|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 28, 2006
doi: 10.1242/10.1242/dev.02574



1 Center for Molecular Neurobiology, Molecular, Cellular and Developmental
Biology Program, Department of Neuroscience, The Ohio State University, 105
Rightmire Hall, 1060 Carmack Road, Columbus, OH 43210, USA.
2 Max-Planck-Institute for Brain Research, RG Developmental Neurobiology,
Department of Neurochemistry, Deutschordenstrasse 46, D-60528 Frankfurt/M,
Germany.
Authors for correspondence (e-mail:
rohrer{at}mpih-frankfurt.mpg.de;
henion.1{at}osu.edu)
Accepted 8 August 2006
| SUMMARY |
|---|
|
|
|---|
). By contrast, generic neuronal
differentiation seems to be unaffected, as the expression of elavl3
(HuC) is not reduced in hands off sympathetic ganglia. These
results demonstrate in vivo an essential and selective function of
hand2 for the noradrenergic differentiation of sympathetic neurons,
and implicates tfap2a and gata2 as downstream effectors.
Key words: Zebrafish, Hand2, Tyrosine hydroxylase, Dopamine ß-hydroxylase, Phox2b, Gata2
| INTRODUCTION |
|---|
|
|
|---|
The development of autonomic neurons depends crucially on the presence of
bone morphogenetic proteins (BMPs), extrinsic differentiation factors that are
produced in the environment of the primordia of autonomic ganglia. In vivo
loss-of-function experiments revealed that BMPs are essential for the
generation of noradrenergic neurons of the paravertebral sympathetic chain
ganglia (Schneider et al.,
1999
) as well as for parasympathetic ciliary ganglion neurons
(Müller and Rohrer,
2002
). Conversely, additional sympathetic and parasympathetic
neurons are produced in response to local BMP overexpression
(Reissmann et al., 1996
;
Müller and Rohrer, 2002
).
The activation of BMP receptor signaling leads to the sequential expression of
Ascl1, a proneural gene expressed by sympathetic and parasympathetic
neurons, and of the paired-homeodomain transcription factors Phox2b
and Phox2a, which are expressed throughout the autonomic nervous
system. The elimination of Ascl1 produces a strong impairment of
sympathetic ganglion development, in particular in noradrenergic
differentiation (Guillemot et al.,
1993
; Hirsch et al.,
1998
). The absence of Phox2b results in the complete lack
of the autonomic nervous system, including neurons of the enteric nervous
system (Pattyn et al., 1999
).
Phox2a is expressed downstream of both Ascl1 and
Phox2b during sympathetic ganglion development
(Lo et al., 1998
;
Pattyn et al., 1997
;
Hirsch et al., 1998
), but its
physiological function in the initial stages of this lineage is unclear in
view of the recent observation that Phox2a is unable to rescue the
effect of the Phox2b knockout on sympathetic neuron development
(Coppola et al., 2005
).
One of the most interesting properties of the Phox2 transcription factors
is their ability to directly activate the transcription of
dopamine-ß-hydroxylase (Dbh) and tyrosine
hydroxylase (Th) genes
(Swanson et al., 1997
;
Yang et al., 1998
;
Zellmer et al., 1995
;
Kim et al., 1998
;
Lo et al., 1999
). Th and Dbh
control essential steps in the synthesis of noradrenaline and represent
characteristic marker genes for differentiated noradrenergic neurons. The
finding that Phox2 factors control cell type specification in autonomic
progenitors as well as their differentiation provided a mechanism to explain
noradrenergic differentiation in both the peripheral nervous system (PNS) and
the central nervous system (CNS). However, as Phox2a/b are also
expressed in non-noradrenergic neurons in both PNS and CNS
(Morin et al., 1997
;
Pattyn et al., 2000a
;
Pattyn et al., 2000b
;
Pattyn et al., 1997
), it is
evident that the action of Phox2 on the expression of noradrenergic marker
genes requires additional co-regulators that are differentially expressed or
modified between noradrenergic and non-noradrenergic neurons. Indeed, a number
of additional transcriptional regulators have been implicated in the control
of Th and Dbh in sympathetic precursor cells, including Creb
(Swanson et al., 1997
;
Adachi and Lewis, 2002
),
Ap-2
(Barallo-Gimeno et al.,
2004
; Holzschuh et al.,
2003
; Knight et al.,
2003
; O'Brien et al.,
2004
) (also known as Tfap2a), Gata2/3
(Lim et al., 2000
;
Tsarovina et al., 2004
) and
Hand2 (also known as dHand) (Howard et
al., 1999
; Howard et al.,
2000
; Xu et al.,
2003
; Rychlik et al.,
2003
).
Hand2 has been identified as a basic helix-loop-helix (bHLH)
transcription factor expressed in heart, autonomic nervous system and neural
crest derivatives (Srivastava et al.,
1995
; Firulli,
2003
). In the autonomic nervous system of chick and mouse,
Hand2 is expressed by sympathetic neurons, adrenal chromaffin cells
and enteric neurons (Firulli,
2003
; Howard and Cserjesi,
1996
; Howard et al.,
1999
). During development, Hand2 expression is induced by
BMPs but is first observed after the onset of Ascl1 and
Phox2b expression in chick sympathetic ganglion priomordia
(Howard et al., 2000
). This
finding, together with the lack of Hand2 expression in the
Phox2b knockout and the maintained expression in the Gata3
knockout (Tsarovina et al.,
2004
), implicates a function of Hand2 downstream of
Phox2b and upstream of Gata2/3 in the group of BMP-induced
transcription factors. Hand2 overexpression was found to induce the
generation of catecholaminergic neurons from neural crest precursor cells in
vitro and in vivo (Howard et al.,
1999
; Howard et al.,
2000
), acting in concert with Phox2b, Phox2a and
Ascl1, which are ectopically expressed after Hand2
overexpression. Also upon forced Phox2a expression, Ascl1
and Phox2b are induced, suggesting cross-regulation between these
transcription factors, which are thus considered a network rather than a
regulatory cascade (Stanke et al.,
1999
; Stanke et al.,
2004
). This cross-regulatory action prohibits firm conclusions
from being drawn on the epistatic relationships between these transcription
factors, based on overexpression experiments. Nor is it possible to address
the individual functions of the factors in sympathetic neuron differentiation,
i.e. whether Hand2 may control specific aspects of the sympathetic
neuron subtype, such as Th and Dbh expression.
