure and at the same magnification. (F) Quantitation of the intensity per surface area of the Nile Red granules in intestinal cells shown in E. Wild type and cup-5(zu223) values are included for comparison. The alleles in all panels are mrp-4(cd8) and cup-5(zu223). Scale bar: ~10 µm in C,D. Large arrows indicate staining of intestinal cells. The MRP-4::GFP transgene also carries a marker that expresses GFP in pharyngeal cells (small arrows).

 
To determine the subcellular localization of the MRP-4 protein, we fused GFP to the C terminus of MRP-4 and expressed it using its own promoter. This MRP-4::GFP fusion protein is at least partially functional as it reverses the suppression of cup-5(zu223) defects by mrp-4(cd8). First, although 89±8% of mrp-4(cd8); cup-5(zu223) embryos hatch, only 53.6±14% of the same embryos carrying the MRP-4::GFP transgene hatch (Fig. 4B). Furthermore, whereas 73±14% of the mrp-4(cd8); cup-5(zu223) hatched embryos develop to adults, only 26.8±23.2% of the same embryos carrying the MRP-4::GFP transgene do (Fig. 4B). Second, around 30% of the mrp-4(cd8); cup-5(zu223) embryos carrying the MRP-4::GFP transgene show premature expression of a pharyngeal reporter, as opposed to none of the embryos carrying the GFP::LGG-1 transgene that also expresses GFP in pharyngeal cells (small arrows in Fig. 4C). Third, in the mrp-4(cd8); cup-5(zu223); cdIs(MRP-4::GFP) embryos that show premature expression of GFP in the pharynx, the sizes of the LysoTracker Red-stained compartments in developing intestinal cells are similar to those in cup-5(zu223) embryos (P 0.8) (Fig. 4D). Fourth, in the mrp-4(cd8); cup-5(zu223); cdIs(MRP-4::GFP) embryos that show premature expression of GFP in the pharynx, the intensities of the Nile Red-stained compartments in developing intestinal cells are similar to those in cup-5(zu223) embryos (P 0.85), and those of mrp-4(cd8); cdIs(MRP-4::GFP) embryos are similar to those in wild-type embryos (P 0.44) and significantly different than mrp-4(cd8) embryos (P 0.00015) (Fig. 4F).

MRP-4::GFP localizes to discrete compartments (integrated density of the GFP staining is 0.021±0.01) that partially co-localize with LysoTracker Red in developing intestinal cells. This indicates that at least some MRP-4::GFP localizes to late endocytic compartments. Some compartments stain with MRP-4::GFP but not with LysoTracker Red and may represent other endocytic compartments or cellular organelles. Conversely, some compartments stain with LysoTracker Red but not with MRP-4::GFP: these may constitute lysosomes that are devoid of MRP-4, either because MRP-4 is normally degraded in these compartments or because MRP-4 does not normally traffic to lysosomes but is transported to other organelles (Fig. 4C).

In cup-5(zu223) developing intestinal cells, MRP-4::GFP puncta are dramatically increased in size and intensity (integrated density of the GFP staining is 0.097±0.05, P 0.009, relative to wild type), indicating a defect in the degradation of MRP-4 (Fig. 4C). In this background, all of the LysoTracker Red-staining compartments contained MRP-4::GFP, indicating that this protein accumulates in the terminal cup-5(zu223) compartments. Some of the MRP-4::GFP-labeled enlarged compartments did not stain for LysoTracker Red in cup-5(zu223) embryos and may represent `maturing' endosomes/lysosomes intermediates (Fig. 4C). MRP-4::GFP staining almost completely overlaps with Nile Red both in wild-type and in cup-5(zu223) cells, which is consistent with the intensity of the Nile Red staining in endosomes/lysosomes being dependent on the presence of MRP-4 (Fig. 3E, Fig. 4D).

