|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 28, 2006
doi: 10.1242/10.1242/dev.02561


Department of Developmental and Cell Biology, and the Developmental Biology Center, University of California Irvine, Irvine, CA 92697, USA.
Authors for correspondence (e-mail:
karora{at}uci.edu;
rwarrior{at}uci.edu)
Accepted 3 August 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Schnurri, Bone Morphogenetic Protein signaling, Bmp, Smad, Transcription, Transcriptional activation, Transcriptional repression, Evolutionary conservation
| INTRODUCTION |
|---|
|
|
|---|
Drosophila Schnurri (Shn) is a large DNA-binding transcription
factor with multiple, widely separated zinc finger domains, and was one of the
first partners identified for Bmp-specific R-Smads
(Dai et al., 2000
;
Udagawa et al., 2000
). Shn
localizes to the nucleus and interacts with Mad and Med in response to Dpp
signaling. Genetic and phenotypical analysis has established that shn
is essential for Dpp signaling at many developmental stages and in diverse
tissues (Arora et al., 1995
;
Grieder et al., 1995
;
Staehling-Hampton et al.,
1995
). At the molecular level, Shn uses two modes to regulate Dpp
target genes: transcriptional activation and repression. Shn can directly
activate a small subset of Dpp-responsive genes, but exerts most of its effect
through a relief-of-repression mechanism. Shn inhibits the expression of a
transcriptional repressor Brinker (Brk) that, in turn, negatively regulates
the expression of most Dpp target genes. Therefore, Dpp signaling leads to the
inhibition of brk expression and the derepression of batteries of
Dpp-responsive genes (Affolter et al.,
2001
; Marty et al.,
2000
; Torres-Vazquez et al.,
2001
; Torres-Vazquez et al.,
2000
). Shn represses brk via the formation of a
Shn/Mad/Med complex on defined elements in the brk promoter
(Muller et al., 2003
;
Pyrowolakis et al., 2004
).
Given the prominent role of Shn in Dpp signaling, an inevitable question is
whether the conservation encountered at other levels of the pathway extends to
the cis-regulatory elements and nuclear factors that mediate the
transcriptional response to Bmps. Furthermore, brk, a primary target
of Shn activity, is absent from genomes outside the arthropods, raising the
possibility that the involvement of Shn in Bmp signaling may be unique to
insects.
Unlike brk, Shn-related genes are found in other phyla. In C.
elegans the lone Shn homolog SMA-9 has been implicated in Bmp signaling,
although its mechanism of action is unknown
(Liang et al., 2003
). Three
Shn homologs are found in vertebrates that also contain widely spaced, paired
zinc finger domains with high sequence similarity to the fly protein. Shn
proteins share additional features, including an unusually large size, overall
structural organization and the presence of acidic domains. Human members of
this family have been variously referred to as
Shn1/HIVEP1/MBP-1/PRDII-BF1/ZAS1, Shn2/HIVEP2/MBP-2/ZAS2 and
Shn3/HIVEP3/KRC/ZAS3 (Liang et al.,
2003
; Wu, 2002
).
No direct evidence ties vertebrate Shn1 or Shn3 to the Bmp pathway, but Shn2
has recently been shown to promote Bmp-responsive transcription of the
PPAR
gene in mouse embryonic fibroblasts. However, Shn2 acts through
sites that bear no resemblance to the sequences recognized by the
Drosophila Shn/Smad complex, and requires co-operativity with the
transcription factor C/EBP
(Jin et
al., 2006
). Thus, whether the mechanism of action of Shn proteins
in Bmp signaling is phylogenetically conserved remains an unanswered
question.
Here, we demonstrate an unusual and unexpected conservation of the cis- and trans-regulatory elements involved in the response to Bmp signaling. We found that an element from the Xenopus Vent2 (Xvent2) promoter that confers sensitivity to Bmp signaling in vertebrate embryos also directs a Dpp-dependent response in Drosophila. However, although the element mediates transcriptional activation in Xenopus, it directs transcriptional repression in Drosophila. We demonstrate that the closest human Shn homolog, hShn1, can mediate signaling-dependent transcriptional activation through this element in vertebrate cells, implicating it in Bmp signal transduction. Remarkably hShn1 can also mediate signaling-dependent repression in Drosophila and rescues patterning defects in shn mutant embryos, whereas fly Shn can activate transcription in Xenopus assays. This switch in transcriptional output between repression and activation is not a function of differences in the cis-regulatory elements or an inherent property of the human and Drosophila proteins, indicating that Shn/Smad complexes are likely to recruit co-activators and co-repressors in a context-dependent manner.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Rescue of shn mutants
Full-length Shn and hShn1 (Fan and
Maniatis, 1990
) were subcloned into pUAST
(Brand and Perrimon, 1993
).