A function of Hand2 in the control of Dbh expression has been
suggested by the finding that Hand2 cooperates with Phox2a in activating
transcription from Dbh promotor reporter constructs
(Xu et al., 2003
;
Rychlik et al., 2003
;
McFadden et al., 2002
;
Howard, 2005
;
Firulli, 2003
). There is also
in vivo evidence implicating a role for Hand2 in the maintenance of
Th and Dbh expression in autonomic neurons
(Müller and Rohrer,
2002
). Developing chick ciliary neurons, by contrast to
sympathetic neurons, express Th and Dbh only transiently. As
Hand2 is not expressed by the vast majority of ciliary neuron
precursors (Müller and Rohrer,
2002
; Lee et al.,
2005
), and ectopic Hand2 expression maintains the
noradrenergic phenotype of ciliary neurons, Hand2 may be required for the
continued expression of noradrenergic properties
(Müller and Rohrer,
2002
).
So far, the proposed effects of Hand2 on sympathetic neuron
development could not be analysed by in vivo loss-of-function approaches.
Hand2-/- mouse embryos die too early to be analysed for
sympathetic ganglion development
(Yamagishi et al., 1999
). We
have now studied the hand2-/- zebrafish mutant hands
off (Yelon et al., 2000
),
as embryos in this species survive for a sufficient number of days to analyse
noradrenergic differentiation in cervical sympathetic ganglia (CSG) and the
CNS. We observed a strong decrease in the expression of th, dbh,
gata2 and tfap2a, with no effect on phox2b- and
zash1a-expressing sympathetic precursor cells. As the zash1a
gene encodes a protein very similar to the mammalian achaete scute homolog
Mash-1 (Allende and Weinberg,
1994
), we refer to zash1a as ascl1.
Interestingly, the expression of the early neuronal marker elavl3
(also known as HuC) (Kim et al.,
1996
) was not affected in hands off embryos. Together,
these results demonstrate for the first time an essential and selective
function for hand2 in the expression of noradrenergic marker genes
dbh and th in the autonomic nervous system. The similar
selective effect on noradrenergic but not generic neuronal differentiation in
hand2 and tfap2a zebrafish mutants
(Holzschuh et al., 2003
),
together with the reduced tfap2a expression in the hands off
mutant, implies that tfap2a is a downstream effector of
hand2 in sympathetic neurons.
The development of central noradrenergic neurons of the locus coeruleus is initated by a similar sequence of inducing signals, i.e. BMP-dependent ascl1 and phox2a/2b expression. The absence of effects on th and dbh expression in the locus coeruleus of hands off embryos confirms previous conclusions that after common initial development later steps of noradrenergic maturation are controlled differentially in the PNS and CNS.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Whole-mount RNA in situ hybridization
Analysis of mRNA expression for hand2
(Yelon et al., 2000
), dbh,
tfap2a (Holzschuh et al.,
2003
), th (T. Look, Dana Farber Cancer Institute),
phox2a (S. Guo, USCF, San Francisco), phox2b (full-length
construct by Jochen Holzschuh, University of Freiburg, Germany, unpublished),
zash-1a (T. Look, Dana Farber Cancer Institute), gata2 (T.
Look, Dana Farber Cancer Institute) and elavl3 (HuC)
(Kim et al., 1996
) was
performed in whole-mount preparations according to Thisse et al.
(Thisse et al., 1993
), with
minor modifications. A detailed protocol will be provided upon request.
Embryo dissection and planimetric analysis
After in situ hybridization, the stained embryos were transferred to 100%
glycerol. After equilibration for at least 2 hours, the yolk and the tail were
removed and used for genotyping. To take pictures at the microscope, the
neural tube and parts of the head overlying the cervical sympathetic ganglion
(CSG) were removed. In addition, the dorsal part of the somites (about
one-third) was removed, using feather scalpels. In embryos stained for
ascl1 the gut was also removed. Pictures were taken with a Zeiss
Axiophot 2 with a SPOT digital camera. Of each specifically stained cell
cluster in the CSG, one representative focal plane was imaged at 20x
magnification. The image was processed and analysed using Metamorph 6.0
Software (Visitron). For planimetric analysis of the pictures, the area to be
measured was manually thresholded. The size of CSG was determined as stained
areas in µm2, combining area measurements of all cell groups
that belong to the ganglion. This morphometric method has been used before to
study sympathetic ganglion development on sections of chick embryos (e.g.
Schneider et al., 1999
;
Howard et al., 2000
;
Tsarovina et al., 2004
). The
variation between repeated quantitation of the same ganglion is below 10%.
Student's t-tests were performed with at least six (6-29) embryos for
2, 3 or 4 dpf embryos and each in situ probe, respectively. As the area
measurements from these whole-mount in situ hybridizations depend crucially on
probe- and stage-specific parameters affecting penetration, background and
staining intensity, they represent relative rather than absolute values. Thus,
the data have been normalized for each age and gene analysed, comparing the
data of hands off mutants to data obtained with the same probe in
control wild-type or heterozygous animals.
Genotyping of hands off zebrafish
Embryos were genotyped by PCR after Proteinase K digest of the yolk, tail
and parts of the removed CNS for 10 hours at 55°C. The primers used were
fgf14-exon1-F (ACATGGCAGCGGCGATTGCC), fgf14-exon1-R
(AGCCCAACGCCACAAGTCCC), which gave a band of 324 bp, and hand2-UTR-F
(AATTTCCCACTACGGACATTGGA) and hand2-UTR-R
(AGAGACAGAAATAGATAATGAACGT), which gave a band of 225 bp. PCR conditions were
as follows: 94°C for 5 minutes, 40 x 94°C for 30 seconds,
56°C for 30 seconds, 72°C for 1 minute and 72°C for 5 minutes. We
could not distinguish between wild-type and heterozygous fishes.
|
| RESULTS |
|---|
|
|
|---|
Whole-mount in situ hybridization for dbh demonstrates the early
generation of cervical sympathetic ganglia (CSG)
(Fig. 1A,B, arrowheads) in
wild-type embryos (Guo et al.,
1999
; Holzschuh et al.,
2001
; An et al.,
2002
) and a massive reduction of dbh-expressing cells in
hands off mutant embryos (Fig.
