|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 September 2006
doi: 10.1242/dev.02576
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 New York University, Department of Biology, New York, NY 10003, USA.
2 Western Washington University, Bellingham, WA 98225, USA.
* Author for correspondence (e-mail: cd38{at}nyu.edu)
Accepted 9 August 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Caudal, Nasonia, Segmentation
| INTRODUCTION |
|---|
|
|
|---|
Much of our understanding of anteroposterior body axis formation has been a
result of elegant screens for segmentation defects in Drosophila. The
syncytial environment of the Drosophila embryo allows for the
generation of morphogenetic gradients of transcription factors, which are
established via mRNA localization, protein diffusion and translational
repression. Reciprocal gradients are then interpreted by downstream targets in
a concentration-dependent manner to establish a complex anteroposterior
patterning system that will eventually form the segmented insect body plan.
However, much of development in most other insects takes place in a
cellularized environment, and thus not all basic mechanisms and principles
used in Drosophila patterning can be conserved. Still, many of the
genes involved in fly segmentation are well conserved
(Tautz, 2004
;
Liu and Kaufman, 2005
).
Although much attention has been focused on anterior patterning in the fly,
the major anterior patterning factor bicoid (bcd) is not
found outside the dipteran lineage (Dearden
and Akam, 1999
; Stauber et
al., 1999
; Stauber et al.,
2000
; Lynch and Desplan,
2003
), and this has thus led researchers to investigate the
patterning networks of other insects, such as Tribolium
(Tautz, 2004
;
Liu and Kaufman, 2005
).
Beetles use an ancestral mode of embryogenesis, termed short-germ
embryogenesis, in which the embryo develops in the posterior of the egg and
only anterior structures are patterned in a syncytial environment. Later,
abdominal and posterior structures are formed in a cellularized environment
through a region in the posterior of the germ rudiment termed the `growth
zone'. This is in contrast to the more derived long-germ mode of patterning
found in flies, where the embryo occupies the entire egg, is patterned
completely within a syncytial environment and, thus, lacks a posterior growth
zone (Davis and Patel, 2002
).
It has been proposed that an anterior patterning center, such as Bcd in the
long-germ Drosophila, would not function well to pattern the anterior
of the embryo in short germ insects
(Stauber et al., 1999
;
Stauber et al., 2000
):
anteriorly localized factors would not be able to reach the germ rudiment at
the posterior of the oocyte and would instead pattern the extra-embryonic
membranes, which lie at the anterior (Lall
and Patel, 2001
; van der Zee
et al., 2005
). Instead, the ancestral system may have exclusively
used a posterior patterning center, allowing for posteriorly localized factors
to reach the developing embryo easily.
The posterior patterning homeoprotein Caudal (Cad) is conserved throughout
evolution from C. elegans to mammals. The Drosophila caudal
gene (Dm cad) is involved in posterior embryonic patterning and
hindgut formation (Macdonald and Struhl, 1987;
Moreno and Morata, 1999
;
Schulz and Tautz, 1995
;
Wu and Lengyel, 1998
). Dm
cad zygotic mutant embryos are not viable and exhibit posterior defects:
a lack of anal pad, anal tuft structures and anal sense organs. This rather
mild phenotype has been attributed to maternal rescue of the loss of zygotic
Dm cad. Maternally mutant embryos that have been paternally rescued
also show mild phenotypes with deletions in abdominal segment 8 (A8) and
sometimes A4, but are viable. Embryos lacking both maternal and zygotic Dm
cad, however, show severe segmentation defects. Although the head and
thorax are normal, the body is shortened owing to elimination of all anal
structures and disruption of more anterior abdominal segments
(Macdonald and Struhl, 1986
)
(Fig. 3).
The phenotype resulting from loss of cad has also been
investigated in Tribolium, Gryllus (cricket) and Artemia
(brine shrimp) using RNA interference (RNAi)
(Copf et al., 2003
;
Copf et al., 2004
;
Shinmyo et al., 2005
), and
also studied in Sacculina (barnacle)
(Rabet et al., 2001
).
Strikingly, in each organism examined, loss of cad results in embryos
where only anterior head structures remain and all thoracic, abdominal and
posterior structures fail to form. This phenotype is more severe than the
Dm cadmat+zyg phenotype, and suggests that cad
may play a greater role in patterning ancestral insects than in
Drosophila. In the intermediate germ Gryllus embryo,
cad plays a major role in thoracic and gnathal patterning by
activating transcription of the gap genes hunchback (hb) and
Krüppel (Kr). This role in gap gene activation is
played by bcd and maternal hb in Drosophila. It has
thus been proposed that, in ancestral insects, cad sits at the top of
the segmentation cascade and regulates gap gene expression, while bcd
has usurped this role in higher dipterans
(Shinmyo et al., 2005
).
The Dm cad gene is expressed maternally and zygotically in the
embryo. Both transcripts share an identical open reading frame and encode a
homeodomain protein of 427 amino acids. Maternal Dm cad RNA is first
made in the nurse cells and is found evenly distributed throughout the embryo
(Mlodzik and Gehring, 1987a
)
(Fig. 1E). The maternal
Dm Cad protein product forms a posterior to anterior gradient via
translational repression by Bcd in the anterior. Bcd binding to the
cad mRNA is mediated by the Bicoid response element (BRE) in the
3'UTR of the cad transcript
(Dubnau and Struhl, 1996
;
Rivera Pomar et al., 1996). A translationally controlled maternal gradient is
also observed in both Bombyx mori (silk moth) and Tribolium,
although it is not understood how it is established in these species
(Wolff et al., 1998
;
Xu et al., 1994
). Furthermore,
the C. elegans cad homolog pal-1 is maternally expressed and
its protein product is restricted to cells of the posterior lineage via
translational repression by mex-3, a gene that encodes an
mRNA-binding protein that shares no homology with Bcd
(Hunter and Kenyon, 1996
).
