First published online 8 December 2005
doi: 10.1242/dev.02188
Development 133, 237-250 (2006)
Published by The Company of Biologists 2006
XCR2, one of three Xenopus EGF-CFC genes, has a distinct role in the regulation of left-right patterning
Yasuko Onuma1,
Chang-Yeol Yeo2 and
Malcolm Whitman1,*
1 Department of Developmental Biology, Harvard School of Dental Medicine, 188
Longwood Avenue, Boston, MA 02115, USA.
2 Department of Life Sciences and Center for Cell Signaling Research, Ewha
Women's University, Seoul 120-750, Korea.
*
Author for correspondence (e-mail:
mwhitman{at}hms.harvard.edu)
Accepted 27 October 2005
 |
SUMMARY
|
|---|
Members of the EGF-CFC family facilitate signaling by a subset of TGFß
superfamily ligands that includes the nodal-related factors and GDF1/VG1.
Studies in mouse, zebrafish, and chick point to an essential role for EGF-CFC
proteins in the action of nodal/GDF1 signals in the early establishment of the
mesendoderm and later visceral left-right patterning. Antisense knockdown of
the only known frog EGF-CFC factor (FRL1), however, has argued against an
essential role for this factor in nodal/GDF1 signaling. To address this
apparent paradox, we have identified two additional Xenopus EGF-CFC
family members. The three Xenopus EGF-CFC factors show distinct
patterns of expression. We have examined the role of XCR2, the only
Xenopus EGF-CFC factor expressed in post-gastrula embryos, in
embryogenesis. Antisense morpholino oligonucleotide-mediated depletion of
XCR2 disrupts left-right asymmetry of the heart and gut. Although
XCR2 is expressed bilaterally at neurula stage, XCR2 is
required on the left side, but not the right side, for normal left-right
patterning. Left-side expression of XNR1 in the lateral plate
mesoderm depends on XCR2, whereas posterior bilateral expression of
XNR1 does not, suggesting that distinct mechanisms maintain
XNR1 expression in different regions of neurula-tailbud embryos.
Ectopic XCR2 on the right side initiates premature right-side expression of
XNR1 and XATV, and can reverse visceral patterning. This activity of XCR2
depends on its co-receptor function. These observations indicate that XCR2 has
a crucial limiting role in maintaining a bistable asymmetry in nodal family
signaling across the left-right axis.
Key words: EGF-CFC factor, Nodal, Left-right patterning, Cripto, XCR, Xenopus
 |
INTRODUCTION
|
|---|
Members of the EGF-CFC gene family encode small extracellular glycosylated
proteins, and include Cripto and Cryptic in humans and mouse
(Bamford et al., 2000
;
Ciccodicola et al., 1989
;
Dono et al., 1991
;
Dono et al., 1993
;
Shen et al., 1997
),
FRL1 in frogs (Kinoshita et al.,
1995
), one-eyed pinhead, oep, in zebrafish
(Zhang et al., 1998
) and
Cripto/CFC in chick (Colas and
Schoenwolf, 2000
; Schlange et
al., 2001
). EGF-CFC family members share two conserved domains: an
EGF-like domain and a CFC domain, which are conserved only among EGF-CFC
family members (reviewed by Adamson et al.,
2002
; Minchiotti et al.,
2002
; Saloman et al.,
2000
; Shen and Schier,
2000
). Recent genetic and biochemical studies have demonstrated
that EGF-CFC proteins act as essential co-factors for signaling by the
nodal/GDF1 subset of TGFß superfamily ligands (reviewed by
Saloman et al., 2000
;
Schier, 2003
). EGF-CFC
proteins facilitate the association of nodal and GDF1/VG1 ligands with Type I
and Type II transmembrane receptors (Cheng
et al., 2003
; Reissmann et
al., 2001
; Yan et al.,
2002
; Yeo and Whitman,
2001
). The EGF-like domain mediates association with nodal
ligands, whereas the CFC domain interacts with the receptor complex.
Loss-of-function studies have established that EGF-CFC proteins function as
co-factors for nodal/GDF1 signals in both mesendoderm and left-right axis
specification (Bamford et al.,
2000
; Ding et al.,
1998
; Gaio et al.,
1999
; Gritsman et al.,
1999
; Linask et al.,
2003
; Schlange et al.,
2001
; Xu et al.,
1999
; Yan et al.,
1999
).
The only reported frog EGF-CFC family member, FRL1, was originally
identified in a screen for FGF receptor ligands
(Kinoshita et al., 1995
).
Ectopic expression and antisense oligonucleotide studies have indicated that
FRL1 is essential for the activation of ERK and subsequently for
neural formation (Yabe et al.,
2003
), and is also an essential co-factor for the dorsal
determinant WNT11 (Tao et al.,
2005
). Strikingly, however, no defects in either the transduction
of nodal/GDF1 signals or left-right patterning were observed following
FRL1 depletion, suggesting that the function of FRL1 might differ
from that of EGF-CFC factors in other vertebrate model organisms. We report
here the identification of two additional EGF-CFC family members in
Xenopus. The three frog EGF-CFC factors show distinct spatial and
temporal expression patterns during development. We have examined the effects
of both loss and gain of function of one of these factors, XCR2, and
have found that it is specifically required for normal left-right patterning
of XNR1 and XATV expression, and for visceral asymmetry.
XCR2 is expressed bilaterally at neurula-tailbud stages, but is
required only on the left side for normal patterning. The requirement of
XCR2 for left-side-specific expression of the nodal-related gene
XNR1, is consistent with prior work demonstrating that the expression
of nodal-related ligands are maintained by a FAST1/FOXH1-mediated
positive-feedback loop (Adachi et al.,
1999
; Norris et al.,
2002
; Osada et al.,
2000
; Saijoh et al.,
2000
). In addition, we found that ectopic expression of
XCR2 on the right side is sufficient to reverse left-right polarity,
and this effect requires XCR2 activity as a co-receptor for
nodal/GDF1 ligands. These observations indicate not only that XCR2 is
required for nodal signaling during left-right patterning, but also that
limitation of nodal signaling across the left-right axis by XCR2 can determine
the polarity of the nodal gradient across this axis.
 |
MATERIALS AND METHODS
|
|---|
Plasmid construction, genomic cloning and design of antisense morpholino oligonucleotides
Using the BLAST search algorithm
(Altschul et al., 1990
), we
identified EST clones corresponding to two novel Xenopus laevis
EGF-CFC factors: (1) from the NIBB Mochii normalized Xenopus laevis
neurula library, cDNA clone XL044d20 (GenBank UniGene Xl. 15503); and (2) from
the NICHD_XGC_Emb1 Xenopus laevis library, cDNA clone IMAGE
Consortium CloneID 6864330 (GenBank CA987644). We designated these novel
EGF-CFC factors XCR2 and XCR3S (short form),
respectively.
To generate pCS-XCR2, pCS2-XCR3S, pCS2-hCFC1, pCRII-XNR1 and pCRII-XATV,
the ORF region of each EST clone (XCR2 or XCR3S) or cDNA insert of
pSP64PA-humanCFC1 (Bamford et al.,
2000
), pCS2+XNR1 (Lustig et
al., 1996
) or pCS2+XATV
(Cheng et al., 2000
) was
subcloned into pCS4+, a derivative of pCS2+ described by Yeo and Whitman
(Yeo and Whitman, 2001
), into
the pCS2+ vector or into the pRII vector (Invitrogen). To generate pCS2-XCR3L
(long form), the ORF region of XCR3L was amplified by PCR from cDNA of stage
10.5 embryos, and subcloned into the pCS2+ vector. pCS-XCR2 mEGF (mutated EGF)
and pCS-XCR2 mCFC (mutated CFC) were generated by PCR-based subcloning: Asn93
and Thr96 to Gly93 and Ala96 in XCR2 mEGF1, and His129 and Trp132 to Gly129
and Gly132 in XCR2 mCFC. All constructs generated by PCR amplification were
sequence verified.
Xenopus laevis genomic clones of XCR2 were isolated by
PCR using the following primers: up (5'-AAGCAATTTCACATCAAC-3') and
down (5'-GGTGGGCCCCGCTGCCTCTAATG-3'; the linker sequence is
underlined). A splice-site-targeted antisense morpholino oligonucleotide,
TACACTCACTGTTAGTTCTTACCTC (XCR2 MO; 25-mer, underlined sequence is the region
in the intron), was designed against the consensus sequence at the first
exon-intron boundary derived from the sequence of two distinct XCR2
genomic clones. A standard control morpholino oligo (SC MO) from GeneTools was
used as a control.