1C,D, arrowheads). By contrast, the dbh-expressing cells
of the medulla oblongata/area postrema
(Holzschuh et al., 2001
;
Holzschuh et al., 2003
) are
not affected (asterisks). To be able to analyse CSG development in wild-type
and hands off mutant embryos in more detail, yolk sac and dorsal
neural tube were dissected after in situ hybridization. Sympathetic ganglia
were viewed and quantified morphometrically from dorsal, combining area
measurements of all cell groups that belong to the ganglion (Figs
2,
3,
4,
5 and
6; see Fig. S1 in the
supplementary material).
In normal wild-type embryos, hand2, th and dbh are expressed in the CSG by 2 dpf (Fig. 2), as shown by in situ hybridization analysis. CSG are located ventrally to the notochord between somites 1 and 4 in somewhat variable arrangements. Whereas at 2 dpf several smaller cell aggregates are present (Fig. 2A-C; see Fig. S1 in the supplementary material for a higher magnification image), larger cell groups are commonly found in 3 dpf embryos (Fig. 2G-I). In addition, single cells or small cell groups were detected more caudally up to somite 6. The differentiation of sympathetic precursors at somites 3 to 4 seems to precede the onset of differentiation of more rostral cell groups, as individual embryos with preferential th/dbh expression in the caudal group were observed, whereas embryos with normal rostral expression always displayed expression in the caudal group. hand2, by contrast to th and dbh, was also expressed in enteric neurons that are located ventrolaterally and posteriorly to sympathetic ganglia. These cells seem to further migrate between the second and third day of development, as their posterior and ventral location became more evident in 3 dpf embryos (Fig. 2A,G). Enteric neurons formed a continuum of cells throughout the length of the gut (see Fig. S2 in the supplementary material) that could be clearly distinguished from the more dorsally located cells of the CSG, which were restricted to somites 1-4.
In the hands off mutant, hand2 expression was completely
absent from sympathetic ganglia (Fig.
2D,J), as well as enteric ganglia, heart, branchial arches and fin
primordia (Yelon et al., 2000
)
(data not shown). The mutant also demonstrated a very dramatic reduction in
the expression of dbh at both 2 and 3 dpf
(Fig. 2E,K). th
expression was also reduced to very low levels at 2 dpf in hands off
mutant embryos but was expressed in a slightly larger proportion of cervical
sympathetic neurons at 3 dpf (Fig.
2F,L). It was apparent that, by contrast to the complete absence
of hand2 expression, th and dbh remained detectable
in a small number of cervical sympathetic neurons. Quantification of the area
of dbh-positive cells revealed a more than 90% reduction in the
expression for both ages (Fig.
2M). th-expression was reduced at 2 and 3 dpf to <5%
and 30% of controls, respectively (Fig.
2N).
To demonstrate that the effect observed in hands off embryos is
caused by the lack of hand2, mutant embryos were injected with
hand2 mRNA. Injection of synthetic hand2 mRNA enhanced the
number of th-expressing sympathetic ganglion cells in a considerable
fraction of injected hands off mutant embryos (see Fig. S3 in the
supplementary material). Quantitative analysis revealed a highly significant
>3-fold increase in th-positive cells in rescued
hand2-/- mutants compared with uninjected mutant embryos
(Fig. 2N). Similar rescue of
dbh-expressing cells was also observed (data not shown).
hand2 injection in zebrafish embryos (n>100) did not
result in ectopic noradrenergic neurons, by contrast to previous
Hand2 overexpression in the chick embryo
(Howard et al., 2000
).
To address the question of whether noradrenergic differentiation, and
th-expression in particular, is delayed rather than prevented in the
absence of hand2, sympathetic ganglia were also analysed in 4 dpf
embryos. At 4 dpf, in addition to the CSG neurons, a group of strongly
th/dbh-positive cells that probably represent chromaffin cells
(An et al., 2002
) are observed
ventrolaterally to the caudal CSG (Fig.
3A,C arrowheads). These cells are devoid of elavl3 (HuC)
(Fig. 6)
(An et al., 2002
). In the
hands off mutant, th and dbh expression was
strongly reduced both in CSG neurons and in the chromaffin cells
(Fig. 3B,D). The total number
of th- and dbh-expressing cells was reduced to 5-10%
compared with wild-type embryos (Fig.
3E; dbh 9% of controls), demonstrating a continued
reduction of th and dbh expression in the absence of
hand2. A similar reduction was observed when dbh was
analysed specifically in the rostral CSG (up to somite 3), where chromaffin
cells are absent (dbh 23% of controls). In conclusion, these findings
demonstrate an essential function for Hand2 in noradrenergic
differentiation during sympathoadrenergic development.
|
|
|
In hands off embryos, phox2b+ and ascl1+ sympathetic precursors were unaffected and were found in their normal rostral position in 2 and 3dpf embryos. Quantification of the areas of phox2b-positive and ascl1-positive CSG cells revealed no significant difference between hand2-deficient and control embryos. Thus, the absence of hand2 has no immediate effects on the survival of phox2b+/ascl1+-sympathetic precursor cells and the level of phox2b and ascl1 expression up to 3 dpf, the latest stage that could be analysed using these markers. Taken together, these results confirm the epistatic relationship between phox2b, ascl1 and hand2, with hand2 as a downstream member in this group of transcription factors.
Expression of phox2a, gata2 and tfap2a in hands off embryos
The timing of Hand2 expression in avian sympathetic primordia,
together with the results of Hand2 overexpression experiments
suggested that Hand2 is expressed upstream of Phox2a and may
control Phox2a expression (Howard
et al., 2000
). We have now observed that phox2a
expression was not affected in hands off mutant embryos up to 3 dpf
(Fig. 5A,D,G,J,M).
phox2a expression was, however, reduced to 34±6% of wild-type
controls in 4 dpf embryos (mean±s.e.m.; P<0.007;
n=37) (data not shown). These results demonstrate that hand2
is not required for the initiation of phox2a expression. The decrease
at 4 dpf may be explained by a loss of ganglion cells and/or a decreased
phox2a expression. The presence of wild-type numbers of
elavl3-expressing CSG neurons at 4 dpf (see below) supports the
latter possibility.