As the Drosophila embryo develops, the Cad protein gradient
becomes steeper and recedes from the anterior, forming a zygotic abdominal
expression domain (Macdonald and Struhl, 1987;
Mlodzik and Gehring, 1987a
)
(Fig. 2H,I). Later, the
abdominal expression domain disappears and only a posterior stripe remains
(Wu and Lengyel, 1998
)
(Fig. 2J). In Gryllus,
cad is expressed in the early embryo in a posterior-to-anterior gradient,
and later is restricted to the posterior growth zone, as in Tribolium
and Artemia (Shinmyo et al.,
2005
; Schulz et al.,
1998
; Copf et al.,
2003
).
In order to study evolution of insect patterning, we have chosen the
long-germ hymenopteran Nasonia vitripennis (Nvit). This
parasitic wasp is a model system where a forwards genetic screen and
functional parental RNAi studies have been performed
(Pultz et al., 1999
;
Pultz et al., 2000
;
Pultz et al., 2005
;
Lynch et al., 2006a
;
Lynch et al., 2006b
).
Nasonia uses a long-germ mode of embryogenesis similar to that of
highly derived Drosophila. However, Nasonia does not possess
a bcd homolog and might therefore rely on an ancestral patterning
system. Thus, Nasonia is an ideal system in which to study the
evolution of patterning gene networks in general, as well as to study the
specific patterning changes that have occurred during the evolution of
long-germ embryogenesis.
In a screen to identify genes involved in embryonic patterning in
Nasonia, many mutations in segmentation genes were identified,
including a large number that resemble mutations in Drosophila genes
of the gap, pair-rule and Polycomb-group
(Pultz et al., 1999
). In
particular, one mutant, head only (ho), has a phenotype very
similar to Tc cad RNAi embryos. It is also reminiscent of Dm
cadmat+zyg mutant embryos, although more severe, and was thus
hypothesized to be due to a lesion in the Nvit cad locus
(Pultz et al., 1999
;
Pultz et al., 2000
). Here, we
use parental RNAi to show that ho is most likely to be a zygotic
Nvit cad mutant. Using ho together with parental RNAi, we
assessed the role of the maternal and zygotic Nvit cad components as
compared with that of Dm cad. We find that Nasonia uses mRNA
localization to generate a posterior to anterior cad mRNA gradient in
the absence of translational regulation of Cad by Bcd. Furthermore, we provide
evidence that in Nasonia, cad acts as a crucial posterior patterning
center sitting atop the ancestral patterning hierarchy.
| MATERIALS AND METHODS |
|---|
|
|
|---|
RNA interference
Nvit cad parental RNAi was performed as described
(Lynch and Desplan, 2006
)
using forward (5' TAATACGACTCACTATAGGGAGACCAC-
CAGAACCGCCGAGCTAAAGAC 3' and reverse (5'
TAATACGACTCACTATAGGGAGACCACTCAGCGGCGAGATCAGTTAAA 3') primers to
generate templates via PCR for transcription of double-stranded RNA. (T7
promoters are in bold.)
Fly lines
cad zygotic mutants were generated by crossing
pr[1]cad[2]P{ry[+t7.2]=neoFRT}40A/CyO
virgin females to
b[1]pr[1]cad[3]/In(2LR)Gla,wg[Gla-1]/CyO.
Maternal cad mutants were generated by crossing
pr[1]cad[2]P{ry[+t7.2]=neoFRT}40A/CyO
virgin females to P[ry+;hs-FLP]12;
P[w+;OvoD1]2L
P[hs-neo;ry+FRT]40A/CyO
males. Third instar larvae and virgin progeny were heat shocked at 37°C
for 90 minutes. Virgin females were crossed to
b[1]pr[1]cad[3]/In(2LR)Gla,wg[Gla-1]/CyO
males to generate progeny of which half are maternally mutant and half are
maternal and zygotic mutants. To generate only maternally mutant progeny,
heat-shocked virgin females were crossed to yw males. Ventral
misexpression lines (sna>Kr; sna>hb; sna>otd; sna>tll) were gifts
from Stephen Small. Males carrying both the snail misexpression transgene and
a ß2-tubulin-FLP transgene were crossed to yw
virgin females to activate ventral misexpression. The resulting progeny were
assayed using in situ hybridization.
Degenerate PCR
Nv caudal was initially cloned by PCR using degenerate forward
(5' CATGAATTCAARACKCGNACKAARGAYAARTA 3'), and the reverse
(5' TGAGTCGACRTTYTGRAACCADATYTTNAC 3') primers.
RACE PCR
Total RNA was isolated from pooled embryos collected 0-4 hours or 4-10
hours after egg laying. SMART PCR cDNA synthesis kit (Clontech) was used for
first-strand cDNA synthesis. The 5' RACE primer (5'
GCGGATGGTGATGTACCGGCTAGAGTAG 3') and 3' RACE primer (5'
AACTCGCCAGCAGCCTCGCCTTGTC 3') were used to clone the 5' and
3' ends of Nasonia caudal mRNA.
Genomic PCR
PCR was used to characterize Nv caudal genomic sequence. Forward and
reverse primer sets included: 5' CAAGACACGAACGAAGGACAAGTACAG 3',
5' ACGGTTAGCACTCGGGTATGAACAACT 3'; and 5'
GTTGTTGAATTCGCCGAGCTAAAGACCGCAAGCAG 3', 5'
ATTGTTAACGTTGAGCACCGAGTGTTG 3'.