Cell culture and luciferase assays
Plasmids used for transfection were: pCS2+XNR1
(Lustig et al., 1996
);
derrière/CS2+ (Sun et al.,
1999
); pCS-mouse nodal and pCS-mouse Cripto-3Flag
(Yeo and Whitman, 2001
);
pCS-XCR2-3Flag that was generated by PCR-based subcloning and includes three
repeats of the Flag epitope fused after Val191 of XCR2 in pCS-XCR2;
pCS2-6Myc-mouse FAST1 (FOXH1) (Weisberg et
al., 1998
); Mix.2 ARE A3-lux
(Chen et al., 1996
); and
pcDNA3.1/V5-His-TOPO/lacZ (Invitrogen). Human embryonic kidney 293T cells were
cultured in 5% CO2 at 37°C in DMEM supplemented with 10% FBS,
100 U/ml of penicillin and 100 µg/ml of streptomycin. Transient
transfection assays were performed by the calcium phosphate method in
triplicate (Sambrook and Russell,
2001
). Plasmid mixtures contained 200 ng of each expression
construct, 200 ng of the luciferase reporter plasmid, 80 ng of CMV-ß-gal
plasmid, and various amounts of pCS2+ vector to maintain a constant amount of
total DNA. ß-gal activity was confirmed to vary linearly with the
quantity of plasmid transfected. Luciferase activity was measured 48 hours
post-transfection and was normalized to the activity of co-transfected
ß-galactosidase activity. The fold differences in luciferase activity
were calculated using the luciferase activity of the pCS2-6Myc-mouse FAST1
(FAST1) transfected control as basal level activity. Expression of each
epitope-tagged protein was confirmed by western blotting.
Microinjection, immunohistochemistry and in situ hybridization analyses
Xenopus laevis embryos were obtained by artificial fertilization,
and embryos were staged according to Nieuwkoop and Faber
(Nieuwkoop and Faber, 1956
).
Synthetic EGFP mRNA was made using SP6 mMESSAGE mMACHINE (Ambion),
and was co-injected with XCR2 MO and/or various plasmids into the marginal
region of one blastomere of two-cell-stage embryos. Embryos were sorted into
left- or right-injected groups based on EGFP-fluorescence, and then fixed for
in situ hybridization analysis, or scored for heart and gut morphology at
stage 45-46 according to Branford et al.
(Branford et al., 2000
).
In situ hybridization analyses were performed according to Sive et al.
(Sive et al., 2000
), but with
the addition of 0.3% CHAPS in 2xSCC and 0.2xSSC for probe washing.
In Fig. 6I,K-V,
Fig. 7C,D and
Fig. 8A-K,M-Q, hybridization
and wash steps were performed at 70°C. RNA probes were synthesized from
pCRII-XNR1 and pCRII-XATV. After staining, pigmented embryos were bleached and
cleared. Immunohistochemistry was carried out according to Faure et al.
(Faure et al., 2000
) and Lee
et al. (Lee et al., 2001
). The
sarcomere myosin-specific antibody MF 20 was provided by the Developmental
Studies Hybridoma Bank at the University of Iowa. The signal was detected with
AlexaFluor594 donkey anti-mouse IgG (H+L) antibody (Molecular Probes), or with
peroxidase-conjugated donkey anti-mouse IgG (H+L) antibody (Jackson
ImmunoResearch), and the DAB Substrate Kit (Vector Laboratories).

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 1. Comparison of amino acid sequences and temporal expression patterns of
Xenopus EGF-CFC factors. (A) Comparison of the amino acid
sequences of Xenopus EGF-CFC proteins (XCR1, XCR2, XCR3S and XCR3L).
XCR3L has a 72 amino acid insertion following the signal sequence of XCR3S.
Dash indicates no amino acid present. Identical residues are shadowed.
Conserved EGF-like domains and CFC domains are underlined. Cysteine residues
in the additional 72 amino acids of XCR3L are indicated by asterisks.
(B) Temporal expression patterns of Xenopus EGF-CFC genes
(XCR1, XCR2, XCR3S and XCR3L) detected by RT-PCR. RNA was
extracted from embryos at the stages indicated over each lane. XCR3S
(lower band) and XCR3L (upper band) were detected using a set of
primers designed to span the insert region. Both bands showed a similar
temporal expression pattern. e, un-fertilized egg; RT-, RT-PCR reaction
without reverse transcriptase.
|
|
Semi-quantitative RT-PCR analysis
Extraction of total RNA and reverse transcription were performed according
to Watanabe and Whitman (Watanabe and
Whitman, 1999
). Ornithine decarboxylase (ODC)
was used as an internal control. Reverse transcriptase negative (RT-)
reactions were carried against all samples using ODC primers to
confirm the absence of genomic DNA contamination. Primers used for PCR were:
FRL1/XCR1 (up, 5'-CTGGTTTTTGCTAAGGACAC- 3';
down, 5'-TTGCAATGCTTGATAAAATG-3'); for temporal expression
analysis of XCR2 (up, 5'-GCTGCGCATATGGGGTTCTT-3'; down,
5'-CGATAATGCAGCCTTGTTTTCTCT-3'); for RNA splicing analysis of
XCR2 (up, 5'-GCCCTTGGGATCCTTACATT-3'; down,
5'-GAGTCAA- TGTTATAAATATGAAT-3'); XCR3 (up,
5'-GCTGTAATTCGCTTGG-GAAC-3'; down,
5'-TTTTGGACATGCACAGAAGC-3'); VG1 (up,
5'-GACCGCTAACGATGAGTG-3'; down,
5'-AGGAATGTCTTCTGGCTC-3'); XNR1
(Lustig et al., 1996
);
ODC
(http://www.xenbase.org/).
PCR products were separated by agarose gel electrophoresiss and visualized by
ethidium bromide staining. PCR products of XCR1 (FRL1),
XCR2, XCR3S and XCR3L were recovered from gels and confirmed
by sequencing.

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 2. Spatial expression patterns of Xenopus EGF-CFC genes.
(A) Spatial expression patterns of XCR1, XCR3S and
XCR3L at stage 9, as determined by RT-PCR of the animal region (A),
the marginal region (M), the vegetal region (V), a mixture of the dissected
three parts (+++) and intact whole embryos (W). VG1 was used as a
control for dissection. (B-I,K-N) Spatial expression analyses by
in situ hybridization for XCR1 (FRL1; B,C), XCR3
(D,E) and XCR2 (F-I,K-N). (B1,D1) Stage 10+ in vegetal view. The
dorsal side is up. (C1,E1,F,G) Stage 12 (C,E,F) and stage 15 (G) in dorsal
view. The anterior side is up. (B2,C2,D2,E2) Stage 10+ (B,D) and stage 12
(C,E) in lateral view. The anterior side is up and the dorsal side is to the
right. (H) Stage 20 in dorsal view. Embryo was cleared with benzyl
benzoate/benzyl alcohol. Lines show the left (L) and right (R) dissection
model for RT-PCR (J). (I) Transverse bisected embryo at stage 20. (J) RT-PCR
of the left lateral region (L), the right lateral region (R) and intact whole
embryos (W) at stage 20. XCR2 was expressed bilaterally, whereas
XNR1 was expressed on only the left side. (K) Stage 25. Line
indicates the section plane shown in M. (L) Stage 30. Line indicates the
section plane in N. (M,N) Transverse cut embryos at stage 25 (M) and stage 30
(N). Red arrowheads indicate the expression of XCR2 in the
prospective heart region; black arrowheads indicate the dorsal lip; white
arrowheads indicate the blastopore. DE, dorsal endoderm; DM, dorsal midline;
FP, floorplate; NC, notochord.
|
|
 |
RESULTS
|
|---|
Xenopus EGF-CFC factors are expressed in distinct patterns spatially and temporally
Because studies of the only reported Xenopus EGF-CFC factor,
FRL1, suggested a functional difference from the proposed role of
EGF-CFC factors in other vertebrate embryo model systems
(Shen and Schier, 2000
;
Tao et al., 2005
;
Yabe et al., 2003
), we
searched the X. laevis EST database for additional EGF-CFC family
members. Full sequencing of two EST clones of potential novel EGF-CFC family
members identified these as two novel Xenopus EGF-CFC genes,
XCR2 and XCR3 (Fig.