cup-5(zu223) lethality is not due to enlarged vacuoles/lysosomes
We thought it possible, although unlikely, that the loss of MRP-4 may rescue the lethality and lysosomal function of cup-5(zu223) embryos by reducing the sizes of lysosomes. We tested this indirectly by testing whether mutations in upstream regulators of endocytosis rescue the lethality of cup-5(zu223) embryos. Loss-of-function mutations in RME-1 (EH-domain protein required in recycling endosomes), RME-6 (RAB-5 GDP/GTP exchange factor required at the plasma membrane and early endosomes) or CUP-10 (myotubularin required at the plasma membrane and endosomes) significantly reduce lysosome sizes of cup-5(zu223) embryos (Dang et al., 2003Go; Grant et al., 2001Go; Sato et al., 2005Go; Xue et al., 2003Go) (see Fig. S1 in the supplementary material). None of these mutations rescue the accumulation of Nile Red-staining compounds in compartments of developing intestinal cells in cup-5(zu223) embryos (see Fig. S2 in the supplementary material). This is in effect the reverse phenotypes of what we see for mrp-4(cd8). However, none of these mutations rescued the lethality of cup-5(zu223) embryos, indicating that reducing the rate of uptake, which leads to a reduction in the sizes of lysosomes, is not sufficient to alleviate the lethality of cup-5(zu223) (see Fig. S3 in the supplementary material).

Rescue of cup-5(zu223) is specific to reducing levels of MRP-4
We used RNAi to test whether reducing the levels of other ABC transporters in worms rescues the cup-5(zu223) embryonic lethality. RNAi of mrp-4 results in 65.5±2% of the cup-5(zu223) embryos hatching, indicating that this is a feasible approach to test the specificity of the suppression by MRP-4. Of the 59 remaining predicted worm ABC transporters, only RNAi of pgp-2 gave any suppression of embryonic lethality. This was surprising as PGP-2 is not even expressed in the intestine (Nunes et al., 2005Go). Indeed, the null mutation pgp-2(gk114) did not produce any rescue of cup-5(zu223) (Nunes et al., 2005Go). The rescue by pgp-2 RNAi is probably due to sequences in the pgp-2 double-stranded RNA that are complementary to sequences in other worm ABC transporters, including MRP-4. These results indicate that suppression of cup-5(zu223) lethality is not a general feature of reducing ABC transporter levels, but is specific to MRP-4. Of the 27 worm ABC transporters that are expressed in intestinal cells, PGP-1 and PGP-3 localize to the apical membrane, whereas nothing is known about the subcellular distribution of the rest (Broeks et al., 1995Go; Zhao et al., 2004Go).

Loss of MRP-4 does not rescue lethality due to reduced endocytic uptake or to activation of apoptosis
The reversal of the cup-5(zu223) lysosomal degradation defect by the loss of MRP-4 suggests that mrp-4(cd8) would not rescue embryonic lethality because of non-lysosomal defects. Indeed, mrp-4(cd8) does not rescue a loss-of-function mutation in ced-9, which results in the activation of apoptosis in most embryonic cells (Fig. 5A). Furthermore, mrp-4(cd8) does not rescue the lethality caused by a null mutation in the yolk receptor RME-2, which severely reduces the availability of yolk in embryonic cells without affecting lysosomal function (Fig. 5A).

Loss of MRP-4 partially rescues lethality due to loss of cathepsin L
We finally asked whether loss of MRP-4 could rescue lysosomal defects that are due to the loss of other proteins than CUP-5. A null mutation in CPL-1, the cathepsin L protease, results in progressively enlarged lysosomes and embryonic lethality (Britton and Murray, 2004Go). Loss of MRP-4 does not rescue this lethality (Fig. 5A). The caveat in this experiment is that embryos lacking CPL-1 die at a much earlier stage than the onset of MRP-4 expression in intestinal cells (Britton and Murray, 2004Go). It had previously been shown that reducing the levels of RME-2 (the yolk receptor) allows some cpl-1 mutant embryos to develop to later stages (Britton and Murray, 2004Go). We thought that these embryos may arrest at the later stages because of the accumulation of MRP-4 in the absence of CPL-1. We therefore reduced the levels of RME-2 by RNAi in cpl-1 and in mrp-4; cpl-1 mutants. We consistently saw a small fraction of embryos that hatched and that developed to adults after RNAi of mrp-4; cpl-1 but not of cpl-1 mutants (Fig. 5B). This suggests that increased MRP-4 activity, either resulting from the absence of the transmembrane channel CUP-5 or from the loss of the lumenal enzyme CPL-1, exacerbates their defects.