Molecular mapping
To determine whether head only was linked with Nv caudal,
degenerate PCR was used to also clone caudal from the sister species
Nasonia giraulti (Ng) for molecular mapping
(Pultz et al., 2005
). A
polymorphism distinguishing the Nv and Ng caudal was detected by
Ambion RNAse Mismatch Detect II kit. This allowed testing surviving sons of a
Nv head only x Ng cross to determine if they had Ng or Nv
caudal. All surviving sons (45/45) had Ng caudal, suggesting
that caudal is linked to head only.
| RESULTS |
|---|
|
|
|---|
|
|
Regulation of Nvit cad by gap genes
In Dm, hb regulates the abdominal expression of Dm cad in
a concentration-dependent manner: High levels of hb repress, whereas
low levels activate, Dm cad transcription
(Schulz and Tautz, 1995
).
Additionally, in hb zygotic mutants, the posterior stripe of
cad is expanded (Mlodzik and
Gehring, 1987b
).
We find that, in addition to an expansion of the posterior Dm cad
stripe, hbzyg mutants show ectopic dorsal expression of
Dm cad in the anterior of the embryo
(Fig. 3H). Similarly, in the
zygotic Nvit hbhl mutant
(Pultz et al., 2005
), the
posterior Nvit cad stripe is duplicated at the anterior of the
embryo. Additionally, faint Nvit cad staining spans the region
between the wild-type posterior Nvit cad stripe and the ectopic
anterior Nvit cad stripe (Fig.
3D-F). This suggests that Nvit hb prevents Nvit
cad expression in the anterior of the embryo. Furthermore, the ectopic
anterior Dm and Nvit cad stripes are reminiscent of the
duplication of the posterior Dm cad stripe at the anterior of
bcd- mutant embryos
(Mlodzik and Gehring,
1987b
).
As Nvit otd-1 to a large extent plays a role similar to that of
Dm bcd (Lynch et al.,
2006a
), we examined Nvit cad expression in otd-1
RNAi embryos. Zygotic Nvit cad becomes derepressed from both poles,
resulting in expression throughout the embryo. The area of Nvit cad
derepression corresponds to the otd-1 expression domains
(Fig. 3A-C).
To assess in more detail the function of hb and otd in
flies, and to address the function of Kr and tll in
regulating cad, we next used ventral misexpression in
Drosophila to examine the effect of the Dm gap genes
tll, Kr, otd and hb on Dm cad expression. We used
the snail (sna) promoter to drive ectopic expression in a
ventral stripe (Andrioli et al.,
2002
). In sna>tll embryos, cad is activated
in the ventral region of the embryo (Fig.
3I). Interestingly, Dm cad is not activated in the
anterior ventral region of the embryo, suggesting that it is strongly
repressed there. This activation by tll agrees with previous studies
that showed a loss of the posterior Dm cad stripe in tll
mutant embryos (Mlodzik and Gehring,
1987b
). Ventral misexpression of the other gap genes does not
affect Dm cad expression (data not shown). In the case of
hb, one would have expected ventral repression of the posterior
Dm cad stripe as it has been shown that high levels of hb
repress Dm cad (Schulz and Tautz,
1995
). The lack of repression might be due to insufficient levels
of ventral hb. The lack of effect of Kr misexpression on
Dm cad is consistent with the wild-type expression of Dm cad
in Kr mutants (data not shown). These results suggest that the role
of hb and other gap genes in regulating cad expression may
have changed in the Drosophila gene network, when compared with more
ancestral patterning networks.
|
28 hours at 28°C; cuticles were
subsequently examined. Interestingly, high concentrations of dsRNA targeting
Nvit cad results in few embryos being laid: embryos derived from
these mothers cease developing and do not reach the cuticular stage,
suggesting that Nvit cad might play a role in oogenesis that is
separate from its role in the early embryo. Females injected with control
gfp dsRNA show no cuticular defects and no difference in egg laying
from wild-type females (data not shown). Lowering the concentration of
Nvit cad dsRNA, however, results in a range of cad
phenotypes. The wild-type Nasonia cuticle is composed of mouth hooks
at the anterior, three thoracic and ten abdominal denticle belts. The second
thoracic, as well as the first three abdominal denticle belts are easily
identified by the presence of spiracles
(Fig. 4A). Weak Nvit
cad RNAi phenotypes show fusion of denticle belts throughout the abdomen
but most commonly between segments A2 and A3 (data not shown). Stronger RNAi
phenotypes exhibit a combination of fused or missing denticle belts, with
progressive loss of segments starting from the posterior. Although, the number
of denticle belts missing ranges from 0 to 13, most embryos retain six or
seven denticle belts. Embryos exhibiting strong phenotypes, however, typically
retain only three or four denticle belts, with T3 or A1 being the most
posterior denticle belt remaining (Fig.
4B). These phenotypes are reminiscent of, but more severe than,
the Dm cadmat+zyg phenotype, which also typically shows
few abdominal denticle belts and often exhibits fusion of belts. Rarely do
Dm cadmat+zyg phenotypes show loss of denticle belts as
far anteriorly as A2 (Fig.
4F).
|
Taken together, the linkage analysis, paternal RNAi phenotypic series, as well as loss of Nvit cad expression in ho strongly suggest that ho is due to a lesion in the Nvit cad locus. Therefore, ho mutant embryos will be used here to examine the effects of zygotic lack of Nvit cad expression, in contrast to parental Nvit cad RNAi, which knocks down both maternal and zygotic Nvt cad expression.