1A). The XCR2 and XCR3 proteins are 34.6% and 30.6% identical to
FRL1, respectively, and 30.6% identical to each other. Examination of the
X. tropicalis EST and genomic databases did reveal the existence of
clear X. tropicalis orthologs for each of the X. laevis
EGF-CFC genes (data not shown). While their overall sequences are quite
divergent from one another, the three X. laevis EGF-CFC proteins
share substantial conservation in the EGF-like and CFC domains, and all
contain a putative O-linked fucosylation site, which has been
identified in mammalian cripto as being crucial for function as a nodal
co-receptor (Schiffer et al.,
2001
; Yan et al.,
2002
). The three Xenopus EGF-CFC proteins are nearly
identical in size, with the notable exception being that the XCR3
transcript occurs in two alternatively spliced forms; the longer form encodes
72 additional amino acids near the N terminus of the protein
(Fig. 1A). This additional
stretch is cysteine-rich but shows no homology to other known proteins or
domains. The full-length sequences for XCR2, XCR3S (short form) and
XCR3L (long form) have been submitted to GenBank under Accession
Numbers AY796186, AY796188 and AY796189, respectively. XCR2 and
XCR3 have also been identified independently by Dorey and Hill (K.
Dorey and C. Hill, personal communication). To render the nomenclature for
Xenopus EGF-CFC factors consistent we, Dorey and Hill, and the
investigators who originally identified FRL1
(Kinoshita et al., 1995
) (M.
Kirschner, personal communication) propose to rename FRL1 as
XCR1.
To begin to characterize the developmental roles of Xenopus
EGF-CFC factors, we examined the temporal expression patterns of XCR1,
XCR2 and XCR3 by RT-PCR (Fig.
1B). Transcripts for all of the XCR genes were detected in
unfertilized eggs, and XCR1 and XCR3 were expressed through
early embryogenesis until the early neurula stage (stage 15). XCR2
was expressed at very low levels maternally, expression increased markedly at
the end of gastrulation (stage 12), and was maintained at high levels through
tadpole stages (stage 45). XCR3 was detected as two bands
corresponding to the two splicing variants, XCR3S and XCR3L,
which showed similar temporal expression patterns. XCR1 and
XCR3 were expressed ubiquitously before gastrulation
(Fig. 2A), whereas
XCR2 expression was too low to compare it in the different regions of
the pre-gastrula embryo (not shown). We next examined the spatial expression
patterns of the three XCR genes by in situ hybridization
(Fig. 2). XCR1
expression was strong in the entire prospective ectoderm at the beginning of
gastrulation, and became restricted to the prospective neural plate by stage
12 (Fig. 2B,C), consistent with
previous reports (Wessely et al.,
2004
; Yabe et al.,
2003
). XCR3 was strongly expressed in the Organizer and
the prospective endoderm at the onset of gastrulation
(Fig. 2D). This expression
became enriched anteriorly during gastrulation
(Fig. 2E). XCR2 was
expressed at very low levels until stage 12, when its expression was
detectable on the dorsal side (Fig.
2F). This dorsal expression was further restricted to the midline
during neurulation (Fig. 2G),
and in the notochord through neurula stages
(Fig. 2H,I). XCR2 was
also bilaterally expressed in the lateral plate region at stage 20
(Fig. 2H,J). XCR2 was
expressed in the prospective heart region at stage 25, and in the floor plate
and dorsal endoderm in the dorsal midline
(Fig. 2K,M). Dorsal midline
expression decreased by stage 30, whereas the heart region expression was
maintained (Fig. 2L,N). The
markedly different temporal and spatial expression patterns of the XCR genes
suggest that they have distinct developmental roles.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3. XCR2 facilitates XNR1 and derrière signaling. 293T cells were
transiently transfected with the A3-lux luciferase reporter. Luciferase
activity was normalized to the activity of co-transfected ß-
galactosidase and then expressed as the fold difference in activity relative
to that of FAST1 transfection. The average of three independent examinations
in triplicate is shown. Error bars show s.d.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 4. XCR2 MO blocks endogenous RNA splicing. (A) Genomic structure
including exon I (1), exon II (2), and exon III (3) of XCR2. The
translation initiation codon (ATG) and a potential termination codon (TAA) are
indicated. The splice-site-targeted antisense morpholino oligonucleotide XCR2
MO (MO) was designed against the sequence at the boundary of exon I/intron I.
Abnormal splicing detected in XCR2 MO-injected embryos is shown by the gray
line (v). The spliced variant is generated by a cryptic splice donor (csd)
site 642 bp downstream from the end of exon I. (B) Sequence comparison
of cDNA from mature mRNA and the aberrant splicing variant. Amino acid
sequences are also indicated. The variant generated by abnormal splicing has a
termination codon (correspondent to TAA in
Fig. 4A) right after the end of
exon I. Arrowhead indicates the correct exon I/exon II splice junction. The
target sequence of XCR2 MO is underlined. (C) RT-PCR analyses of
XCR2 mRNA in XCR2 MO-injected embryos. Embryos were injected with 10,
20 and 50 ng of XCR2 MO, or 20 and 50 ng of Standard Control MO (SC MO), and
harvested for RT-PCR at stage 15, 25 and 35. The primer set was designed to
span the first intron to detect splicing of the endogenous XCR2
pre-mRNA. In XCR2 MO-injected embryos, the mature mRNA (m) was decreased and
an abnormal splicing variant (v) was detected. At stage 35, the mature
XCR2 mRNA was detectable at low levels in embryos injected with
lowest dose (10 ng) of XCR2 MO.
|
|
The distinctive expression pattern of XCR2 suggested a role for
XCR2 that was distinct from those of XCR1 and XCR3.
We therefore examined whether XCR2, like other EGF-CFC factors, acts
to facilitate nodal-like ligand signaling. The activity of XCR2 on
XNR1 or derrière signaling was tested in 293T cells transiently
transfected with FAST1/FOXH1 and a nodal-responsive luciferase reporter, the
Mix.2 ARE A3-luc reporter (Fig.
3). XNR1 or derrière increase luciferase
activity in a FOXH1-dependent manner, but only in the presence of
co-transfected XCR2. Similar results were seen with co-transfection
of the related mouse genes Nodal and Cripto
(Fig. 3). These results
indicate that XCR2 can act as a co-factor for nodal-related ligands,
as has been previously reported for other EGF-CFC factors. The fact that
derrière signaling, as well as XNR1 signaling, is supported by XCR
expression has not been reported, but is consistent with previous work showing
that the structurally similar ligand VG1 requires EGF-CFC factors to signal,
and that ectopic derrière shows only limited activity in zebrafish
MZoep mutants (Cheng et al.,
2003
).
Left-side XCR2 expression is essential for left-right patterning
We next investigated the role of XCR2 in early frog development
using antisense morpholino oligonucleotide (MO)-mediated depletion. Because
preliminary experiments indicated that two antisense MOs targeting
XCR2 translation were ineffective (data not shown), we designed an
antisense MO targeting the first exon-intron junction to block XCR2
pre-mRNA splicing. We cloned genomic DNA containing XCR2 by PCR, and
found the position of the first intron to be conserved with known EGF-CFC
genes (data not shown, GenBank Accession Number AY796187)
(Colas and Schoenwolf, 2000
).
A 25 nucleotide antisense MO was designed against the first exon-intron
boundary; three bases targeted the first exon and 22 bases targeted the first
intron (Fig. 4A,B). We first
examined whether the XCR2 MO blocks endogenous RNA splicing by RT-PCR, using
primers that span the first intron. In XCR2 MO-injected embryos, the amount of
mature XCR2 mRNA was decreased and an abnormal splicing variant was
generated from a cryptic splice donor site
(Fig. 4C). Correct splicing of
XCR2 was inhibited through stage 35. Splicing of XCR2 mRNA
was not affected by control MO injection. The abnormal splicing variant
detected in XCR2 MO-injected embryos has an in-frame termination
codon immediately following the end of exon I, resulting in an eight amino
acid long predicted coding sequence (Fig.
4B). These results indicate that this splice-site-targeted
antisense MO is an effective tool for the inhibition of endogenous
XCR2 function.
We next examined the phenotype of XCR2 MO-injected embryos. The XCR2 MO did
not cause any detectable defect in dorsoventral or anteroposterior axis
patterning through stage 45, either in comparison to control MO-injected or
uninjected embryos (Fig. 5A,B). There was also no effect of the XCR2 MO on movement or responsiveness of
swimming tadpoles (data not shown). XCR2 MO-injected embryos were, however,
extensively randomized with respect to left-right axis formation
(Fig. 5C-H). The left-right
patterning defects were scored according to Branford et al.