The Zn-finger transcription factors Gata2 and Gata3 are essential for
sympathetic neuron development in chick and mouse, respectively, and belong to
the BMP-controlled network of transcription factors in sympathetic precursors
(Lim et al., 2000
;
Tsarovina et al., 2004
).
Gata2 expression in chick sympathetic ganglia is detectable after the
onset of Hand2 expression, suggesting a function downstream of
Hand2. The continued expression of Hand2 in sympathetic
precursor cells of Gata3-knockout mice is in agreement with the
notion that Gata2/3 are acting downstream of Hand2
(Tsarovina et al., 2004
). This
is now confirmed by the massive reduction of gata2 expression in the
hands off mutant (Fig.
5B,E,H,K,N). Whereas at 3 dpf the reduction of gata2
expression was virtually complete (about 7% of control;
Fig. 5K,N), some
gata2-expressing cells were detectable in the rostral part of the CSG
at earlier stages (Fig.
5E,N).
The Ap-2
transcription factor has been implicated in the control of
noradrenergic differentiation, because it binds to the Th and
Dbh promotor and stimulates transcription from Th- and
Dbh-reporter constructs. In addition, the analysis of the zebrafish
mutation mont blanc/tfap2a provided in vivo evidence for a function
of tfap2a in noradrenergic differentiation
(Holzschuh et al., 2003
;
O'Brien et al., 2004
).
However, it was unclear at which point tfap2a interacts with members
of the BMP-induced genetic cascade. The strong reduction in tfap2a
expression in hands off embryos
(Fig. 5C,F,I,L,O) demonstrates
a direct or indirect regulation by hand2. Therefore, Ap-2
seems to act, together with Gata2/3, downstream of hand2 in the
control of noradrenergic development.
|
Hand2 is not required for central noradrenergic neurons
The essential role of Hand2 in the control of noradrenergic
differentiation in sympathetic neurons raised the question of whether
Hand2 would also be required for the generation of central
noradrenergic neurons. Although in previous expression studies Hand2
expression was not detected in the locus coeruleus
(Goridis and Rohrer, 2002
),
the possibility remained that Hand2 levels below the detection level
of the in situ hybridization technique might be sufficient to maintain
noradrenergic differentiation. The present study, showing that th and
dbh expression in the locus coeruleus is unchanged and develops to
normal size in hand2-deficient zebrafish
(Fig. 7), excludes this
possibility. These results indicate that the molecular control of
noradrenergic differentiation differs between the PNS and the CNS, although
the initial set of regulatory factors is identical, i.e. BMPs as extrinsic
signals and Ascl1/Phox2 as downstream transcription factors.
| DISCUSSION |
|---|
|
|
|---|
may mediate, at least in
part, the effects of Hand2 on noradrenergic differentiation.
|
|
Hand2 has been considered an important member of the transcriptional
network controlling sympathetic neuron development due to its ability to
induce the generation of noradrenergic/catecholaminergic neurons in
gain-of-function experiments (Howard et
al., 1999
; Howard et al.,
2000
). Overexpression is an important tool to identify candidate
target genes, but in the sympathetic lineage different effects were observed
upon transcription factor overexpression compared with in vivo
loss-of-function approaches. Gata2/3, for instance, is essential for
Th expression during normal development of sympathetic neurons but
has virtually no effect on Th expression in overexpression
experiments (Tsarovina et al.,
2004
). A further complication is the induction of upstream genes
by the forced ectopic expression of transcription factors
(Stanke et al., 1999
;
Stanke et al., 2004
). Thus, it
is essential to confirm the functions of candidate target genes identified
from overexpression experiments using loss-of-function approaches.
The role of Hand transcription factors in the development of
catecholaminergic cells has been addressed in quail neural crest cultures,
using antisense oligonucleotides directed against Hand2 and
Hand1 (Howard et al.,
1999
). Inhibitory effects were observed only with the combined
interference of both Hand1 and Hand2. As Hand2, but
not Hand1, seems to be involved in sympathetic neuron generation in
vivo (Howard et al., 2000
), it
was unclear to what extent the neural crest cultures reflect the in vivo
situation. To address the physiological function of Hand2 during in
vivo development of sympathetic ganglia, Hand2-deficient mice were
not informative due to the early death of mouse embryos between embryonic day
9.5 and 10.5, caused by impaired heart development
(Yamagishi et al., 1999
).
Zebrafish mutations in the hands off locus display similar
malformations as observed for Hand2-/- mouse embryos
(Yelon et al., 2000
;
Yamagishi et al., 1999
). The
dramatic reduction in ventricular precursors is even more severe in hands
off zebrafish than that observed in Hand2 knockout mice,
possibly because of the lack of compensatory activity of a second
Hand gene in this organism. However, by contrast to the mouse, the
zebrafish embryos survive sufficiently long to permit the analysis of the
development of cervical sympathetic ganglia, which differentiate several days
before trunk sympathetic neurons (An et
al., 2002
). Cervical sympathetic neurons are detected in 2 dpf
embryos by the expression of phox2b, phox2a, ascl1, hand2, gata2, tfap2a,
th, dbh and elavl3 (HuC) between somites 1 to 4. The
location of cells varies from individual to individual but generally becomes
organized in two major cell groups with increasing age.
The massive loss of th and dbh expression in cervical
sympathetic ganglia of hands off zebrafish embryos demonstrates an
essential role for hand2 in sympathetic neuron development.
hand2 is essential for th/dbh expression, not only in
sympathetic ganglia but also in cells with the characteristics of chromaffin
cells that become apparent in 4 dpf embryos
(An et al., 2002
). As the
number of ascl1-, phox2b- and phox2a-expressing sympathetic
precursor cells is initially not affected, a function of Hand2 in the control
of th and dbh expression is the most probable mechanism of
action, and indirect effects on cell migration can be excluded. A direct
action is supported by the interaction and synergistic function of Phox2a and
Hand2 at the Dbh promotor (Xu et
al., 2003
; Rychlik et al.,
2003
). Although evidence for the function of Hand2 at the
Th promotor is still lacking, it is tempting to speculate that Hand2
and Phox2a act together to induce both Dbh and Th in this
lineage. However, the results on the transactivation of the Th
promotor by Phox2a are controversial [cf. Zellmer et al.