Nvit cad regulates hb expression through Kr
To test whether maternal Nvit cad contributes to embryonic
patterning and to decipher its place in the Nasonia patterning
hierarchy, we examined the effects on gap gene expression of knocking down
maternal and zygotic Nvit cad and compared our results with those
obtained in ho mutants. We also compared the function of cad
in Nasonia with its role in Drosophila.
Nvit hunchback (Nvit hb) is expressed maternally and
zygotically in the Nasonia embryo
(Pultz et al., 2005
;
Lynch et al., 2006a
)
(Fig. 5A). Maternal Nvit
hb is first distributed throughout the embryo and remains unaffected in
ho, as well as in Nvit cad RNAi embryos. Later zygotic
Nvit hb appears as an anterior cap and as a broad stripe in the
posterior of the embryo (Pultz et al.,
2005
). In ho mutants, the anterior expression domain of
Nvit hb expands toward the posterior. The same effect is seen in
embryos derived from females injected with Nvit cad dsRNA, suggesting
that zygotic, but not maternal Nvit cad, positions the posterior
boundary of the Nvit hb anterior zygotic expression domain
(Fig. 5B,C). As cad is
generally thought of as a transcriptional activator, we examined whether
Nvit cad might activate a repressor of hb. A candidate for
this repressor is Krüppel (Kr).
Nvit Kr is expressed in a broad stripe in the center of the Nasonia embryo resembling Dm Kr expression (Fig. 5G). In ho embryos, there is a clear reduction in Nvit Kr transcription, leaving only a thin stripe of expression (Fig. 5I). In Nvit cad RNAi embryos, the central broad expression domain of Nvit Kr is absent (Fig. 5H). Therefore, both maternal and zygotic Nvit cad components are required to activate Nvit Kr expression. Anterior Nvit hb expression might therefore expand towards the posterior in Nvit cad mutants owing to the absence of Nvit Kr expression (Fig. 5G-I). Indeed, in the absence of Nvit Kr, Nvit hb shows a similar posterior expansion (A.E.B. and C.D., unpublished). We next examined whether loss of Dm cad also affects Dm Kr expression. In sharp contrast to the role of Nvit cad in Nvit Kr activation, we find that Dm Kr is not affected in zygotic, maternal or maternal + zygotic Dm cad mutant embryos (Fig. 6I,J). Furthermore, there is no effect on Dm hb expression in the same mutant genotypes (Fig. 6K,L).
|
Nvit cad activates both Nvit kni and Nvit gt
Dm cad acts as a transcriptional activator of Dm giant
(gt) and Dm knirps (kni)
(Rivera-Pomar et al., 1995
;
Schulz and Tautz, 1995
). We
verified that removing either zygotic or maternal Dm cad alone shows
no effect on Dm gt and Dm kni expression (data not shown).
However, removing both maternal and zygotic Dm cad causes a reduction
in the expression of the posterior stripe of Dm gt
(Fig. 6A-D), while the
posterior stripe of Dm kni is reduced in intensity and expanded
posteriorly (Fig. 6E-H). This
expansion is probably due to a reduction in Dm gt, which acts as a
repressor of Dm kni (Rivera-Pomar
et al., 1995
). Nevertheless, these phenotypes are fairly mild.
Nvit kni and Nvit gt are expressed zygotically in a similar pattern to their fly counterparts (Fig. 5D,J; Fig. 6A,C,E,G). Zygotic Nvit cad appears to be necessary to activate the posterior stripes of both Nvit gt and Nvit kni, since they are missing in ho mutants (Fig. 5F,L). In Nvit cad RNAi embryos, the same effect is observed at the posterior, while the anterior expression domains of Nvit kni and Nvit gt are also affected. Although positioned properly, the anterior Nvit kni domain is dramatically reduced (Fig. 5E), while the anterior domain of Nvit gt is expanded posteriorly (Fig. 5K). This expansion is not only due to loss of Kr as there is no dramatic posterior expansion of Nvit gt in Nvit Kr RNAi embryos (A.E.B. and C.D., unpublished). Therefore maternal Nvit cad probably represses anterior Nvit gt directly or activates another repressor of Nvit gt, thereby establishing its posterior border of expression.
Nvit cad activates tll but not otd transcription
Nvit otd has recently been shown to act as a morphogen involved in
anterior patterning. Moreover, Nvit otd is involved in posterior
patterning and its posterior cuticular phenotype partly overlaps with that of
Nvit cad (Lynch et al.,
2006a
). We therefore examined whether Nvit cad regulates
expression of posterior Nvit otd and Nvit tailless (Nvit
tll) (Lynch et al.,
2006b
), which is involved in terminal patterning. Nvit
otd is expressed maternally at both poles in the early embryo. Zygotic
expression later forms caps at both poles of the embryo
(Lynch et al., 2006a
).
ho and Nvit cad RNAi embryos show normal maternal and
zygotic expression of Nvit otd, consistent with the model that
Nvit otd is a maternal morphogen that regulates its own expression
(data not shown) (Lynch et al.,
2006a
).
Nvit tll is expressed zygotically and resembles Dm tll
expression (compare Fig. 4M
with Fig. 5M)
(Lynch et al., 2006b
).
Nvit tll is affected identically in both ho and Nvit
cad RNAi embryos, where both the anterior and the posterior expression
domains of Nvit tll are reduced. Later, however, the anterior
expression domain is restored, while the posterior domain remains absent.
Zygotic Nvit cad therefore activates both Nvit tll
expression domains, but is not necessary for later activation of anterior
Nvit tll expression (Fig.
5M-O). In Drosophila, otd (data not shown) and
tll remain unaffected in the three different classes of Dm
cad mutants (Fig.