(Branford et al., 2000
); heart
morphology is scored as normal or reversed, and gut morphology is scored for
left or right origin of the gut, and for clockwise or counterclockwise coil
direction. A low dose of XCR2 MO (20 ng) caused 23% reversed and 55% normal
heart formation, 37% reversed and 41% normal gut origin, and 28% reversed and
50% normal gut coil direction (Table
1). A higher dose (50 ng) of XCR2 MO caused complete randomization
of heart asymmetry (37% reversed and 39% normal). By contrast, 50 ng of the
control MO had no significant effect on left-right patterning (90% and 89%
normal heart and gut formation, respectively;
Table 1).

View larger version (52K):
[in this window]
[in a new window]
|
Fig. 5. XCR2 MO disturbs randomization of left-right asymmetric patterning of
the heart and gut in stage 45-46 embryos. (A) Embryo injected with
50 ng of a standard control MO (SC MO). (B) Embryo injected with 50 ng
of XCR2 MO. (C-H) Embryos injected with MO into the marginal region of
both blastomeres at the two-cell stage, immunostained with MF 20 antibody, and
the signal detected by fluorescence (C,D) or DAB staining (E-H). (C,E) Embryo
injected with 50 ng of SC MO, showing normal left-right asymmetric patterning
of the heart (C,E) and gut (right origin and counterclockwise coil, RO/CCW)
(E). (D,F-H) Embryos injected with 20 ng of XCR2 MO. (D) Reversed morphology
of heart. (F) Embryo has a mirror-imaged heart and gut (the left origin and
clockwise coil, LO/CW). (G) Embryo has a normal heart, and left origin and
counterclockwise-coiled gut (LO/CCW). (H) Embryo has reversed heart, right
origin and clockwise-coiled gut (RO/CW).
|
|
XCR2 is expressed symmetrically in the lateral region at neurula
stages (Fig. 2). This symmetric
expression pattern is shared with other vertebrate EGF-CFC factors. EGF-CFC
proteins are thought to be an essential component of a positive-feedback loop
in which nodal-like ligands maintain and expand their own expression in the
left lateral plate mesoderm (LPM) during the establishment of left-right axis
patterning (Burdine and Schier,
2000
; Hamada et al.,
2002
). The function of EGF-CFC proteins on the right side,
however, has not been specifically addressed. To examine the role of
XCR2 in the left versus the right side of the embryo, embryos were
injected XCR2 MO into one of two blastomeres after the first cleavage, which
divides the embryo along the midline of the future left-right axis. Injection
of 10 ng of XCR2 MO caused complete randomization of heart formation (48%
reversed and 49% normal), and extensive, but incomplete, randomization of gut
formation (23% mirror and 46% normal), when injected on the left side of the
embryo (Table 2). By contrast,
right-side injection did not affect left-right patterning, even at a dose of
20 ng of XCR2 MO (95% and 91% of normal heart and gut formation,
respectively). These results indicate that left-side, but not right-side,
expression of XCR2 is necessary for the correct establishment of
left-right asymmetry. We also examined left-side-specific expression of
XNR1 and XATV in the left LPM to establish whether
XCR2 is required in the left LPM for expression of these genes.
Left-side injection of 10 ng of XCR2 MO inhibited XNR1 expression in
the LPM (84%), whereas right-side injection of XCR2 MO or left-side injection
of control MO had no effect on XNR1 expression
(Fig. 6A-J,
Table 3). Similarly,
XATV expression in the left LPM was inhibited by left-side injection
of 10 ng of XCR2 MO (90%), but the dorsal midline expression of XATV
was not inhibited by XCR2 depletion
(Fig. 6O-R, Table 4).
The symmetric expression of XNR1 has been reported to start before
the left-right asymmetric expression of XNR1 is detectable
(Lohr et al., 1997
;
Lowe et al., 1996
). We could
first detect bilateral XNR1 expression at stage 15 in two patches
beside the presumptive notochord region, at the posterior of the archenteron
roof (Fig. 7A-C), and
left-side-specific XNR1 expression began in the LPM at stage 20
(Fig. 7G,H,
Table 8). Bilateral injection
of XCR2 MO did not affect bilateral expression of XNR1 at stage 15,
before left-side-specific XNR1 expression begins
(Fig. 7E-F,
Table 5). At stage 20, the
initiation of expression of XNR1 in the left-side LPM was efficiently
inhibited by XCR2 MO, but the bilateral expression of XNR1 was not
affected (Fig. 7G-J,
Table 5). Left-side-specific
expression of XNR1 was not detectable at stage 18 and 19 (data not
shown). These observations indicate that at post-gastrula stages, bilateral
posterior expression of XNR1 is independent of XCR2, whereas
left-side LPM specific expression is dependent on XCR2 at the earliest stage
at which this expression can be detected.
View this table:
[in this window]
[in a new window]
|
Table 8. Temporal analysis of expression of XNR1 at the lateral plate
mesoderm (LPM) following ectopic expression of XCR2
|
|

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 6. Left-side injection of XCR2 MO inhibits XNR1 and XATV
expression in the lateral plate mesoderm (LPM). (A-N) In situ
hybridization of XNR1. White arrows indicate the expression of
XNR1 in the LPM. (A) Embryo injected with 10 ng of SC MO into the
left side, showing normal XNR1 expression. (B) Injection of 10 ng of
XCR2 MO into the left side caused no expression of XNR1 in the LPM.
(C) Co-injection of 10 ng of XCR2 MO with 10 pg of pCS-EGFP plasmid into the
left side caused no expression of XNR1 in the LPM. (D,E,I)
Co-injection of 10 ng of XCR2 MO with 10 pg of pCS-XCR2 plasmid into the left
side rescued the expression of XNR1 in the LPM and also caused
ectopic XNR1 expression in the somite (yellow arrows). (I) Transverse
section of the rescued embryo. Ectopic XNR1 expression in the somite
was observed. (F,G) Right-side injection of 10 ng of SC MO (F) or XCR2 MO (G)
did not affect XNR1 expression. (H,J) Uninjected control embryo.
(K-N) Co-injection of 10 ng of XCR2 MO with 10 pg of XCR1 (K),
XCR3S (L), XCR3L (M) or human CFC1 (N) plasmid in
the left side rescued the expression of XNR1 in the LPM. (O-V)
In situ hybridization of XATV in ventral view. Arrows indicate the
expression of XATV in the left LPM (white) and the dorsal midline
(blue). (O,Q) Embryo injected with 10 ng of XCR2 MO in the left side inhibited
the expression of XATV in the left LPM, but not in the dorsal
midline. (P,R) Embryo injected with 10 ng of XCR2 MO in the right side,
showing normal XATV expression. (S,U) Co-injection of 10 ng of XCR2
MO with 10 pg of pCS-XCR2 plasmid in the left side rescued the expression of
XATV in the left LPM. (T,V) Uninjected control embryo.
|
|
To confirm the specificity of the effects of XCR2 MO on left-right
asymmetric gene expression and visceral patterning, we examined whether
ectopic expression of XCR2 can rescue the defects caused by XCR2 MO,
using a CMV promoter-driven XCR2 expression plasmid (pCS-XCR2;
Fig. 6D-R; Tables
3,
4). XNR1 and
XATV expression in the LPM were severely reduced in 84% or 90% of
embryos, respectively, injected with 10 ng of XCR2 MO on the left side.
XNR1 and XATV expression in the LPM was restored in 86% or
45% of embryos co-injected with XCR2 MO and pCS-XCR2 plasmid on the left side.
However, the spatial patterns of pCS-XCR2-rescued expression of XNR1
were variable and often did not coincide well with the normal expression
patterns of XNR1 (Fig.
6E), which was consistent with the inability of plasmid injection
to accurately recapitulate the spatial pattern, timing and dose of endogenous
XCR2 expression, confirmed by in situ hybridization of XCR2
(data not shown). In addition, we examined the abilities of other
Xenopus EGF-CFC members and human CFC1 (Cryptic) to
rescue the effect of the XCR2 MO. Co-injection with XCR2 MO and a CMV
promoter-driven XCR1, XCR3S, XCR3L or human CFC1 expression
plasmid rescued XNR1 expression in the LPM in 50%, 83%, 82% or 59% of
embryos, respectively (Fig.
6K-N, Table 3). We
also examined left-right asymmetric visceral patterning in tadpoles
co-injected with pCS-XCR2 and the XCR2 MO. Co-injection of 10 pg of pCS-XCR2
rescued the left-right asymmetry of the heart and gut (73% and 80% of normal
heart and gut formation, respectively; see
Table 6). The efficiency of the
rescue of morphological asymmetry was not improved by increasing the amount of
injected XCR2 plasmid (10, 20 and 40 pg). As in the case of the
rescue of XNR1 expression, this probably reflects the variable
distribution of the rescue plasmid. These observations demonstrate, however,
the specificity of action of the antisense MO, and also suggest a significant
functional overlap among different members of the EGF-CFC family in their
ability to participate in signaling during left-right patterning.