(Zellmer et al., 1995
) and
Yang et al. (Yang et al.,
1998
)] and there is also evidence for differential regulation of
Th and Dbh expression in developing sympathetic ganglia
(Tsarovina et al., 2004
).
The loss of th and dbh expression in the hands
off mutant was significantly reduced by the injection of wild-type
hand2 mRNA. This result is in line with the previously shown rescue
of the hands off myocardial phenotype
(Yelon et al., 2000
) and
confirms that the defects in the hands off
(hans6) mutant are due to a deficiency of hand2.
Overexpression of hand2 in wild-type embryos by injection of
hand2 mRNA did not notably affect the formation of sympathetic
ganglia, nor cause the generation of ectopic noradrenergic neurons. By
contrast, Hand2 overexpression in the chick embryo using
RCAS-retroviral vectors resulted in ectopic neurons in the peripheral nerve
(Howard et al., 2000
). In
avian and rodent peripheral ganglia and nerves, significant numbers of
pluripotent neural crest stem cells have been identified (e.g.
Le Lièvre et al., 1980
;
Duff et al., 1991
;
Bixby et al., 2002
) (Binder,
Tsarovina and H.R., unpublished). The lack of ectopic cells in zebrafish may
be due to differences in the timing or expression levels of hand2
mRNA or due to lower numbers/absence of neural crest stem cells in the
developing zebrafish PNS. Although it is known that some pre-migratory neural
crest cells in zebrafish are multipotent
(Raible and Eisen, 1994
), it
is not currently known whether zebrafish neural crest cells at any embryonic
stage possess stem cell properties.
We have found that the expression of gata2 and tfap2a
requires hand2 function and gata2/3 and tfap2a have
previously been shown to be essential for sympathetic neuron development
(Lim et al., 2000
;
Tsarovina et al., 2004
;
Holzschuh et al., 2003
). The
mechanism of action for Gata2/3 is unclear, although a context-dependent
function has been suggested based on the different effects of gain- and
loss-of-function approaches (Tsarovina et
al., 2004
). By contrast, specific AP-2
-binding sites have
been identified in the upstream regions of Dbh and Th genes
in different species (Greco et al.,
1995
; Kim et al.,
1998
; Kim et al.,
2001
). Ap-2
transactivates Th and Dbh
promotor activities in non-catecholaminergic cells
(Kim et al., 2001
). The
genetic link between hand2 and tfap2a revealed in the
hands off mutant, together with the similar sympathetic neuron
phenotype of hands off and mont blanc mutants
(Holzschuh et al., 2003
),
suggests the possibility that Ap-2
functions downstream of
hand2 and may, at least in part, mediate hand2 effects on
th and dbh expression.
The analysis of the hands off mutant confirmed the proposed epigenetic relationship between hand2 and gata2 but not for hand2 and phox2a. Our data suggest that the initial phox2a expression is not controlled by hand2. The previously suggested scheme with hand2 upstream of phox2a was essentially based on the difference between the onset of expression of these genes, deduced from in situ hybridization analysis. The discrepant conclusions can be explained by a comparatively low sensitivity of the phox2a in situ hybridization probe, preventing the detection of phox2a expression at early developmental stages. The decreased phox2a expression in 4 dpf hands off embryos may reflect a hand2 requirement for continued phox2a expression or a decrease in cell numbers. To address the question of whether sympathetic neuron number was reduced in 4 dpf mutant embryos, the expression of the generic neuronal marker elav3l (HuC) was studied.
The question of to what extent generic neuronal markers would be affected
in the hands off mutant was also of interest, as Hand2 overexpression
in chick neural crest cells results in the expression of both noradrenergic
and generic neuronal genes (Howard et al.,
2000
). The analysis of the hands off mutants revealed
that neuronal differentiation, i.e. elavl3 expression, was not
impaired up to 4 dpf. The reason for the transiently increased area of
elavl3-expressing cells in 3 dpf hands off embryos is
unclear but may be due to effects of hand2 on the timing of neuronal
differentiation or a transient inhibitory effect. By contrast to the
maintenance or even increase of generic neuronal differentiation in hands
off embryos, th and dbh expression is strongly reduced
already at 2 dpf in the absence of hand2. This selective loss of
noradrenergic properties is very similar to the phenotype of the
tfap2a zebrafish mutation mont blanc in the CSG
(Holzschuh et al., 2003
). It
supports the notion that hand2, acting through tfap2a, may
selectively control the expression of subtype-specific noradrenergic genes in
the sympathoadrenal lineage.
To what extent is the function of Hand2 maintained in other lineages of the
nervous system? hand2 is expressed in neurons of all parts of the
peripheral autonomic nervous system, in cells of the sympathoadrenal lineage,
i.e. sympathetic neurons and adrenal chromaffin cells, parasympathetic ganglia
(Dai et al., 2004
) (F.M. and
H.R., unpublished) and enteric neurons (Wu
and Howard, 2002
; Dai et al.,
2004
). As there is a variable extent of noradrenergic
differentiation in parasympathetic ganglia during development, Hand2
expression and Th/Dbh expression may also correlate in
parasympathetic ganglia, as observed for the chick sphenopalatine ganglion
(Tsarovina et al., 2004
) (F.M.
and H.R., unpublished). Whether Hand2 is involved in the expression
of (transient) adrenergic properties of rodent enteric neurons
(Howard and Cserjesi, 1996
;
Wu and Howard, 2002
) is
presently unclear. This question could not be addressed in the present study
because we did not detect th and dbh expression in
phox2b+/phox2a+/hand2+ zebrafish
enteric neurons. The th/dbh expressing group of cells in close
vicinity of the CSG are considered to be chromaffin cells rather than enteric
neurons (An et al., 2002
;
Holzschuh et al., 2001
). It
will be interesting to address the role of hand2 in the enteric
nervous system using the hands off mutant in future studies.
Central noradrenergic neurons of the locus coeruleus have been shown to
depend on similar inducers to those in the PNS. The development of locus
coeruleus neurons is dependent on the transcription factors Ascl1,
Phox2a and Phox2b (Morin et
al., 1997
; Hirsch et al.,
1998
; Pattyn et al.,
2000b
). The normal development of the locus coeruleus in hands
off mutants now demonstrates that downstream of phox2b
noradrenergic differentiation is differentially regulated in PNS and CNS. This
has also been shown for Gata2/3, which is required in the PNS but not
in the locus coeruleus for Th and Dbh expression
(Tsarovina et al., 2004
).