6M,N).
Dm cad regulates pair rule gene expression
Our results indicate that Nvit cad plays a major role in gap gene
regulation. As we see a much weaker regulatory contribution of Dm cad
at the level of the gap genes, it is likely that this role has been taken over
by bcd in Drosophila or become redundant with other
patterning factors. However, although Dm cad might have become
obsolete at the level of gap gene regulation, the Dm
cadmat+zyg phenotype does show severe segmentation defects. We
therefore examined the role of Dm cad in regulating pair-rule gene
expression as a possible explanation for the severe cuticular phenotype
resulting from the complete loss of Dm cad.
|
As Dm cad-binding sites have been identified in the 3+7 and 4+6
enhancer elements of the pair-rule gene Drosophila even skipped
(eve) (Hader et al.,
1998
; Schroeder et al.,
2004
), we looked at the expression of Dm eve in the
different Dm cad mutant backgrounds. In a small number of Dm
cadzyg mutant embryos, the posterior stripes of Dm
eve are weakly reduced. In Dm cadmat mutants, Dm
eve stripes 4-7 are expressed weakly with stripes 5 and 6 not well
resolved in some cases. In Dm cadmat+zyg mutants, however,
there is a loss of stripes 4, 6 and 7, a posterior expansion of stripe 5, as
well as a reduction in stripe 3 expression
(Fig. 7B). These results
validate the presence of Cad-binding sites in the stripes 3/7 and 4/6 enhancer
elements and further support the idea that the severity of the Dm
cadmat+zyg phenotype is a result of aberrant pair-rule gene
expression rather than of defects in gap gene expression.
|
| DISCUSSION |
|---|
|
|
|---|
Extensive function of Nvit cad
We have investigated the function of Nvit cad in early
embryogenesis using both parental RNAi and the ho mutation, which
probably results from the loss of zygotic Nvit cad. This allowed us
to distinguish maternal and zygotic functions for a gene in a species other
than Drosophila. The fact that the Nvit cad RNAi phenotype
is much more severe than total loss of Dm cad is not surprising given
the fact that both maternal and zygotic expression patterns of Nvit
cad reach much further towards the anterior of the embryo than Dm
cad. Similarly, in Gryllus, the Gb cad RNAi phenotype
includes a complete loss of thoracic, abdominal and posterior structures. This
is reflected in the wild-type expression of Gb cad, which is
expressed in the presumptive gnathal and thoracic regions, as well as in the
posterior growth zone (Shinmyo et al.,
2005
).
The fact that the severe cad phenotype is conserved in arthropods suggests that ancestrally, cad played a greater role in embryonic development but has lost some of its importance in Drosophila. We discuss these roles of cad, and what function it has retained in Drosophila for pair-rule gene regulation.
Maternal Nvit cad mRNA is localized
We have shown that Nasonia establishes a maternal mRNA gradient in
the early embryo using mRNA localization and diffusion. Maternal Nvit
cad mRNA is tightly localized to the posterior of the oocyte. After the
embryo is laid, however, the mRNA diffuses far towards the anterior creating
an mRNA gradient. Nasonia has thus devised a new mechanism for
establishing a posterior-to-anterior gradient of cad mRNA, which
probably forms a similar gradient at the protein level. In Drosophila,
cad maternal transcripts are homogenously distributed throughout the
early embryo and the Cad protein gradient is produced later through
translational repression by Bcd (Dubnau and
Struhl, 1996
; Rivera-Pomar et
al., 1996
) (Fig.
1D). A redundant translational repression system may exist in
Nasonia to ensure that no Cad is produced at the anterior.
The mechanism that establishes the Cad gradient in Nasonia is of
particular importance as bcd is a new addition to the developmental
network and is found only in higher dipterans. Consequently, Bcd cannot be
responsible for establishing the Cad gradient in more ancestral species
(Lynch and Desplan, 2003
).
Nonetheless the Cad gradient is conserved among insects. In
Tribolium, Cad protein is first expressed homogenously throughout the
embryo. Later, however, a posterior to anterior protein gradient forms but
nothing is known about the mechanisms leading to the formation of this
gradient. Interestingly, however, when a transgene encoding the Tc
cad mRNA is placed in Drosophila, it leads to the formation of a
translational gradient that is dependent on bcd
(Wolff et al., 1998
). This
argues that a common underlying mechanism may be responsible for establishing
the protein gradient in Tribolium and in Drosophila. It is
likely that bcd took over the function of a translational repressor
present in ancestral insects, perhaps including Nasonia. The mRNA
gradient might therefore be specific to the wasp. Interestingly, Nvit
otd mRNA is also localized to both the anterior and posterior poles of
the embryo, which has not been reported in any other species
(Lynch et al., 2006a
). This
suggests that Nasonia may extensively use RNA localization mechanisms
for setting up the anteroposterior axes in the embryo. Moreover, maternal mRNA
localization may be a common feature of long germ development. Studies
performed in other Hymenopterans, which undergo extremely diverse modes of
embryogenesis, ranging from long-germ embryogenesis in Apis mellifera
(Davis and Patel, 2002
) to the
polyembryonic development of Copidosoma floridanum
(Grbic, 2003
) will aid in
identifying the conserved mechanisms among these diverse modes of
embryogenesis. In Copidosoma, up to 2000 embryos may be produced
clonally from a single egg, showing that maternal determinants cannot play
similar axial patterning roles in this insect as seen in long and short germ
insects (Zhurov et al., 2004
).