    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We show in this study that the accumulation of an endosomal/lysosomal ABC transporter exacerbates the lysosomal degradation defects of cells lacking CUP-5. In the absence of MRP-4, lysosomal function is restored in the developing intestinal cells of cup-5(null). This results in the rescue of two other developmental defects, the premature expression of pmyo-2::GFP in pharyngeal cells and the restoration of intestinal tissue architecture. Given the restricted expression of MRP-4 in intestinal cells, the restoration of intestinal tissue architecture is probably due to a cell-autonomous requirement of lysosomes for the degradation of at least some junctional proteins (d'Azzo et al., 2005Go; Salameh, 2006Go). The suppression of the premature pharyngeal expression is probably non-cell-autonomous, and could be due either to defective connections between intestinal and pharyngeal tissues and/or to signaling abnormalities between the two tissues in the absence of CUP-5.


Figure 5
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. Suppression of other mutations by mrp-4(cd8). (A) Percentage of laid embryos of the indicated genotypes that hatched. ced-9 embryos that hatched arrested development as L1 larvae. All of the hatched embryos from other strains developed into adults. (B) Percentage of laid embryos of the indicated genotypes that hatched after control or rme-2 RNAi. Alleles used are ced-9(n1950n2161), rme-2((b1008), cpl-1(ok360), cup-5(zu223) and mrp-4(cd8).

 
We propose a model in which MRP-4 is normally found on endosomes and/or lysosomes where it functions in the transport of compounds, possibly organic anions, into these compartments. Although we do not know the traffic itinerary of MRP-4, our data indicate that in the absence of CUP-5, there is a preliminary defect leading to a delay in the degradation or the mistrafficking of MRP-4, leading to its accumulation on endocytic organelles. The import of compounds by MRP-4 further inhibits the activity of degradative enzymes within lysosomes, which in turn leads to an additional increase in MRP-4 levels. Such a feedback loop ultimately results in a severe defect in lysosomal activity, in the accumulation of lipids and other proteins, and in an increase in the size of the terminal endocytic compartment by an unknown mechanism.

Several mammalian ABC transporters localize to late endosomes/lysosomes, including the ABCB transporter (MDR/TAP) member 6, ABCA1, ABCA2, ABCA3, ABCA5, ABCB9 and the ABCC transporter MRP2 (Bagshaw et al., 2005Go; Chen et al., 2005Go; Cheong et al., 2006Go; Kubo et al., 2005Go; Neufeld et al., 2004Go; Zhang et al., 2000Go; Zhou et al., 2001Go). ABCA1 traffics between late endosomes and the cell surface and is required for the efflux from the cell of cholesterol in late endosomes (Chen et al., 2005Go; Neufeld et al., 2004Go). ABCA5-knockout mice accumulate lysosomes and autophagosomes in their cardiomyocytes, indicating a requirement of these transporters in late endocytic trafficking (Kubo et al., 2005Go). Finally, and consistent with the proposed function of MRP-4 in the transport of lipophilic substances into compartments, ABCA3 is required for late endosomal/lysosomal loading of phosphatidylcholine and for the maturation of late endosomes (Cheong et al., 2006Go).

Distinct pathways may be the source of this lysosome `overload', and hence the exacerbation of lysosomal defects resulting from a primary lesion, in different cell types. In developing intestinal cells of worm embryos, MRP-4 transports compounds into endosomes/lysosomes. In other cells, lysosome `overloading' may be accomplished by endocytosis of various substrates. For example, embryos laid by worms lacking CPL-1, the cathepsin L protease, are unable to degrade both the yolk protein YP170 and yolk itself (Britton and Murray, 2004Go). Furthermore, decreasing the lipid load in lysosomes of this mutant, by reducing the amount of yolk taken up by oocytes, reduces the size of the expanded lysosomes and allows some of these embryos to develop to later stages (Britton and Murray, 2004Go).

Most lysosomal disorders show similar cell biological abnormalities: lysosomal enlargement and the accumulation of multiple substrates (Vellodi, 2005Go). We propose that a common mechanism for the exacerbation of the symptoms is that a primary lesion results in the progressive accumulation of substrates in lysosomes that ultimately lead to inhibition of other lysosomal enzymes. In some cell types, a reduction in the rate of degradation of endosomal/lysosomal ABC transporters may be the primary reason for the accumulation of these substrates.