Besides the nervous system, Hand2 is involved in the development
of heart, branchial arches and limbs
(Srivastava, 1999
;
Firulli, 2003
). Although only
a limited number of target genes are known so far, it is of interest that in
several cases a maintenance function has been proposed. In hands off
mutant embryos, the T-box transcription factor tbx5 is initiated in
the developing heart and fins, but its expression is not maintained
(Yelon et al., 2000
). Another
putative Hand downstream target in the heart is Irx4, which
is initiated in Hand2-deficient mice but not maintained during
development (Bruneau et al.,
2000
). In sympathetic neurons, a maintenance function of
hand2 is now suggested for gata2 and phox2a, as
their expression is more strongly affected with increasing age of the embryos.
Also the presence of a small number of th/dbh-positive cells in
hands off mutants may indicate that noradrenergic differentiation is
initiated in newly born neurons but not maintained in the absence of
hand2. An alternative possibility would be that hand2 is
expressed and/or required for th/dbh expression in most but not all
CSG cells. However, a definitive decision between an induction or/and
maintenance function would require a conditional knockout of hand2 in
differentiated sympathetic neurons.
A further common finding is that the function of Hand2 does not require DNA
binding, i.e. Hand2 participates in a transcriptional complex, where the
interaction with the promotor is mediated by the binding partner(s) of Hand2
rather than by Hand2 itself (McFadden et
al., 2002
; Xu et al.,
2003
; Rychlik et al.,
2003
). It is not clear whether the co-activation function of Hand2
is linked to the maintenance role, but it is tempting to speculate along this
line. An additional characteristic observed in several lineages is the
interaction of Hand2 with members of the Gata family of Zn-finger
transcription factors. In the heart there is evidence suggesting a common
action of Hand2 and Gata4 in the transcriptional control of a number of
cardiac specific marker genes (Dai et al.,
2002
).
In conclusion, we demonstrate that hand2 is essential for the
expression of noradrenergic marker genes th and dbh in
zebrafish cervical sympathetic ganglia. The dramatic loss of dbh and
th expression at early developmental stages is compatible with the
notion, derived from previous work in the chick
(Howard et al., 1999
;
Howard et al., 2000
;
Müller and Rohrer, 2002
),
that hand2 is involved in the induction and/or maintenance of
noradrenergic characteristics. The effect of the hand2 loss of
function on subtype-specific rather than generic neuronal genes correlates
with the phenotype of the tfap2a mutant
(Holzschuh et al., 2003
) and
implicates Hand2 and Tfap2a (Ap-2
) as selective regulators of the
noradrenergic sympathetic neuronal phenotype.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/20/4015/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Institute for Physiological Chemistry,
Martin-Luther-University, Hollystrasse 1, D-06097 Halle, Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Adachi, M. and Lewis, E. J. (2002). The paired-like homeodomain protein, arix, mediates protein kinase A-stimulated dopamine b-hydroxylase gene transcription through its phosphorylation status. J. Biol. Chem. 277, 22915-22924.
Alexander, J., Stainier, D. Y. and Yelon, D. (1998). Sreening mosaic F1 females for mutations affecting zebrafish heart induction and patterning. Dev. Genet. 22,288 -299.[CrossRef][Medline]
Allende, M. L. and Weinberg, E. S. (1994). The expression pattern of two zebrafish achaete-scute Homolog (ash) genes is altered in the embryonic brain of the cyclops mutant. Dev. Biol. 166,509 -530.[CrossRef][Medline]
An, M., Luo, R. and Henion, P. D. (2002). Differentiation and maturation of zebrafish dorsal root and sympathetic ganglion neurons. J. Comp. Neurol. 446,267 -275.[CrossRef][Medline]
Barallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Bixby, S., Kruger, G. M., Mosher, J. T., Joseph, N. M. and Morrison, S. J. (2002). Cell-intrinsic differences between stem cells from different regions of the peripheral nervous system regulate the generation of neural diversity. Neuron 35,643 -656.[CrossRef][Medline]
Bruneau, B. G., Bao, Z.-Z., Tanaka, M., Schott, J.-J., Izumo, S., Cepko, C. L., Seidman, J. G. and Seidman, C. E. (2000). Cardiac expression of the ventricle-specific homeobox gene Irx4 is modulated by Nkx2-5 and dHand. Dev. Biol. 217,266 -277.[CrossRef][Medline]
Coppola, E., Pattyn, A., Guthrie, S. C., Goridis, C. and Studer, M. (2005). Reciprocal gene replacements reveal unique functions for Phox2 paralogous homeobox genes during neural differentiation. EMBO J. 24,4392 -4403.[CrossRef][Medline]
Dai, Y. S., Cserjesi, P., Markham, B. E. and Molkentin, J.
D. (2002). The transcription factors GATA4 and dHAND
physically interact to synergistically activate cardiac gene expression
through a p300-dependent mechanism. J. Biol. Chem.
277,24390
-24398.
Dai, Y.-S., Hao, J., Bonin, C., Morikawa, Y. and Cserjesi, P. (2004). JAB1 enhances HAND2 transcriptional activity by regulating HAND2 DNA binding. J. Neurosci. Res. 76,613 -622.[CrossRef][Medline]
Duff, R. S., Langtimm, C. J., Richardson, M. K. and Sieber-Blum, M. (1991). In vitro clonal analysis of progenitor cell patterns in dorsal root and sympathetic ganglia of the quail. Dev. Biol. 147,451 -459.[CrossRef][Medline]
Firulli, A. B. (2003). A HANDful of questions: the molecular biology of the heart and neural crest derivatives (HAND)-subclass of basic helix-loop-helix transcription factors. Gene 312,27 -40.[CrossRef][Medline]
Goridis, C. and Rohrer, H. (2002). Specification of catecholaminergic and serotonergic neurons. Nat. Rev. Neurosci. 3,531 -541.[CrossRef][Medline]
Greco, D., Zellmer, E., Zhang, Z. and Lewis, E. (1995). Transcription factor AP-2 regulates expression of the dopamine beta-hydoxylase gene. J. Neurochem. 65,510 -516.[Medline]
Guillemot, F., Lo, L.-C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75,463 -476.[CrossRef][Medline]
Guo, S., Wilson, S. W., Cooke, S., Chitnis, A. B., Driever, W. and Rosenthal, A. (1999). Mutations in the zebrafish unmask shared regulatory pathways controlling the development of catecholaminergic neurons. Dev. Biol. 208,473 -487.[CrossRef][Medline]
Hirsch, M. R., Tiveron, M. C., Guillemot, F., Brunet, J. F. and Goridis, C. (1998). Control of noradrenergic differentiation and Phox2a expression by MASH1 in the central and peripheral nervous system. Development 125,599 -608.[Abstract]
Holzschuh, J., Ryu, S., Aberger, F. and Driever, W. (2001). Dopamine transporter expression distinguishes dopaminergic neurons from other catecholaminergic neurons in the developing zebrafish embryo. Mech. Dev. 101,237 -243.[CrossRef][Medline]
Holzschuh, J., Barrallo-Gimeno, A., Ettl, A. K., Durr, K.,
Knapik, E. W. and Driever, W. (2003). Noradrenergic neurons
in zebrafish hindbrain are induced by retinoic acid and require tfap2a for
expression of the neurotransmitter phenotype.