However, work in the long germ Apis mellifera might elucidate whether
maternal mRNA localization is a common feature of long-germ embryogenesis.
cad is the ancestral activator of gap genes
In Nasonia, cad functions as an activator of gap gene expression,
placing it at the top of the segmentation network similar to bcd in
Drosophila. However, we find no evidence that Cad acts as a
morphogenetic gradient. Gap genes are primary interpreters of anteroposterior
cues and serve to divide the early embryo into broad expression domains. Among
gap genes, Dm Kr is a particularly important player that acts as a
potent repressor of other gap and pair rule genes. Positioning the Kr
domain is therefore crucial and Bcd is involved in Dm Kr regulation
in addition to activating a large number of anterior patterning genes such as
Dm hb. bcd is therefore considered a master patterning gene
(Hoch et al., 1991
). In
Gryllus, Gb Kr and Gr hb are activated by
cad and it was hypothesized that this represents the ancestral
function of cad, placing it at the top of the segmentation hierarchy
(Shinmyo et al., 2005
).
Cad-binding sites have been identified in Dm Kr regulatory region,
which may be vestiges that had once functioned in an ancestral patterning
system (Schroeder et al.,
2004
). Our results in Nasonia confirm that the role of
cad to activate Kr is conserved and supports the notion that
this role has been usurped by bcd in Drosophila. We also
find that Nvit cad activates tll expression. This role is
not conserved in the fly, despite the presence of cad-binding sites
in the regulatory region of Dm tll
(Schroeder et al., 2004
).
kni and gt, which are only weakly affected in
Drosophila cad mutants, absolutely require cad in
Nasonia. It is likely that kni and gt rely instead
on bcd for activation in Drosophila. It should be noted that
the anterior patterning gene bcd is involved in activating gap gene
expression in the posterior of the embryo. This is also true of the
posterior-most stripe of the pair-rule gene hairy, which relies on
the combined activity of Bcd and Cad for activation
(La Rosee et al., 1997
).
Similarly, although cad is typically thought to regulate expression
in the posterior of the embryo, maternal Nvit cad is involved in
regulating the anterior expression domains of both kni and
gt.
Although the role of cad in activating the gap genes seems to have been taken over by bcd in Drosophila, complete loss of Dm cad does result in severe segmentation defects. We have shown that Dm cad acts at the level of pair-rule genes instead and that it is a strong transcriptional regulator of Dm eve expression.
Nvit otd and Nvit cad work together in patterning posterior segments
bcd is believed to have evolved as a duplication of zen
(Dearden and Akam, 1999
;
Stauber et al., 1999
;
Stauber et al., 2000
) that
later acquired a K50 residue within its homeodomain, giving it the
same binding specificity as Otd (Treisman
et al., 1989
). It has thus been proposed that otd is a
major ancestral anterior patterning gene, the role of which has been taken
over by bcd (reviewed by Lynch
and Desplan, 2003
). Interestingly, in Nasonia, otd is
expressed maternally and zygotically at both poles. Loss of Nvit otd
results in the loss of both anterior and posterior structures
(Lynch et al., 2006a
). This
phenotype is somewhat overlapping in the posterior with Nvit cad.
Thus, it is likely that Nvit cad and Nvit otd work in
concert to regulate posterior genes, as seen in fly with bcd and
cad activating posterior hairy and kni stripes. The
presence of Bcd (K50) binding sites in promoter elements of genes
expressed in the posterior of the Drosophila embryo may thus reflect
an ancestral role of otd in activating posterior genes, although
Nasonia remains the sole example so far of posterior otd
expression.
Nvit otd is necessary to repress Nvit cad from both poles
of the embryo. Additionally, Nvit hb represses later Nvit
cad expression in the anterior of the embryo. This suggests that zygotic
Nvit cad is first activated throughout the embryo, and that a strong
repression system is required to prevent Nvit cad from specifying
posterior fates in the anterior. In Drosophila, the absence of Bcd
leads to the expansion of maternal Cad to the anterior of the egg. This
results in the duplication at the anterior of the embryo of a telson, a
structure that requires cad. However, the mere presence of Cad at the
anterior is not sufficient to induce the formation of a telson. In embryos
where Bcd is present but unable to bind the cad 3'UTR, Cad is
expanded anteriorly, yet only head involution defects are seen but no telson
forms at the anterior (Mlodzik et al.,
1990
; Neissing et al.,
1999
; Neissing et al.,
2002
). This is probably due to the presence of
bcd-dependent Hb at the anterior, which might inhibit Cad protein
function. Like bcd, Nvit otd also acts, probably in concert with
Nvit hb, in repressing posterior development in the anteriormost
region of the embryo by repressing Nvit cad. However, Nvit
otd controls Nvit cad at the transcriptional level, whereas
bcd represses Dm cad at the translational level.
| Conclusion |
|---|
|
|
|---|
In conclusion, the posterior-to-anterior gradient of Nasonia maternal cad is established in a novel way through the formation of an mRNA gradient. Moreover, maternal Nvit cad plays a distinct role from its zygotic counterpart. Together, maternal and zygotic Nvit cad regulate gap gene expression in a non-redundant manner, placing cad at the top of the segmentation network. In Drosophila, it seems that cad has lost, to bcd, its ability to activate gap genes and instead its role in the patterning network is to regulate pair rule genes. The combinatorial activation of posterior kni by cad and bcd in Drosophila may be a remnant of the ancestral role of cad as the key transcriptional activator of gap genes. We thus propose that cad is the ancestral patterning center in short-germ embryogenesis and that this role is retained in Nasonia long-germ development but largely lost in Drosophila.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Andrioli, L. P., Vasisht, V., Theodosopoulou, E., Oberstein, A.
and Small, S. (2002). Anterior repression of a Drosophila
stripe enhancer requires three position-specific mechanisms.