Therapies for lysosomal storage diseases based on supplying cells with the enzymes they are deficient for do not result in complete recovery with results that vary considerably based on the age of onset and the rapidity of progression (Desnick, 2004Go; Jeyakumar et al., 2005Go; Vellodi, 2005Go). We propose that in these more severe cases, the lysosomes may have already accumulated substances that inactivate lysosomal enzymes. New enzymes that are delivered to these aberrant lysosomes may not be fully functional. Inactivating endosomal/lysosomal ABC transporters, in conjunction with established therapies, may prove more effective for restoring lysosomal function of some cells.

There is considerable research aimed at inactivating MDR and MRP transporters because of their ability to confer resistance to cytotoxic and antiviral drugs (Glavinas et al., 2004Go; Haimeur et al., 2004Go). Recent studies using diterpenic lactones isolated from Euphorbia, or shRNAi constructs, have shown a reversal of the multidrug resistance activity of the ABCB transporter MDR1 in mouse cells (Ferreira et al., 2005Go; Pichler et al., 2005Go). Reducing the activity of lysosomal ABC transporters in various cells may be a viable treatment strategy for the treatment of mucolipidosis type IV, and perhaps of other lysosomal disorders.

Supplementary material
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/19/3939/DC1


    ACKNOWLEDGMENTS
 
We are grateful for Barth Grant, Stuart Kim and James McGhee for antibodies to RME-2, LIN-12 and IFB-2, respectively. We also thank Alicia Melendez for the GFP::LGG-1 construct. Some nematode strains used in this work were provided by the Caenorhabditis Genetics Center, which is funded by the NIH National Center for Research Resources. The authors declare that they have no competing financial interests. This work was funded by a March of Dimes grant (#6-FY04-60) and an NIGMS grant GM65235 to H.F.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Altarescu, G., Sun, M., Moore, D. F., Smith, J. A., Wiggs, E. A., Solomon, B. I., Patronas, N. J., Frei, K. P., Gupta, S., Kaneski, C. R. et al. (2002). The neurogenetics of mucolipidosis type IV. Neurology 59,306 -313.[Abstract/Free Full Text]
Bach, G. (2001). Mucolipidosis Type IV. Mol. Genet. Metab. 73,197 -203.[CrossRef][Medline]
Bagshaw, R. D., Mahuran, D. J. and Callahan, J. W. (2005). A proteomic analysis of lysosomal integral membrane proteins reveals the diverse composition of the organelle. Mol. Cell. Proteomics 4,133 -143.[Abstract/Free Full Text]
Bargal, R. and Bach, G. (1997). Mucolipidosis type IV: abnormal transport of lipids to lysosomes. J. Inherit. Metab. Dis. 20,625 -632.[CrossRef][Medline]
Bargal, R., Avidan, N., Ben-Asher, E., Olender, Z., Zeigler, M., Frumkin, A., Raas-Rothschild, A., Glusman, G., Lancet, D. and Bach, G. (2000). Identification of the gene causing Mucolipidosis Type IV. Nat. Genet. 26,118 -123.[CrossRef][Medline]
Bassi, M. T., Manzoni, M., Monti, E., Pizzo, M. T., Ballabio, A. and Borsani, G. (2000). Cloning of the gene encoding a novel integral membrane protein, mucolipidin-and identification of the two major founder mutations causing Mucolipidosis Type IV. Am. J. Hum. Genet. 67,1110 -1120.[Medline]
Bauer, B. E., Wolfger, H. and Kuchler, K. (1999). Inventory and function of yeast ABC proteins: about sex, stress, pleiotropic drug and heavy metal resistance. Biochim. Biophys. Acta 1461,217 -236.[Medline]
Bossinger, O. and Schierenberg, E. (1996). The use of fluorescent marker dyes for studying intercellular communication in nematode embryos. Int. J. Dev. Biol. 40,431 -439.[Medline]