Development 130,5741
-5754.
Howard, M. J. (2005). Mechanisms and perspectives on differentiation of autonomic neurons. Dev. Biol. 277,271 -286.[CrossRef][Medline]
Howard, M. J. and Cserjesi, P. (1996). Chicken eHand and dHand influence neural crest cell differentiation. Soc. Neurosci. Abstr. 22, 21.2 .
Howard, M., Foster, D. N. and Cserjesi, P. (1999). Expression of Hand gene products may be sufficient for the differentiation of avian neural crest-derived cells into catecholaminergic neurons in culture. Dev. Biol. 215, 62-77.[CrossRef][Medline]
Howard, M. J., Stanke, M., Schneider, C., Wu, X. and Rohrer, H. (2000). The transcription factor dHAND is a downstream effector of BMPs in sympathetic neuron specification. Development 127,4073 -4081.[Abstract]
Kim, C. H., Ueshima, E., Muraoka, O., Tanaka, H., Yeo, S. Y., Huh, T. L. and Mikki, N. (1996). Zebrafish elav/HuC homologue as a very early neuronal marker. Neurosci. Lett. 216,109 -112.[CrossRef][Medline]
Kim, H.-S., Seo, H., Yang, C., Brunet, J.-F. and Kim, K.-S.
(1998). Noradrenergic-specific transcription of the dopamine
b-hydroxylase gene requires synergy of multiple cis-acting elements
including at least two Phox2a-binding sites. J.
Neurosci. 18,8247
-8260.
Kim, H.-S., Hong, S. J., LeDoux, M. S. and Kim, K.-S. (2001). Regulation of the tyrosine hydroxylase and dopamine ß-hydroxylase genes by the transcription factor AP-2. J. Neurochem. 76,280 -294.[CrossRef][Medline]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y.,
Geisler, R., Rauch, G.-D. and Schilling, T. F. (2003).
lockjaw encodes a zebrafish tfap2a required for early neural
crest development. Development
130,5755
-5768.
Lee, V. M., Bronner-Fraser, M. and Baker, C. V. H. (2005). Restricted response of mesencephalic neural crest to sympathetic differentiation signals to the trunk. Dev. Biol. 278,175 -192.[CrossRef][Medline]
Le Lièvre, C. S., Schweizer, G. G., Ziller, C. M. and LeDouarin, N. M. (1980). Restrictions of developmental capabilities in neural crest cell derivatives as tested by in vivo transplantation experiments. Dev. Biol. 77,362 -378.[CrossRef][Medline]
Lim, K.-C., Lakshmanan, G., Crawford, S. E., Gu, Y., Grosveld, F. and Engel, J. D. (2000). Gata3 loss leads to embryonic lethality due to noradrenaline deficiency of the sympathetic nervous system. Nat. Genet. 25,209 -212.[CrossRef][Medline]
Lo, L. C., Tiveron, M. C. and Anderson, D. J. (1998). MASH1 activates expression of the paired homeodomain transcription factor Phox2a, and couples pan-neuronal and subtype-specific components of autonomic neuronal identity. Development 125,609 -620.[Abstract]
Lo, L. C., Morin, X., Brunet, J. F. and Anderson, D. J. (1999). Specification of neurotransmitter identity by Phox2 proteins in neural crest stem cells. Neuron 22,693 -705.[CrossRef][Medline]
McFadden, D. G., McAnally, J., Richardson, J. A.,
Charité, J. and Olson, E. N. (2002). Misexpression of
dHAND induces ectopic digits in the developing limb bud in the absence of
direct DNA binding. Development
129,3077
-3088.
Morin, X., Cremer, H., Hirsch, M. R., Kapur, R. P., Goridis, C. and Brunet, J. F. (1997). Defects in sensory and autonomic ganglia and absence of locus coeruleus in mice deficient for the homeobox gene Phox2a. Neuron 18,411 -423.[CrossRef][Medline]
Müller, F. and Rohrer, H. (2002). Molecular control of ciliary neuron development: BMPs and downstream transcriptional control in the parasympathetic lineage. Development 129,5707 -5717.[CrossRef][Medline]
O'Brien, E. K., d'Alencon, C., Bonde, G., Li, W., Schoenebeck,
J., Allende, M. L., Gelb, B. D., Yelon, D., Eisen, J. S. and Cornell, R.
A. (2004). Transcription factor Ap-2
is necessary for
development of embryonic melanophores, autonomic neurons and pharyngeal
skeleton in zebrafish. Dev. Biol.