Development 129,4931
-4940.
Brent, A. E., Schweitzer, R. and Tabin, C. J.
(2003). A somitic compartment of tendon progenitors.
Cell 113,235
-248.[CrossRef][Medline]
Copf, T., Rabet, N., Celniker, E. and Averof, M.
(2003). Posterior patterning genes and the identification of the
unique body region in the brine shrimp Artemia franciscana.Development 130,5915
-5927.
Copf, T., Schroder, R. and Averof, M. (2004).
Ancestral role of caudal genes in axis elongation and segmentation.
Proc. Natl. Acad. Sci. USA
101,17711
-17715.
Davis, G. K. and Patel, N. H. (2002). Short,
long, and beyond: molecular and embryological approaches to insect
segmentation. Annu. Rev. Entomol.
47,669
-699.[CrossRef][Medline]
Dearden, P. and Akam, M. (1999). Developmental
evolution: axial patterning in insects. Curr. Biol.
9,R591
-R594.[CrossRef][Medline]
Dearolf, C. R., Topol, J. and Parker, C. S.
(1989). The caudal gene product is a direct activator of
fushi tarazu transcription during Drosophila embryogenesis.
Nature 341,340
-342.[CrossRef][Medline]
Dubnau, J. and Struhl, G. (1996). RNA
recognition and translational regulation by a homeodomain protein.
Nature 379,694
-699.[CrossRef][Medline]
Grbic, M. (2003). Polyembryony in parasitic
wasps: evolution of a novel mode of development. Int. J. Dev.
Biol. 47,633
-642.[Medline]
Hader, T., La Rosee, A., Ziebold, U., Busch, M., Taubert, H.,
Jackle, H. and Rivera-Pomar, R. (1998). Activation of
posterior pair-rule stripe expression in response to maternal caudal
and zygotic knirps activities. Mech. Dev.
71,177
-186.[CrossRef][Medline]
Hoch, M., Seifert, E. and Jackle, H. (1991).
Gene expression mediated by cisacting sequences of the Kruppel gene in
response to the Drosophila morphogens bicoid and hunchback. EMBO
J. 10,2267
-2278.[Medline]
Hunter, C. P. and Kenyon, C. (1996). Spatial
and temporal controls target pal-1 blastomere specification activity
to a single blastomere lineage in C. elegans embryos.
Cell 87,217
-226.[CrossRef][Medline]
Lall, S. and Patel, N. H. (2001). Conservation
and divergence in molecular mechanisms of axis formation. Annu.
Rev. Genet. 35,407
-437.[CrossRef][Medline]
La Rosee, A., Hader, T., Taubert, H., Rivera-Pomar, R. and
Jackle, H. (1997). Mechanism and Bicoid-dependent control of
hairy stripe 7 expression in the posterior region of the Drosophila
embryo. EMBO J. 16,4403
-4411.[CrossRef][Medline]
Liu, P. Z. and Kaufman, T. C. (2005). Short and
long germ segmentation: unanswered questions in the evolution of a
developmental mode. Evol. Dev.
7, 629-646.[CrossRef][Medline]
Lynch, J. A. and Desplan, C. (2003).
`De-evolution' of Drosophila toward a more generic mode of axis
patterning. Int. J. Dev. Biol.
47,497
-503.[Medline]
Lynch, J. A. and Desplan, C. (2006). A method
for parental RNA interference in the wasp Nasonia vitripennis. Nat.
Protocols 1,486
-494.[CrossRef]
Lynch, J. A., Brent, A. E., Leaf, D. S., Pultz, M. A. and
Desplan, C. (2006a). Localized maternal
orthodenticle patterns anterior and posterior in long germ wasp
Nasonia. Nature 439,728
-732.[CrossRef][Medline]
Lynch, J. A., Olesnicky, E. C. and Desplan, C.
(2006b). Regulation and function of tailless in the long
germ wasp Nasonia vitripennis. Dev. Genes Evol.
216,493
-498.[CrossRef][Medline]
Macdonald, P. M. and Struhl, G. (1986). A
molecular gradient in early Drosophila embryos and its role in
specifying the body pattern. Nature
324,537
-545.[CrossRef][Medline]
Mlodzik, M. and Gehring, W. J. (1987a).
Expression of the caudal gene in the germ line of
Drosophila: formation of an RNA and protein gradient during early
embryogenesis. Cell 48,465
-478.[CrossRef][Medline]
Mlodzik, M. and Gehring, W. J. (1987b).
Hierarchy of the genetic interactions that specify the anteroposterior
segmentation pattern of the Drosophila embryo as monitored by
caudal protein expression. Development
101,421
-435.[Abstract]
Mlodzik, M., Gibson, G. and Gehring, W. J.
(1990). Effects of ectopic expression of caudal during
Drosophila development. Development
109,271
-277.[Abstract]
Moreno, E. and Morata, G. (1999). Caudal is the
Hox gene that specifies the most posterior Drosophila segment.
Nature 400,873
-877.[CrossRef][Medline]
Neissing, D., Dostatni, N., Jackle, H. and Rivera-Pomas, R.
(1999). Sequence interval within the PEST motif of Bicoid is
important for translational repression of caudal mRNA in the anterior
region of the Drosophila embryo. EMBO J.
18,1966
-1973.[CrossRef][Medline]
Neissing, D., Blanke, S. and Jackle, H. (2002).
Bicoid associates with the 5'-capbound complex of caudal mRNA
and represses translation. Genes Dev.
16,2576
-2582.
Pultz, M. A. and Leaf, D. S. (2003). The jewel
wasp Nasonia: querying the genome with haplo-diploid genetics.