shnP4738 is a null allele (Arora
et al., 1995
). Progeny from UAS-Shn/UAS-hShn1,
shnP4738/CyO flies crossed to shnP4738/CyO; HS-Gal4
were aged to 8-10 hours and received two 1-hour heat shocks at 37°C,
separated by 25°C rest periods. brk expression was monitored
using the enhancer trap X-47
(Campbell and Tomlinson, 1999
).
Whole-mount cuticles were prepared as described
(Arora et al., 1995
).
Homozygous mutants were identified by the absence of wg-lacZ or
CyO, Kr>GFP.
Xenopus reporter gene analyses
pXvent2(-150)LUC and pXvent2-5xBRE(-150)LUC have
been described previously (von Bubnoff et
al., 2005
). The oligonucleotide
5'-CGGCAGACAGGTTGGAGCCAGCTCGGCAGACAGGTTGGAGCCAGCT-3'
containing a BRE dimer (mutations underlined) was used to generate a PCR
product that was subcloned into pXvent2(-150)LUC to create
pXvent2-5xBRE(sub2)(-150)LUC.
pXvent2-6xBRE(del2)(-150)LUC was similarly created using
5'-CGGCAGAC_GGTGGAGCCAGCTCGGCAGAC_GGTGGAGCCAGCT-3 (underscores indicate
deleted bases). pXvent2-5xBRE(-150)GFP3,
pXvent2-5xBRE(sub2)(-150)GFP3 and
pXvent2-6xBRE(-150)(del2)GFP3 contain
BamHI-HindIII fragments from the respective reporter
plasmids in pCXGFP3 (a gift of Enrique Amaya, University of Manchester).
Full-length Shn and hShn1 were subcloned into pBSII-KS, containing the SV40
polyadenylation signal. Capped mRNAs were synthesized using the T3 mMessage
Machine Kit (Ambion), including 1 µl GTP/20 µl reaction, diluted into
single use `injection cocktails' containing reporter genes, stored at
-80°C and used within 24 hours.
mRNA concentrations/embryo were: luciferase reporters, 200 pg;
dominant-negative (Suzuki et al.,
1994
) and constitutively active
(Candia et al., 1997
) BmpR,
0.1-2.0 ng; and hShn1 and Shn, 2 ng. Wild-type and mutant BRE reporters were
microinjected into the animal poles of two- to four-cell stage embryos and
incubated until blastula stages 8-9. Mid-blastula stage animal caps were
dissected and homogenized for luciferase assays when sibling embryos reached
stages 10.5-11 (Watabe et al.,
1995
). In situ hybridization and generation of transient
transgenic embryos using the sperm nuclear transfer technique have been
described previously (von Bubnoff et al.,
2005
).
Biochemical assays
N-terminal FLAG-Mad and FLAG-Med, TkvA and ShnCT plasmids have been
described previously (Gao et al.,
2005
). PCR fragments 1 (hShn11-599), 2
(hShn11-702), 3 (hShn1496-1121), 4
(hShn11002-1635), 5 (hShn11496-2213), 6
(hShn11756-2544) and 7 (hShn11756-2717) were subcloned
into the pAWM vector containing an Actin5C promoter and C-terminal 6xMyc
epitopes (a gift of T. D. Murphy, Carnegie Institution, Baltimore). Extracts
from Drosophila S2 cells transfected with individual hShn1 constructs
and TkvA/Mad/Med or TkvA/hSmad1/hSmad4 were incubated with anti-FLAG antisera.
Immunoprecipitates were run on 4-12% gradient SDS polyacrylamide gels before
western blotting and visualization of interacting protein with anti-Myc. Gel
shift assays were performed as described
(Gao et al., 2005
;
Kirov et al., 1994
;
Pyrowolakis et al., 2004
).