Bossinger, O., Fukushige, T., Claeys, M., Borgonie, G. and McGhee, J. D. (2004). The apical disposition of the Caenorhabditis elegans intestinal terminal web is maintained by LET-413. Dev. Biol. 268,448 -456.[CrossRef][Medline]
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.[Abstract/Free Full Text]
Britton, C. and Murray, L. (2004). Cathepsin L protease (CPL-1) is essential for yolk processing during embryogenesis in Caenorhabditis elegans. J. Cell Sci. 117,5133 -5143.[Abstract/Free Full Text]
Broeks, A., Janssen, H. W., Calafat, J. and Plasterk, R. H. (1995). A P-glycoprotein protects Caenorhabditis elegans against natural toxins. EMBO J. 14,1858 -1866.[Medline]
Chen, C. S., Bach, G. and Pagano, R. E. (1998). Abnormal transport along the lysosomal pathway in Mucolipidosis Type IV disease. Proc. Natl. Acad. Sci. USA 95,6373 -6378.[Abstract/Free Full Text]
Chen, W., Wang, N. and Tall, A. R. (2005). A PEST deletion mutant of ABCA1 shows impaired internalization and defective cholesterol efflux from late endosomes. J. Biol. Chem. 280,29277 -29281.[Abstract/Free Full Text]
Cheong, N., Madesh, M., Gonzales, L. W., Zhao, M., Yu, K., Ballard, P. L. and Shuman, H. (2006). Functional and trafficking defects in ATP binding cassette A3 mutants associated with respiratory distress syndrome. J. Biol. Chem. 281,9791 -9800.[Abstract/Free Full Text]
d'Azzo, A., Bongiovanni, A. and Nastasi, T. (2005). E3 ubiquitin ligases as regulators of membrane protein trafficking and degradation. Traffic 6, 429-441.[CrossRef][Medline]
Dang, H., Li, Z., Skolnik, E. Y. and Fares, H. (2003). Disease-related myotubularins function in endocytic traffic. Mol. Biol. Cell 15,189 -196.[Medline]
Dean, M., Hamon, Y. and Chimini, G. (2001). The human ATP-binding cassette (ABC) transporter superfamily. J. Lipid Res. 42,1007 -1017.[Abstract/Free Full Text]
Desnick, R. J. (2004). Enzyme replacement and enhancement therapies for lysosomal diseases. J. Inherit. Metab. Dis. 27,385 -410.[Medline]
Fares, H. and Greenwald, I. (2001a). Genetic analysis of endocytosis in Caenorhabditis elegans. Coelomocyte uptake defective mutants. Genetics 159,133 -145.[Abstract/Free Full Text]
Fares, H. and Greenwald, I. (2001b). Regulation of endocytosis by CUP-5, the Caenorhabditis elegans mucolipin-1 homologue. Nat. Genet. 28, 64-68.[CrossRef][Medline]
Ferreira, M. J., Gyemant, N., Madureira, A. M. and Molnar, J. (2005). Inhibition of P-glycoprotein transport activity in a resistant mouse lymphoma cell line by diterpenic lactones. Anticancer Res. 25,3259 -3262.[Abstract/Free Full Text]
Glavinas, H., Krajcsi, P., Cserepes, J. and Sarkadi, B. (2004). The role of ABC transporters in drug resistance, metabolism and toxicity. Curr. Drug Deliv. 1, 27-42.[CrossRef][Medline]
Gonzalez-Polo, R. A., Boya, P., Pauleau, A. L., Jalil, A., Larochette, N., Souquere, S., Eskelinen, E. L., Pierron, G., Saftig, P. and Kroemer, G. (2005). The apoptosis/autophagy paradox: autophagic vacuolization before apoptotic death. J. Cell Sci. 118,3091 -3102.[Abstract/Free Full Text]
Graham, P. L. and Kimble, J. (1993). The mog-1 gene is required for the switch from spermatogenesis to oogenesis in Caenorhabditis elegans. Genetics 133,919 -931.[Abstract]
Grant, B. and Hirsh, D. (1999). Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Mol. Biol. Cell 10,4311 -4326.[Abstract/Free Full Text]
Grant, B., Zhang, Y., Paupard, M.-C., Lin, S. X., Hall, D. H. and Hirsh, D. (2001). Evidence that RME-1, a conserved C. elegans EH domain protein, functions in endocytic recycling. Nat. Cell Biol. 3,573 -579.[CrossRef][Medline]