265,246
-261.[CrossRef][Medline]
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. F. (1997). Expression and interactions of the two closely related homeobox genes Phox2a and Phox2b during neurogenesis. Development 124,4065 -4075.[Abstract]
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J.-F. (1999). The homeobox gene Phox2b is essential for the development of all autonomic derivatives of the neural crest. Nature 399,366 -370.[CrossRef][Medline]
Pattyn, A., Hirsch, M. R., Goridis, C. and Brunet, J. F. (2000a). Control of hindbrain motor neuron differentiation by the homeobox gene Phox2b. Development 127,1349 -1358.[Abstract]
Pattyn, A., Goridis, C. and Brunet, J. F. (2000b). Specification of the central noradrenergic phenotype by the homeobox gene Phox2b. Mol. Cell. Neurosci. 15,235 -243.[CrossRef][Medline]
Raible, D. W. and Eisen, J. S. (1994). Restriction of neural crest cell fate in the trunk of the embryonic zebrafish. Development 120,495 -503.[Abstract]
Reissmann, E., Ernsberger, U., Francis-West, P. H., Rueger, D., Brickell, P. M. and Rohrer, H. (1996). Involvement of bone morphogenetic proteins-4 and-7 in the specification of the adrenergic phenotype in developing sympathetic neurons. Development 122,2079 -2088.[Abstract]
Rohrer, H. (2003). The role of bone morphogenetic proteins in sympathetic neuron development. Drug News Perspect. 16,589 -596.[CrossRef][Medline]
Rychlik, J. L., Gerbasi, V. and Lewis, E. J.
(2003). The interaction between dHand and Arix at the dopamine
b-hydroxylase promotor region is independent of direct dHand binding to DNA.
J. Biol. Chem. 278,49652
-49660.
Schneider, C., Wicht, H., Enderich, J., Wegner, M. and Rohrer, H. (1999). Bone morphogenetic proteins are required in vivo for the generation of sympathetic neurons. Neuron 24,861 -870.[CrossRef][Medline]
Srivastava, D. (1999). HAND proteins: Molecular mediators of cardiac development and congenital disease. Trends Cardiovasc. Med. 9,11 -18.[CrossRef][Medline]
Srivastava, D., Cserjesi, P. and Olson, E. N.
(1995). A subclass of bHLH proteins required for cardiac
morphogenesis. Science
270,1995
-1999.
Stanke, M., Junghans, D., Geissen, M., Goridis, C., Ernsberger, U. and Rohrer, H. (1999). The Phox2 homeodomain proteins are sufficient to promote the development of sympathetic neurons. Development 126,4087 -4094.[Abstract]
Stanke, M., Stubbusch, J. and Rohrer, H. (2004). Interaction of Mash1 and Phox2b in sympathetic neuron development. Mol. Cell. Neurosci. 25,374 -382.[CrossRef][Medline]
Stewart, R. A., Look, A. T., Kanki, J. P. and Henion, P. D. (2004). Development of the peripheral sympathetic nervous system in zebrafish. Methods Cell Biol. 76,236 -258.
Swanson, D. J., Zellmer, E. and Lewis, E. J.
(1997). The homeodomain protein arix interacts synergistically
with cyclic AMP to regulate expression of neurotransmitter biosynthetic genes.
J. Biol. Chem. 272,27382
-27392.
Thisse, C., Thise, B., Schilling, T. F. and Postlethwait, J. H. (1993). Structure of the zebrafish snail 1 gene and ist expression in wild-type, spade tail, and no-tail mutant embryos. Development 119,1203 -1215.[Abstract]
Tsarovina, K., Pattyn, A., Stubbusch, J., Müller, F., Van
der Wees, J., Schneider, C., Brunet, J.-F. and Rohrer, H.
(2004). Essential role of Gata transcription factors in
sympathetic neuron development. Development
131,4775
-4786.
Wu, X. and Howard, M. J. (2002). Transcripts encoding HAND genes are differentially expressed and regulated by BMP4 and GDNF in developing avian gut. Gene Expr. 10,279 -293.[Medline]
Xu, H. M., Firulli, A. B., Zhang, X. T. and Howard, M. J. (2003). HAND2 synergistically enhances transcription of dopamine-b-hydroxylase in the presence of Phox2a. Dev. Biol. 262,183 -193.[CrossRef][Medline]
Yamagishi, H., Garg, V., Matsuoka, R., Thomas, T. and
Srivastava, D. (1999). A molecular pathway revealing a
genetic basis for human cardiac and craniofacial defects.
Science 283,1158
-1161.
Yang, C., Kim, H.-S., Seo, H. and Kim, K.-S. (1998). Identification and characterization of potential cis-regulatory elements governing transcriptional activation of the rat tyrosine hydroxylase gene. J. Neurochem. 71,1358 -1368.[Medline]
Yelon, D., Ticho, B., Halpern, M. E., Ruvinsky, I., Ho, R. K., Silver, L. M. and Stainier, D. Y. R. (2000). The bHLH transcription factor Hand2 plays parallel roles in zebrafish heart and pectoral fin development. Development 127,2573 -2582.[Abstract]
Zellmer, E., Zhang, Z., Greco, D., Rhodes, J., Cassel, S. and Lewis, E. J. (1995). A homeodomain protein selectively expressed in noradrenergic tissue regulates transcription of neurotransmitter biosynthetic genes. J. Neurosci. 15,8109 -8120.[Abstract]
This article has been cited by other articles:
![]() |
B. L. Arduini, K. M. Bosse, and P. D. Henion Genetic ablation of neural crest cell diversification Development, June 15, 2009; 136(12): 1987 - 1994. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P Hernandez and M. L Allende Zebrafish (Danio rerio) as a model for studying the genetic basis of copper toxicity, deficiency, and metabolism Am. J. Clinical Nutrition, September 1, 2008; 88(3): 835S - 839S. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Hong, T. Lardaro, M. S. Oh, Y. Huh, Y. Ding, U. J. Kang, J. Kirfel, R. Buettner, and K.-S. Kim Regulation of the Noradrenaline Neurotransmitter Phenotype by the Transcription Factor AP-2{beta} J. Biol. Chem., June 13, 2008; 283(24): 16860 - 16867. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Reiprich, C. C. Stolt, S. Schreiner, R. Parlato, and M. Wegner SoxE Proteins Are Differentially Required in Mouse Adrenal Gland Development Mol. Biol. Cell, April 1, 2008; 19(4): 1575 - 1586. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wildner, M. S. Gierl, M. Strehle, P. Pla, and C. Birchmeier Insm1 (IA-1) is a crucial component of the transcriptional network that controls differentiation of the sympatho-adrenal lineage Development, February 1, 2008; 135(3): 473 - 481. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. D'Autreaux, Y. Morikawa, P. Cserjesi, and M. D. Gershon Hand2 is necessary for terminal differentiation of enteric neurons from crest-derived precursors but not for their migration into the gut or for formation of glia Development, June 15, 2007; 134(12): 2237 - 2249. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||