To determine whether XCR2 may be limiting as well as necessary for
nodal-family signaling during left-right patterning, we evaluated the effects
of ectopic expression of XCR2 by injection of pCS-XCR2.
Right-side-specific injection of 10-40 pg of pCS-XCR2 with control MO causes
significant perturbation of the asymmetric expression of XNR1
relative to the left-side injection
(Table 3). The right-side
injection of pCS-XCR2 with control MO also caused abnormal heart and gut
asymmetry (Table 6).
Interestingly, right-side injection of 40 pg of pCS-XCR2 not only caused
ectopic right-side expression of XNR1 (38%), but also a significant
number of reversals in the asymmetry of XNR1 expression (52%)
(Table 3). To investigate
whether ectopic expression of XCR2 on the right side is due to its
function as a nodal/VG1 ligand co-receptor, we tested two mutants of
XCR2 in this assay: XCR2 mEGF, which is mutated in the
EGF-like domain required for binding to nodal family ligands, and XCR2
mCFC, which is mutated in the CFC domain and no longer interacts with
Type I nodal/VG1 receptors (Yeo and
Whitman, 2001
). In contrast to injection of wild-type
XCR2 on the right side, which caused ectopic XNR1 expression
in the right LPM and inhibited endogenous XNR1 expression on the left
side in 40% of embryos (Fig.
8B, Table 7),
neither pCS-XCR2 mEGF nor pCS-XCR2 mCFC reversed the asymmetry in
XNR1 expression (Fig.
8A,C,D; Table 7).
These results indicate that the ability of ectopic XCR2 to change the
left-side-specific XNR1 expression depends on the function of XCR2 as
a co-receptor for nodal/VG1 family ligands.
View this table:
[in this window]
[in a new window]
|
Table 7. The expression of XNR1 in the lateral plate mesoderm (LPM)
following ectopic expression of wild-type or mutant XCR2
|
|

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 7. Bilateral expression of XNR1 is not affected by XCR2 MO
injection. (A-C) Normal expression pattern of XNR1 in the
posterior archenteron roof at stage 15 as determined by in situ hybridization
using uninjected embryos. Asymmetric expression of XNR1 was not
observed at stage 15. (C) Posterior archenteron roof of half-dissected embryo
in side view. Two stripes of bilateral XNR1 expression were observed.
(D) In situ hybridization with an XNR1 sense probe. No signal
was observed in the archenteron roof. (E,F) Injection of 20 ng
of SC MO (E) or of XCR2 MO (F) into the marginal region of both blastomeres at
the two-cell stage. The bilateral expression of XNR1 is not affected
at stage 15 in either condition. (G,H) Normal expression pattern
of XNR1 at stage 20. The bilateral expression is maintained (black
arrowheads) and asymmetric expression appears in the LPM (red arrowhead).
(I) Injection of 20 ng of SC MO does not inhibit either bilateral or
asymmetric expression of XNR1 at stage 20. (J) Injection of 20
ng of XCR2 MO inhibited the asymmetric expression of XNR1, but not
bilateral expression at stage 20. (A,G) Lateral views. The anterior side is to
the left. (B,E,F,H-J) Posterior views. The dorsal side is up. The embryo was
cleared with benzyl benzoate/benzyl alcohol (A,B,E-J). Black arrowheads
indicate the bilateral expression of XNR1; red arrowheads indicate
the asymmetric expression of XNR1.
|
|
To clarify how right-side misexpression of XCR2 causes left-right
axis reversal, we examined the dynamics of XNR1 and XATV
expression in pCS-XCR2 injected embryos
(Fig. 8, Tables
8,
9). Expression of XNR1
or XATV in the right LPM following right-side injection of pCS-XCR2
was detectable by stage 15 in 17% (XNR1) or stage 17 in 45%
(XATV) of injected embryos. This is in marked contrast to the normal
expression of XNR1 or XATV in the LPM, which is first
detectable at stage 20 (XNR1) or at stage 23 (XATV)
(Fig. 8G-K,M-Q; Tables
8,
9). In embryos injected on the
right side with pCS-XCR2, endogenous left-side XNR1 and XATV
expression was absent at stage 20 in 67% (XNR1) and at stage 23 in
73% (XATV) of embryos, respectively. The endogenous expression of
XCR2 itself on the left side, however, was not affected by pCS-XCR2
injection on the right side (Fig.
8L,R). We also investigated whether the left-right asymmetry
defect was overcome by XNR1 misexpression on the left side, by using
an EF1
promoter-driven XNR1 expression plasmid
(pXEX/XNR1) (Sampath et al.,
1997
). The heart and gut morphology was inverted by pCS-XCR2
injection into the right side in 57% and 46% of embryos, respectively
(Table 10). Concomitant
injection of 20 pg of pXEX/XNR1 on the left side rescued the
orientation of heart and gut morphology in 79% and 64% of injected embryos,
whereas 20 pg of the pXEX control vector did not. This observation indicates
that ectopic expression of XCR2 on the right is sufficient to initiate
premature, ectopic expression of XNR1 and XATV on the right
side, leading to suppression of the normal expression of these factors on the
left side.
View this table:
[in this window]
[in a new window]
|
Table 9. Temporal analysis of expression of XATV at the lateral plate
mesoderm (LPM) following ectopic expression of XCR2
|
|
View this table:
[in this window]
[in a new window]
|
Table 10. Left-side overexpression of XNR1 rescues the heart and gut
asymmetry defects induced by right-side overexpression of
XCR2
|
|
 |
DISCUSSION
|
|---|
We report here the identification of three different EGF-CFC family members
and examine the role of one of them, XCR2, in Xenopus
embryogenesis. Our results, and those of K. Dorey and C. Hill (personal
communication), suggest that all three are likely to be involved in mediating
signaling by nodal-related ligands during embryogenesis. The spatially
restricted expression patterns of frog EGF-CFC genes and their necessary role
in nodal-related ligand signaling events, strongly suggest that the expression
of these factors is locally limiting for signaling by nodal-related ligands in
the post-gastrula embryo. Antisense morpholino-mediated loss-of-function
experiments show that XCR1 and XCR3 are important for
nodal-related signaling during pre-gastrula germ layer specification and
patterning, whereas XCR2 is specifically required for left-right
patterning during neurula-tailbud stages, indicating that all three are likely
to function as co-receptors (K. Dorey and C. Hill, personal communication).
Although XCR2 is expressed bilaterally on both sides of late
neurulae, it is required only on the left side for correct patterning,
consistent with a model in which nodal-related signaling on the left side of
the LPM is required for left-side specification.

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 8. Right-side overexpression of XCR2 causes left-right inverted
gene expression. (A-D,G-I,M-O) In situ hybridization of XNR1 in
dorsal view (A-D,G,I,M,O), anterior side at top, and in side view of a
half-dissected embryo (H,N). (E,F,J,K,P,Q) In situ hybridization of
XATV in ventral view (E,F) and in dorsal view (J-K,P,Q). (L,R) In
situ hybridization of XCR2 in dorsal view. (A,G-H) Embryo injected
with 40 pg of pCS-EGFP plasmid in the right side. (B,M-R) Embryo injected with
40 pg of pCS-XCR2 into the right side. (A,E) Embryo showing
normal expression of XNR1 (A) or XATV (E) in the left LPM
(arrow) at stage 25/26. (B,F) Right-side XCR2 overexpression
caused right-side expression of XNR1 (B) or XATV (F; arrow),
and suppressed the left-side expression at stage 25/26. (C,D)
Injection of 40 pg of pCS-XCR2 mEGF (C) or pCS-XCR2 mCFC (D) into the right
side did not affect the expression pattern of XNR1 (arrow) at stage
25. (G-L) Embryos injected with pCS-EGFP plasmid in the right
side. XNR1 expression was not detected in the LPM at stage 15 (G) and
stage 16 (H), but was detectable at stage 20 (I) (arrow). XATV
expression was not detected in the LPM at stage 17 (J), but was detectable at
stage 23 (K; arrow). XCR2 was expressed broadly at stage 20 (L).
(M-R) Embryo injected with pCS-XCR2 plasmid in the right side.
XNR1 expression was ectopically expressed in the right LPM at stage
15 (M) and stage 16 (N), in addition to posterior bilateral expression. Strong
XNR1 expression was detected on the right side (arrow), but not on
the left side at stage 20 (O). Ectopic XATV expression (arrow) was
detected in the right LPM at stage 17 (P). XATV expression was
detected on the right side (arrow), but not on the left side at stage 23 (Q).