Greenspan, P., Mayer, E. P. and Fowler, S. D. (1985). Nile red: a selective fluorescent stain for intracellular lipid droplets. J. Cell Biol. 100,965 -973.[Abstract/Free Full Text]
Gumienny, T. L., Lambie, E., Hartwieg, E., Horvitz, H. R. and Hengartner, M. O. (1999). Genetic control of programmed cell death in the Caenorhabditis elegans hermaphrodite germline. Development 126,1011 -1022.[Abstract]
Haimeur, A., Conseil, G., Deeley, R. G. and Cole, S. P. (2004). The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation. Curr. Drug Metab. 5,21 -53.[CrossRef][Medline]
Hermann, G. J., Leung, B. and Priess, J. R. (2000). Left-right asymmetry in C. elegans intestine organogenesis involves a LIN-12/Notch signaling pathway. Development 127,3429 -3440.[Abstract]
Hersh, B. M., Hartwieg, E. and Horvitz, H. R. (2002). The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types. Proc. Natl. Acad. Sci. USA 99,4355 -4360.[Abstract/Free Full Text]
Hirohashi, T., Suzuki, H. and Sugiyama, Y. (1999). Characterization of the transport properties of cloned rat multidrug resistance-associated protein 3 (MRP3). J. Biol. Chem. 274,15181 -15185.[Abstract/Free Full Text]
Holland, K. A. and Holland, I. B. (2005). Adventures with ABC-proteins: highly conserved ATP-dependent transporters. Acta Microbiol. Immunol. Hung. 52,309 -322.[CrossRef][Medline]
Jansen, S. M., Groener, J. E., Bax, W. and Poorthuis, B. J. (2001). Delayed lysosomal metabolism of lipids in Mucolipidosis Type IV fibroblasts after LDL-receptor-mediated endocytosis. J. Inherit. Metab. Dis. 24,577 -586.[CrossRef][Medline]
Jedlitschky, G. and Keppler, D. (2002). Transport of leukotriene C4 and structurally related conjugates. Vitam. Horm. 64,153 -184.[Medline]
Jeyakumar, M., Dwek, R. A., Butters, T. D. and Platt, F. M. (2005). Storage solutions: treating lysosomal disorders of the brain. Nat. Rev. Neurosci. 6, 713-725.[Medline]
Konig, J., Nies, A. T., Cui, Y., Leier, I. and Keppler, D. (1999). Conjugate export pumps of the multidrug resistance protein (MRP) family: localization, substrate specificity, and MRP2-mediated drug resistance. Biochim. Biophys. Acta 1461,377 -394.[Medline]
Krause, M. and Hirsh, D. (1987). A trans-spliced leader sequence on actin mRNA in C. elegans.Cell 49,753 -761.[CrossRef][Medline]
Kubo, Y., Sekiya, S., Ohigashi, M., Takenaka, C., Tamura, K., Nada, S., Nishi, T., Yamamoto, A. and Yamaguchi, A. (2005). ABCA5 resides in lysosomes, and ABCA5 knockout mice develop lysosomal disease-like symptoms. Mol. Cell. Biol. 25,4138 -4149.[Abstract/Free Full Text]
LaPlante, J. M., Falardeau, J., Sun, M., Kanazirska, M., Brown, E. M., Slaugenhaupt, S. A. and Vassilev, P. M. (2002). Identification and characterization of the single channel function of human mucolipin-1 implicated in mucolipidosis type IV, a disorder affecting the lysosomal pathway. FEBS Lett. 532,183 -187.[CrossRef][Medline]
Leier, I., Jedlitschky, G., Buchholz, U., Cole, S. P., Deeley, R. G. and Keppler, D. (1994). The MRP gene encodes an ATP-dependent export pump for leukotriene C4 and structurally related conjugates. J. Biol. Chem. 269,27807 -27810.[Abstract/Free Full Text]
Leier, I., Jedlitschky, G., Buchholz, U., Center, M., Cole, S. P., Deeley, R. G. and Keppler, D. (1996). ATP-dependent glutathione disulphide transport mediated by the MRP gene-encoded conjugate export pump. Biochem. J. 314,433 -437.[Medline]