Genesis 35,185
-191.[CrossRef][Medline]
Pultz, M. A., Pitt, J. N. and Alto, N. M.
(1999). Extensive zygotic control of the anteroposterior axis in
the wasp Nasonia vitripennis. Development
126,701
-710.[Abstract]
Pultz, M. A., Zimmerman, K. K., Alto, N. M., Kaeberlein, M.,
Lange, S. K., Pitt, J. N., Reeves, N. L. and Zehrung, D. L.
(2000). A genetic screen for zygotic embryonic lethal mutations
affecting cuticular morphology in the wasp Nasonia vitripennis.Genetics 154,1213
-1229.
Pultz, M. A., Westendorf, L., Gale, S. D., Hawkins, K., Lynch,
J., Pitt, J. N., Reeves, N. L., Yao, J. C., Small, S., Desplan, C. et al.
(2005). A major role for zygotic hunchback in patterning
the Nasonia embryo. Development
132,3705
-3715.
Rabet, N., Gibert, J. M., Queinnec, E., Deutsch, J. S. and
Mouchel-Vielh, E. (2001). The caudal gene of the
barnacle Sacculina carcini is not expressed in its vestigial abdomen.
Dev. Genes Evol. 211,172
-178.[CrossRef][Medline]
Rivera-Pomar, R., Lu, X., Perrimon, N., Taubert, H. and Jackle,
H. (1995). Activation of posterior gap gene expression in the
Drosophila blastoderm. Nature
376,253
-256.[CrossRef][Medline]
Rivera-Pomar, R., Niessing, D., Schmidt-Ott, U., Gehring, W. J.
and Jackle, H. (1996). RNA binding and translational
suppression by bicoid. Nature
379,746
-749.[CrossRef][Medline]
Schroeder, M. D., Pearce, M., Fak, J., Fan, H., Unnerstall, U.,
Emberly, E., Rajewsky, N., Siggia, E. D. and Gaul, U. (2004).
Transcriptional control in the segmentation gene network of Drosophila.PLOS Biol
. 2,E271
.[CrossRef][Medline]
Schulz, C. and Tautz, D. (1995). Zygotic
caudal regulation by hunchback and its role in abdominal
segment formation of the Drosophila embryo.
Development 121,1023
-1028.[Abstract]
Schulz, C., Schroder, R., Hausdorf, B., Wolff, C. and Tautz,
D. (1998). A caudal homologue in the short germ band
beetle Tribolium shows similarities to both, the Drosophila
and the vertebrate caudal expression patterns. Dev. Genes
Evol. 208,283
-289.[CrossRef][Medline]
Shinmyo, Y., Mito, T., Matsushita, T., Sarashina, I., Miyawaki,
K., Ohuchi, H. and Sumihare, N. (2005). caudal is
required for gnathal and thoracic patterning and for posterior elongation in
the intermediate-germband cricket Gryllus bimaculatus. Mech.
Dev. 122,231
-239.[CrossRef][Medline]
Stauber, M., Jackle, H. and Schmidt-Ott, U.
(1999). The anterior determinant bicoid of Drosophila is a
derived Hox class 3 gene. Proc. Natl. Acad. Sci. USA
96,3786
-3789.
Stauber, M., Taubert, H. and Schmidt-Ott, U.
(2000). Function of bicoid and hunchback homologs in the basal
cyclorrhaphan fly Megaselia (Phoridae). Proc. Natl. Acad.
Sci. USA 97,10844
-10849.
Tautz, D. (2004). Segmentation. Dev.
Cell 7,301
-312.[CrossRef][Medline]
Treisman, J., Gönczy, P., Vashishtha, M., Harris, E. and
Desplan, C. (1989). A single amino acid can determine the DNA
binding specificity of homeodomain proteins. Cell
59,553
-562.[CrossRef][Medline]
van der Zee, M., Berns, N. and Roth, S. (2005).
Distinct functions of the Tribolium zerknult genes in serosa
specification and dorsal closure. Curr. Biol.
15,624
-636.[CrossRef][Medline]
Wolff, C., Reinhard, S., Schulz, C., Tautz, D. and Klingler,
M. (1998). Regulation of the Tribolium homologues of
caudal and hunchback in Drosophila: evidence for
maternal gradient systems in a short germ embryo.
Development 125,3645
-3654.[Abstract]
Wu, L. H. and Lengyel, J. (1998). A Role of
caudal in hindgut specification and gastrulation suggests homology
between Drosophila amnioproctodeal invagination and vertebrate
blastopore. Development
125,2433
-2442.[Abstract]
Xu, X., Xu, P. and Suzuki, Y. (1994). A
maternal homeobox gene, Bombyx caudal, forms both mRNA and protein
gradients spanning anteroposterior axis during gastrulation.
Development 120,277
-285.[Abstract]
Zhurov, V., Terzin, T. and Grbic, M. (2004).
Early blastomere determines embryo proliferation and caste fate in the
polyembryonic wasp. Nature
432,764
-769.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
S. Lemke and U. Schmidt-Ott Evidence for a composite anterior determinant in the hover fly Episyrphus balteatus (Syrphidae), a cyclorrhaphan fly with an anterodorsal serosa anlage Development, January 1, 2009; 136(1): 117 - 127. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D Peel The evolution of developmental gene networks: lessons from comparative studies on holometabolous insects Phil Trans R Soc B, April 27, 2008; 363(1496): 1539 - 1547. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Brent, G. Yucel, S. Small, and C. Desplan Permissive and Instructive Anterior Patterning Rely on mRNA Localization in the Wasp Embryo Science, March 30, 2007; 315(5820): 1841 - 1843. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||