Left-side expression of XCR2 was not affected, but very strong
expression was detected on the right (injected) side at stage 20 (R).
|
|
Maintenance of localized expression of nodal ligands has been shown to
depend on positive-feedback regulation mediated through a
FAST1/FOXH1-responsive enhancer in the first intron of nodal orthologs in a
broad range of chordate species (Whitman,
2001
). Depletion of XCR2 suppresses XNR1
expression in the left-side LPM, consistent with a role for XCR2 as a
co-factor in XNR1 signaling. The signals that initiate left-side-specific
expression of XNR1 in the frog embryo are not known. One possibility
is that the posterior bilateral expression of XNR1 is functionally
comparable with nodal expression in the peri-nodal region of the
mouse (Brennan et al., 2002
;
Saijoh et al., 2003
), and that
the XNR1 signal from this posterior region is responsible for the
initiation of XNR1 expression in the left-side LPM through an
XCR2-dependent pathway. A cilia-based mechanism for the left-right asymmetric
distribution of nodal protein has been proposed
(McGrath et al., 2003
;
Nonaka et al., 2002
;
Nonaka et al., 1998
); whether
a comparable mechanism might distribute the posterior-bilateral XNR1
asymmetrically is an interesting possibility, but it requires additional
investigation. Alternatively, an asymmetric distribution of VG1 activity has
been proposed as a mechanism for the initiation of left-right signaling
(Chen et al., 2004
;
Hyatt et al., 1996
;
Kramer and Yost, 2002
). This
signal could also be dependent on XCR2 (alternatively it could depend on XCR1
and XCR3 (K. Dorey and C. Hill, personal communication), and therefore our
data do not distinguish between these possibilities. We found that inhibition
of XCR2 blocks left-side-specific expression of XNR1 as early as this
expression is detectable. Although we cannot rule out the possibility that a
non-XCR2-dependent signal initiates left-side XNR1 expression at a
level not detectable by in situ hybridization, our data are consistent with
the possibility that the initiation of asymmetric XNR1 expression is
XCR2 dependent. Once asymmetric XNR1 expression is initiated,
XCR2 is also likely to be required for the activity of the
FAST1/FOXH1-mediated positive-feedback loop maintaining XNR1
expression in the left LPM.
The bilateral expression of XNR1 in the posterior region of
neurula stage embryos is not affected by depletion of XCR2. While it
is possible that bilateral posterior expression is supported by residual
XCR2, or by the perdurance of XCR1 or XCR3 from
early embryogenesis, it seems likely that this expression is maintained by a
mechanism distinct from the positive-feedback loop of XNR1. The
pattern of XCR2- independent expression of XNR1 is similar
to the expression of mouse Nodal in the peri-nodal region, which is
independent of Cryptic (Gaio et
al., 1999
; Yan et al.,
1999
), indicating a broad conservation of this posterior pattern
of neurula-stage gene expression of nodal ligands among vertebrates. It is
possible that this posterior bilateral expression of XNR1 is
transferred anteriorly in a left-right asymmetric manner to establish the
asymmetric expression of XNR1 in the LPM
(Wright, 2001
), but the basis
for this transition to asymmetry remains unclear.
In contrast to effects on the left side LPM, depletion of XCR2 on
the right side of the embryo does not detectably alter left-right patterning.
Although expression of both nodal family ligands and the nodal antagonists
lefty/antivin is excluded from the right side
(Branford et al., 2000
;
Cheng et al., 2000
;
Joseph and Melton, 1997
;
Lowe et al., 1996
;
Tanegashima et al., 2000
), the
extent or significance of their potential diffusion across and/or from the
midline is not known. On the one hand, our results indicate that
XCR2-dependent activity of neither the nodal family ligands nor their
antagonists is essential on the right side for correct patterning. On the
other hand, ectopic expression of XCR2 is sufficient to reverse the
left-right polarity, as can ectopic expression of TGFß family ligands or
activated receptors (Chen et al.,
2004
; Hanafusa et al.,
2000
; Hyatt et al.,
1996
; Sampath et al.,
1997
; Toyoizumi et al.,
2000
). Data from several laboratories, including our own, have
shown that EGF-CFC proteins function as co-factors for nodal/GDF1 signaling,
but are not sufficient to activate SMAD2 signaling in absence of the ligands
(Fig. 3) (Saijo et al., 2000;
Yan et al., 2002
;
Yeo and Whitman, 2001
;
Reissmann et al., 2001
). That
ectopic XCR2 expression on the right side is enough to reverse
left-right polarity indicates, therefore, that there are sufficient levels of
nodal/GDF1 family ligands in the right-side LPM to initiate the left-side
program when an exogenous co-receptor is provided. Ectopic XCR2 is
also sufficient to activate ectopic XNR1 expression in the somites
(Fig. 6), indicating that
ectopic XCR2 can sensitize somites to endogenous nodal-related signals. This
also suggests that the diffusion of XNR1 or related ligands is not restricted
to the LPM at somite stages, although the possibility that nodal ligands are
expressed at undetectable, but functionally significant, levels in the somite
itself cannot be ruled out. Because left-side or right-side specific
injections at the two-cell stage lead to variable expression in midline
structures, our data do not distinguish a function for XCR2 expressed in
midline structures such as the notochord in left-right patterning.
Why ectopic XCR2 expression on the right is sufficient to flip the
left-right orientation of XNR1 expression remains an interesting
theoretical question. This effect is eliminated by point mutations in either
of the two domains required for XCR2 function as a nodal ligand co-receptor,
strongly indicating that it is this function that mediates the observed effect
on axis orientation. That ectopic XCR2 expression is sufficient to
reverse the polarity of XNR1 expression suggests: (1) that XCR2 is
limiting for activity of endogenous nodal/GDF1 family ligands on the right
side of the embryo; (2) that elevated XCR2 enhances the activity of these
ligands more than it enhances the activity of any lefty/antivin antagonists
(Chen and Shen, 2004
;
Cheng et al., 2004
;
Tanegashima et al., 2004
); (3)
that the enhancement of activity of nodal/GDF1 ligands present on the right
side is sufficient to establish a positive-feedback loop for XNR1
expression in the right-side LPM; and (4) that this early XNR1
expression on the right induces XATV, which in turn diffuses to
suppress the normal activation of XNR1 signaling and expression on the left
side.
The establishment of the left-right axis is a fascinating example of how an
initial symmetry breaking event establishes a system of feedback loops that
maintain a sharply divided asymmetry in the activity of a diffusible signaling
molecule, in this case XNR1. Our observations suggest that XCR2 may be a
critical limiting component of both the amplitude and the spatial extent of
the left-side signal during left-right patterning. Consideration of this role
for EGF-CFC factors will therefore be important for theoretical modeling of
the dynamics of left-right patterning.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Drs Marc Kirschner, Maximilian Muenke, Hazel Sive and Christopher
V. E. Wright for gifts of plasmids; and the NIBB Xenopus laevis EST
project and the American Type Culture Collection for EST clone resources. We
thank Drs Caroline Hill and Karel Dorey for sharing results before
publication. We thank Dr Michael Levin for helpful advice on photography. This
work was supported by grants from the NICHD. C.-Y.Y. was supported by a grant
(R08-2003-000-10943-0) from the Basic Research Program of the Korea Science
& Engineering Foundation.
 |
REFERENCES
|
|---|
Adachi, H., Saijoh, Y., Mochida, K., Ohishi, S., Hashiguchi, H.,
Hirao, A. and Hamada, H. (1999). Determination of left/right
asymmetric expression of nodal by a left side-specific enhancer with sequence
similarity to a lefty-2 enhancer. Genes Dev.
13,1589
-1600.[Abstract/Free Full Text]
Adamson, E. D., Minchiotti, G. and Salomon, D. S.
(2002). Cripto: a tumor growth factor and more. J.
Cell Physiol. 190,267
-278.[CrossRef][Medline]
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman,
D. J. (1990). Basic local alignment search tool.
J. Mol. Biol. 215,403
-410.[CrossRef][Medline]
Bamford, R. N., Roessler, E., Burdine, R. D., Saplakoglu, U.,
dela Cruz, J., Splitt, M., Goodship, J. A., Towbin, J., Bowers, P., Ferrero,
G. B. et al. (2000). Loss-of-function mutations in the
EGF-CFC gene CFC1 are associated with human left-right laterality defects.