Lum, J. J., Bauer, D. E., Kong, M., Harris, M. H., Li, C., Lindsten, T. and Thompson, C. B. (2005). Growth factor regulation of autophagy and cell survival in the absence of apoptosis. Cell 120,237 -248.[CrossRef][Medline]
Melendez, A., Talloczy, Z., Seaman, M., Eskelinen, E. L., Hall, D. H. and Levine, B. (2003). Autophagy genes are essential for dauer development and life-span extension in C. elegans.Science 301,1387 -1391.[Abstract/Free Full Text]
Neufeld, E. B., Stonik, J. A., Demosky, S. J., Jr, Knapper, C. L., Combs, C. A., Cooney, A., Comly, M., Dwyer, N., Blanchette-Mackie, J., Remaley, A. T. et al. (2004). The ABCA1 transporter modulates late endocytic trafficking: insights from the correction of the genetic defect in Tangier disease. J. Biol. Chem. 279,15571 -15578.[Abstract/Free Full Text]
Nunes, F., Wolf, M., Hartmann, J. and Paul, R. J. (2005). The ABC transporter PGP-2 from Caenorhabditis elegans is expressed in the sensory neuron pair AWA and contributes to lysosome formation and lipid storage within the intestine. Biochem. Biophys. Res. Commun. 338,862 -871.[CrossRef][Medline]
Pichler, A., Zelcer, N., Prior, J. L., Kuil, A. J. and Piwnica-Worms, D. (2005). In vivo RNA interference-mediated ablation of MDR1 P-glycoprotein. Clin. Cancer Res. 11,4487 -4494.[Abstract/Free Full Text]
Praitis, V., Casey, E., Collar, D. and Austin, J. (2001). Creation of low-copy integrated transgenic lines in Caenorhabditis elegans. Genetics 157,1217 -1226.[Abstract/Free Full Text]
Raychowdhury, M. K., Gonzalez-Perrett, S., Montalbetti, N., Timpanaro, G. A., Chasan, B., Goldmann, W. H., Stahl, S., Cooney, A., Goldin, E. and Cantiello, H. F. (2004). Molecular pathophysiology of mucolipidosis type IV: pH dysregulation of the mucolipin-1 cation channel. Hum. Mol. Genet. 13,617 -627.[Abstract/Free Full Text]
Salameh, A. (2006). Life cycle of connexins: regulation of connexin synthesis and degradation. Adv. Cardiol. 42,57 -70.[Medline]
Sambrook, J., Fritch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual (2nd edn). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sato, M., Sato, K., Fonarev, P., Huang, C. J., Liou, W. and Grant, B. D. (2005). Caenorhabditis elegans RME-6 is a novel regulator of RAB-5 at the clathrin-coated pit. Nat. Cell Biol. 7,559 -569.[CrossRef][Medline]
Schaheen, L., Dang, H. and Fares, H. (2006). Basis of lethality in C. elegans lacking CUP-5, the mucolipidosis type IV orthologue. Dev. Biol. 293,382 -391.[CrossRef][Medline]
Sheps, J. A., Ralph, S., Zhao, Z., Baillie, D. L. and Ling, V. (2004). The ABC transporter gene family of Caenorhabditis elegans has implications for the evolutionary dynamics of multidrug resistance in eukaryotes. Genome Biol. 5, R15.[CrossRef][Medline]
Siegfried, K. R., Kidd, A. R., 3rd, Chesney, M. A. and Kimble, J. (2004). The sys-1 and sys-3 genes cooperate with Wnt signaling to establish the proximal-distal axis of the Caenorhabditis elegans gonad. Genetics 166,171 -186.[Abstract/Free Full Text]
Sun, M., Goldin, E., Stahl, S., Falardeau, J. L., Kennedy, J. C., Acierno, J. S., Jr, Bove, C., Kaneski, C. R., Nagle, J., Bromley, M. C. et al. (2000). Mucolipidosis Type IV is caused by mutations in a gene encoding a novel transient receptor potential channel. Hum. Mol. Genet. 9,2471 -2478.[Abstract/Free Full Text]
Takacs-Vellai, K., Vellai, T., Puoti, A., Passannante, M., Wicky, C., Streit, A., Kovacs, A. L. and Muller, F. (2005). Inactivation of the autophagy gene bec-1 triggers apoptotic cell death in C. elegans. Curr. Biol. 15,1513 -1517.[CrossRef][Medline]
Timmons, L. and Fire, A. (1998). Specific interference by ingested dsRNA. Nature 395, 854.[CrossRef][Medline]