Nat. Genet. 26,365
-369.[CrossRef][Medline]
Branford, W. W., Essner, J. J. and Yost, H. J.
(2000). Regulation of gut and heart left-right asymmetry by
context-dependent interactions between xenopus lefty and BMP4 signaling.
Dev. Biol. 223,291
-306.[CrossRef][Medline]
Brennan, J., Norris, D. P. and Robertson, E. J.
(2002). Nodal activity in the node governs left-right asymmetry.
Genes Dev. 16,2339
-2344.[Abstract/Free Full Text]
Burdine, R. D. and Schier, A. F. (2000).
Conserved and divergent mechanisms in left-right axis formation.
Genes Dev. 14,763
-776.[Free Full Text]
Chen, C. and Shen, M. M. (2004). Two modes by
which Lefty proteins inhibit nodal signaling. Curr.
Biol. 14,618
-624.[CrossRef][Medline]
Chen, X., Rubock, M. J. and Whitman, M. (1996).
A transcriptional partner for MAD proteins in TGF-beta signalling.
Nature 383,691
-696.[CrossRef][Medline]
Chen, Y., Mironova, E., Whitaker, L. L., Edwards, L., Yost, H.
J. and Ramsdell, A. F. (2004). ALK4 functions as a receptor
for multiple TGF beta-related ligands to regulate left-right axis
determination and mesoderm induction in Xenopus. Dev.
Biol. 268,280
-294.[CrossRef][Medline]
Cheng, A. M., Thisse, B., Thisse, C. and Wright, C. V.
(2000). The lefty-related factor Xatv acts as a feedback
inhibitor of nodal signaling in mesoderm induction and L-R axis development in
xenopus. Development
127,1049
-1061.[Abstract]
Cheng, S. K., Olale, F., Bennett, J. T., Brivanlou, A. H. and
Schier, A. F. (2003). EGF-CFC proteins are essential
coreceptors for the TGF-beta signals Vg1 and GDF1. Genes
Dev. 17,31
-36.[Abstract/Free Full Text]
Cheng, S. K., Olale, F., Brivanlou, A. H. and Schier, A. F.
(2004). Lefty Blocks a Subset of TGFbeta Signals by Antagonizing
EGF-CFC Coreceptors. PLoS Biol.
2, E30.[CrossRef][Medline]
Ciccodicola, A., Dono, R., Obici, S., Simeone, A., Zollo, M. and
Persico, M. G. (1989). Molecular characterization of a gene
of the `EGF family' expressed in undifferentiated human NTERA2 teratocarcinoma
cells. EMBO J. 8,1987
-1991.[Medline]
Colas, J. F. and Schoenwolf, G. C. (2000).
Subtractive hybridization identifies chick-cripto, a novel EGF-CFC ortholog
expressed during gastrulation, neurulation and early cardiogenesis.
Gene 255,205
-217.[CrossRef][Medline]
Ding, J., Yang, L., Yan, Y. T., Chen, A., Desai, N.,
Wynshaw-Boris, A. and Shen, M. M. (1998). Cripto is required
for correct orientation of the anterior-posterior axis in the mouse embryo.
Nature 395,702
-707.[CrossRef][Medline]
Dono, R., Montuori, N., Rocchi, M., De Ponti-Zilli, L.,
Ciccodicola, A. and Persico, M. G. (1991). Isolation and
characterization of the CRIPTO autosomal gene and its X-linked related
sequence. Am. J. Hum. Genet.
49,555
-565.[Medline]
Dono, R., Scalera, L., Pacifico, F., Acampora, D., Persico, M.
G. and Simeone, A. (1993). The murine cripto gene: expression
during mesoderm induction and early heart morphogenesis.
Development 118,1157
-1168.[Abstract]
Faure, S., Lee, M. A., Keller, T., ten Dijke, P. and Whitman,
M. (2000). Endogenous patterns of TGFbeta superfamily
signaling during early Xenopus development.
Development 127,2917
-2931.[Abstract]
Gaio, U., Schweickert, A., Fischer, A., Garratt, A. N., Muller,
T., Ozcelik, C., Lankes, W., Strehle, M., Britsch, S., Blum, M. et al.
(1999). A role of the cryptic gene in the correct establishment
of the left-right axis. Curr. Biol.
9,1339
-1342.[CrossRef][Medline]
Gritsman, K., Zhang, J., Cheng, S., Heckscher, E., Talbot, W. S.
and Schier, A. F. (1999). The EGF-CFC protein one-eyed
pinhead is essential for nodal signaling. Cell
97,121
-132.[CrossRef][Medline]
Hamada, H., Meno, C., Watanabe, D. and Saijoh, Y.
(2002). Establishment of vertebrate left-right asymmetry.
Nat. Rev. Genet. 3,103
-113.[CrossRef][Medline]
Hanafusa, H., Masuyama, N., Kusakabe, M., Shibuya, H. and
Nishida, E. (2000). The TGF-beta family member derriere is
involved in regulation of the establishment of left-right asymmetry.
EMBO Rep. 1,32
-39.[CrossRef][Medline]
Hyatt, B. A., Lohr, J. L. and Yost, H. J.
(1996). Initiation of vertebrate left-right axis formation by
maternal Vg1. Nature
384, 62-65.[CrossRef][Medline]
Joseph, E. M. and Melton, D. A. (1997). Xnr4: a
Xenopus nodal-related gene expressed in the Spemann organizer. Dev.
Biol. 184,367
-372.[CrossRef][Medline]
Kinoshita, N., Minshull, J. and Kirschner, M. W.
(1995). The identification of two novel ligands of the FGF
receptor by a yeast screening method and their activity in Xenopus
development. Cell 83,621
-630.[CrossRef][Medline]
Kramer, K. L. and Yost, H. J. (2002).
Ectodermal syndecan-2 mediates left-right axis formation in migrating mesoderm
as a cell-nonautonomous Vg1 cofactor. Dev. Cell
2, 115-124.[CrossRef][Medline]
Lee, M. A., Heasman, J. and Whitman, M. (2001).
Timing of endogenous activin-like signals and regional specification of the
Xenopus embryo. Development
128,2939
-2952.[Abstract/Free Full Text]
Linask, K. K., Han, M. D., Linask, K. L., Schlange, T. and
Brand, T. (2003). Effects of antisense misexpression of CFC
on downstream flectin protein expression during heart looping. Dev.
Dyn. 228,217
-230.[CrossRef][Medline]
Lohr, J. L., Danos, M. C. and Yost, H. J.
(1997). Left-right asymmetry of a noda-related gene is regulated
by dorsoanterior midline structures during Xenopus development.
Development 124,1465
-1472.[Abstract]
Lowe, L. A., Supp, D. M., Sampath, K., Yokoyama, T., Wright, C.
V., Potter, S. S., Overbeek, P. and Kuehn, M. R. (1996).
Conserved left-right asymmetry of nodal expression and alterations in murine
situs inversus. Nature
381,158
-161.[CrossRef][Medline]
Lustig, K. D., Kroll, K., Sun, E., Ramos, R., Elmendorf, H. and
Kirschner, M. W. (1996). A Xenopus nodal-related gene that
acts in synergy with noggin to induce complete secondary axis and notochord
formation. Development
122,3275
-3282.[Abstract]
McGrath, J., Somlo, S., Makova, S., Tian, X. and Brueckner,
M. (2003). Two populations of node monocilia initiate
left-right asymmetry in the mouse. Cell
114, 61-73.[CrossRef][Medline]
Minchiotti, G., Parisi, S., Liguori, G. L., D'Andrea, D. and
Persico, M. G. (2002). Role of the EGF-CFC gene cripto in
cell differentiation and embryo development. Gene
287, 33-37.[CrossRef][Medline]
Nieuwkoop, P. D. and Faber, J. (1956).
Normal Table of Xenopus laevis (Daudin). Amsterdam:
North-Holland.
Nonaka, S., Tanaka, Y., Okada, Y., Takeda, S., Harada, A.,
Kanai, Y., Kido, M. and Hirokawa, N. (1998). Randomization of
left-right asymmetry due to loss of nodal cilia generating leftward flow of
extraembryonic fluid in mice lacking KIF3B motor protein.
Cell 95,829
-837.[CrossRef][Medline]
Nonaka, S., Shiratori, H., Saijoh, Y. and Hamada, H.
(2002). Determination of left-right patterning of the mouse
embryo by artificial nodal flow. Nature
418, 96-99.[CrossRef][Medline]
Norris, D. P., Brennan, J., Bikoff, E. K. and Robertson, E.
J. (2002). The Foxh1- dependent autoregulatory enhancer
controls the level of Nodal signals in the mouse embryo.
Development 129,3455
-3468.[Medline]
Osada, S. I., Saijoh, Y., Frisch, A., Yeo, C. Y., Adachi, H.,
Watanabe, M., Whitman, M., Hamada, H. and Wright, C. V.
(2000). Activin/nodal responsiveness and asymmetric expression of
a Xenopus nodal-related gene converge on a FAST-regulated module in intron 1.
Development 127,2503
-2514.[Abstract]
Reissmann, E., Jornvall, H., Blokzijl, A., Andersson, O., Chang,
C., Minchiotti, G., Persico, M. G., Ibanez, C. F. and Brivanlou, A. H.
(2001). The orphan receptor ALK7 and the Activin receptor ALK4
mediate signaling by Nodal proteins during vertebrate development.
Genes Dev. 15,2010
-2022.[Abstract/Free Full Text]
Saijoh, Y., Adachi, H., Sakuma, R., Yeo, C. Y., Yashiro, K.,
Watanabe, M., Hashiguchi, H., Mochida, K., Ohishi, S., Kawabata, M. et al.
(2000). Left-right asymmetric expression of lefty2 and nodal is
induced by a signaling pathway that includes the transcription factor FAST2.
Mol. Cell 5,35
-47.[CrossRef][Medline]
Saijoh, Y., Oki, S., Ohishi, S. and Hamada, H.
(2003). Left-right patterning of the mouse lateral plate requires
nodal produced in the node. Dev. Biol.
256,160
-172.[Medline]
Saloman, D. S., Bianco, C., Ebert, A. D., Khan, N. I., De
Santis, M., Normanno, N., Wechselberger, C., Seno, M., Williams, K., Sanicola,
M. et al. (2000). The EGF-CFC family: novel epidermal growth
factor-related proteins in development and cancer. Endocr. Relat.
Cancer 7,199
-226.[Abstract]
Sambrook, J. and Russell, D. W. (2001).
Molecular Cloning: A Laboratory Guide. New York: Cold
Spring Harbor Laboratory Press.
Sampath, K., Cheng, A. M., Frisch, A. and Wright, C. V.
(1997). Functional differences among Xenopus nodal-related genes
in left-right axis determination. Development
124,3293
-3302.[Abstract]
Schier, A. F. (2003). Nodal signaling in
vertebrate development. Annu. Rev. Cell Dev. Biol.
19,589
-621.[CrossRef][Medline]
Schiffer, S. G., Foley, S., Kaffashan, A., Hronowski, X.,
Zichittella, A. E., Yeo, C. Y., Miatkowski, K., Adkins, H. B., Damon, B.,
Whitman, M. et al. (2001). Fucosylation of Cripto is required
for its ability to facilitate nodal signaling. J. Biol.
Chem. 276,37769
-37778.[Abstract/Free Full Text]
Schlange, T., Schnipkoweit, I., Andree, B., Ebert, A., Zile, M.
H., Arnold, H. H. and Brand, T. (2001). Chick CFC controls
Lefty1 expression in the embryonic midline and nodal expression in the lateral
plate. Dev. Biol. 234,376
-389.[CrossRef][Medline]
Shen, M. M. and Schier, A. F. (2000). The
EGF-CFC gene family in vertebrate development. Trends
Genet. 16,303
-309.[CrossRef][Medline]
Shen, M. M., Wang, H. and Leder, P. (1997). A
differential display strategy identifies Cryptic, a novel EGF-related gene
expressed in the axial and lateral mesoderm during mouse gastrulation.
Development 124,429
-442.[Abstract]
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis: A
Laboratory Manual. New York: Cold Spring Harbor Laboratory
Press.
Sun, B. I., Bush, S. M., Collins-Racie, L. A., LaVallie, E. R.,
DiBlasio-Smith, E. A., Wolfman, N. M., McCoy, J. M. and Sive, H. L.
(1999). derriere: a TGF-beta family member required for posterior
development in Xenopus. Development
126,1467
-1482.[Abstract]
Tanegashima, K., Yokota, C., Takahashi, S. and Asashima, M.
(2000). Expression cloning of Xantivin, a Xenopus
lefty/antivin-related gene, involved in the regulation of activin signaling
during mesoderm induction. Mech. Dev.
99, 3-14.[CrossRef][Medline]
Tanegashima, K., Haramoto, Y., Yokota, C., Takahashi, S. and
Asashima, M. (2004). Xantivin suppresses the activity of
EGF-CFC genes to regulate nodal signaling. Int. J. Dev.
Biol. 48,275
-283.[CrossRef][Medline]
Tao, Q., Yokota, C., Puck, H., Kofron, M., Birsoy, B., Yan, D.,
Asashima, M., Wylie, C. C., Lin, X. and Heasman, J. (2005).
Maternal wnt11 activates the canonical wnt signaling pathway required for axis
formation in Xenopus embryos. Cell
120,857
-871.[CrossRef][Medline]
Toyoizumi, R., Mogi, K. and Takeuchi, S.
(2000). More than 95% reversal of left-right axis induced by
right-sided hypodermic microinjection of activin into Xenopus neurula embryos.
Dev. Biol. 221,321
-336.[CrossRef][Medline]
Watanabe, M. and Whitman, M. (1999). FAST-1 is
a key maternal effector of mesoderm inducers in the early Xenopus embryo.
Development 126,5621
-5634.[Abstract]
Weisberg, E., Winnier, G. E., Chen, X., Farnsworth, C. L.,
Hogan, B. L. and Whitman, M. (1998). A mouse homologue of
FAST-1 transduces TGF beta superfamily signals and is expressed during early
embryogenesis. Mech. Dev.
79, 17-27.[CrossRef][Medline]
Wessely, O., Kim, J. I., Geissert, D., Tran, U. and De Robertis,
E. M. (2004). Analysis of Spemann organizer formation in
Xenopus embryos by cDNA macroarrays. Dev. Biol.
269,552
-566.[CrossRef][Medline]
Whitman, M. (2001). Nodal signaling in early
vertebrate embryos: themes and variations. Dev. Cell
1, 605-617.[CrossRef][Medline]
Wright, C. V. (2001). Mechanisms of left-right
asymmetry: what's right and what's left? Dev. Cell
1, 179-186.[CrossRef][Medline]
Xu, C., Liguori, G., Persico, M. G. and Adamson, E. D.
(1999). Abrogation of the Cripto gene in mouse leads to failure
of postgastrulation morphogenesis and lack of differentiation of
cardiomyocytes. Development
126,483
-494.[Abstract]
Yabe, S., Tanegashima, K., Haramoto, Y., Takahashi, S., Fujii,
T., Kozuma, S., Taketani, Y. and Asashima, M. (2003). FRL-1,
a member of the EGF-CFC family, is essential for neural differentiation in
Xenopus early development. Development
130,2071
-2081.[Abstract/Free Full Text]
Yan, Y. T., Gritsman, K., Ding, J., Burdine, R. D., Corrales, J.
D., Price, S. M., Talbot, W. S., Schier, A. F. and Shen, M. M.
(1999). Conserved requirement for EGF-CFC genes in vertebrate
left-right axis formation. Genes Dev.
13,2527
-2537.[Abstract/Free Full Text]
Yan, Y. T., Liu, J. J., Luo, Y., Chaosu, E., Haltiwanger, R. S.,
Abate-Shen, C. and Shen, M. M. (2002). Dual roles of Cripto
as a ligand and coreceptor in the nodal signaling pathway. Mol.
Cell. Biol. 22,4439
-4449.[Abstract/Free Full Text]
Yeo, C. and Whitman, M. (2001). Nodal signals
to Smads through Cripto-dependent and Cripto-independent mechanisms.
Mol. Cell 7,949
-957.[CrossRef][Medline]
Zhang, J., Talbot, W. S. and Schier, A. F.
(1998). Positional cloning identifies zebrafish one-eyed pinhead
as a permissive EGF-related ligand required during gastrulation.
Cell 92,241
-251.[CrossRef][Medline]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:

|
 |

|
 |
 
D. D'Andrea, G. L. Liguori, J. A. Le Good, E. Lonardo, O. Andersson, D. B. Constam, M. G. Persico, and G. Minchiotti
Cripto promotes A-P axis specification independently of its stimulatory effect on Nodal autoinduction
J. Cell Biol.,
February 6, 2008;
180(3):
597 - 605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M. Shen
Nodal signaling: developmental roles and regulation
Development,
March 15, 2007;
134(6):
1023 - 1034.
[Abstract]
[Full Text]
[PDF]
|
 |
|