Treusch, S., Knuth, S., Slaugenhaupt, S. A., Goldin, E., Grant, B. D. and Fares, H. (2004). Caenorhabditis elegans functional orthologue of human protein h-mucolipin-1 is required for lysosome biogenesis. Proc. Natl. Acad. Sci. USA 101,4483 -4488.[Abstract/Free Full Text]
Vellodi, A. (2005). Lysosomal storage disorders. Br. J. Haematol. 128,413 -431.[CrossRef][Medline]
Williams, B. D., Schrank, B., Huynh, C., Shownkeen, R. and Waterston, R. H. (1992). A genetic mapping system in Caenorhabditis elegans based on polymorphic sequence-tagged sites. Genetics 131,609 -624.[Abstract]
Xue, D. and Horvitz, H. R. (1997). Caenorhabditis elegans CED-9 protein is a bifunctional cell-death inhibitor. Nature 390,305 -308.[CrossRef][Medline]
Xue, Y., Fares, H., Grant, B., Li, Z., Rose, A. M., Clark, S. G. and Skolnik, E. Y. (2003). Genetic analysis of the myotubularin family of phosphatases in Caenorhabditis elegans. J. Biol. Chem. 278,34380 -34386.[Abstract/Free Full Text]
Zeng, H., Liu, G., Rea, P. A. and Kruh, G. D. (2000). Transport of amphipathic anions by human multidrug resistance protein 3. Cancer Res. 60,4779 -4784.[Abstract/Free Full Text]
Zhang, F., Zhang, W., Liu, L., Fisher, C. L., Hui, D., Childs, S., Dorovini-Zis, K. and Ling, V. (2000). Characterization of ABCB9, an ATP binding cassette protein associated with lysosomes. J. Biol. Chem. 275,23287 -23294.[Abstract/Free Full Text]
Zhao, Z., Sheps, J. A., Ling, V., Fang, L. L. and Baillie, D. L. (2004). Expression analysis of ABC transporters reveals differential functions of tandemly duplicated genes in Caenorhabditis elegans. J. Mol. Biol. 344,409 -417.[CrossRef][Medline]
Zhou, C., Zhao, L., Inagaki, N., Guan, J., Nakajo, S., Hirabayashi, T., Kikuyama, S. and Shioda, S. (2001). ATP-binding cassette transporter ABC2/ABCA2 in the rat brain: a novel mammalian lysosome-associated membrane protein and a specific marker for oligodendrocytes but not for myelin sheaths. J. Neurosci. 21,849 -857.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
H. Kawai, T. Tanji, H. Shiraishi, M. Yamada, R. Iijima, T. Inoue, Y. Kezuka, K. Ohashi, Y. Yoshida, K. Tohyama, et al.
Normal Formation of a Subset of Intestinal Granules in Caenorhabditis elegans Requires ATP-binding Cassette Transporters HAF-4 and HAF-9, Which Are Highly Homologous to Human Lysosomal Peptide Transporter TAP-Like
Mol. Biol. Cell, June 15, 2009; 20(12): 2979 - 2990.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
E. Goldin, R. C. Caruso, W. Benko, C. R. Kaneski, S. Stahl, and R. Schiffmann
Isolated Ocular Disease Is Associated with Decreased Mucolipin-1 Channel Conductance
Invest. Ophthalmol. Vis. Sci., July 1, 2008; 49(7): 3134 - 3142.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
P. Sundaram, W. Han, N. Cohen, B. Echalier, J. Albin, and L. Timmons
Caenorhabditis elegans ABCRNAi Transporters Interact Genetically With rde-2 and mut-7
Genetics, February 1, 2008; 178(2): 801 - 814.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
E. Currie, B. King, A. L. Lawrenson, L. K. Schroeder, A. M. Kershner, and G. J. Hermann
Role of the Caenorhabditis elegans Multidrug Resistance Gene, mrp-4, in Gut Granule Differentiation
Genetics, November 1, 2007; 177(3): 1569 - 1582.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.02575v1
133/19/3939    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaheen, L.
Right arrow Articles by Fares, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaheen, L.
Right arrow Articles by Fares, H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?