Extracts from Drosophila S2 cells transfected with different plasmid
combinations were used to shift a Xvent2 BRE probe
(5'-CTAAGAGCTGGCTCCACCATGTCTGCCGTTAGTTGGCTCA-3').
For supershifts, 60 ng of anti-FLAG (M2, Sigma) or 100 ng of anti-MYC (9E10,
Santa Cruz) were added to the binding reactions. GST pull-downs were carried
out as described (Dai et al.,
2000
). Human Smad1 and Smad4 linker+MH2 regions subcloned in
pGEX-4T-1 were expressed in E. coli BL21. PCR fragments of hShn1 were
subcloned into pCITE4A (Novagen) before in vitro translation using the TNT-T7
Coupled Transcription/Translation Kit (Promega).
Molecular phylogeny
Shn proteins used were: D. melanogaster DMU31368; X.
tropicalis Shn1 genome v4.1 gw1.33.114.1, Shn2 gw1.274.19.1, Shn3
ensemble.c_scaffold_ 478000040; Mouse Shn1 NM_007772, Shn2 NM_010437, Shn3
NM_010657; Human Shn1 NM_002114, Shn2 NM_006734, Shn3, NM_024503. CLUSTALW
analysis was performed using the San Diego Supercomputer Center's Biology
Workbench.
| RESULTS |
|---|
|
|
|---|
|
|
T at position 4) that has been
reported to prevent Mad/Med binding and formation of the repression complex in
flies (Pyrowolakis et al.,
2004
The Xenopus and Drosophila cis-elements share architecture critical for Bmp responsiveness
The similarities between the Xenopus BRE and the Drosophila
brk element, both in sequence and in the ability to assemble a
signaling-dependent repression complex, raise an intriguing question. Do these
parallels reflect an underlying conservation of the Bmp-responsive
transcriptional regulators? To address this issue, we first tested whether
mutations that abolish repression by the brk element in
Drosophila correspondingly alter the ability of Xvent2-BRE
to respond to Bmp signaling in Xenopus. Substitutions of individual
residues in the Mad and Med sites of the brk element interfere with
complex formation and affect repression in vivo
(Pyrowolakis et al., 2004
). In
previous studies, we and others have shown that Smad4 binds the BRE and that
mutations that compromise the stimulation of Xvent2 reporters map to
regions corresponding to the Smad sites
(Hata et al., 2000
;
Henningfeld et al., 2000
;
Karaulanov et al., 2004
;
von Bubnoff et al., 2005
). A
distinguishing feature of the Drosophila element is the requirement
for an invariant spacing between the Mad and Med sites that is crucial for the
recruitment of Shn to the Smad-DNA complex
(Pyrowolakis et al., 2004
). If
a similar complex binds the Xenopus BRE, the spacer sequences could
serve as docking sites for a Smad co-factor, such as a vertebrate Shn (see
Fig. 1R). We therefore
generated BRE-luciferase reporters that alter either the length or the
sequence of the Xvent2 spacer and tested their ability to respond to
Bmp signaling in Xenopus animal cap assays
(Fig. 2B, see Materials and
methods). The wild-type Xvent2-BRE drives high-level luciferase
expression in response to endogenous Bmps that is further increased upon
co-injection of a constitutively active Bmp receptor (CABR), demonstrating
that the reporter responds to changes in activity of the Bmp pathway
(Fig. 2C). Substitution of 2 bp
within the spacer without altering its length (Xvent2-sub2), does not
affect Bmp responsiveness (Fig.
2A,C). By contrast, shortening the spacer by deleting 2 bp
(Xvent2-del2) rendered the reporter insensitive to stimulation
(Fig. 2A,C). These results
demonstrate that the Xvent2-BRE responds to Bmp stimulation in a
manner identical to that observed for the brk element in
Drosophila.
To examine whether the response to endogenous Bmp signaling places similar
constraints on BRE architecture, we assessed the activity of these constructs
in transgenic Xenopus (Kroll and
Amaya, 1996
; von Bubnoff et
al., 2005
). Wild-type and mutant BRE multimers were cloned
upstream of the Xvent2 minimal promoter driving GFP, and reporter
gene expression was examined by in situ hybridization. The wild-type BRE
drives expression at several sites where Bmp4 is transcribed, including the
eye, otic vesicle, ventral branchial arches, and the proctodeal region
(Fig. 2C)
(Karaulanov et al., 2004
;
von Bubnoff et al., 2005
). The
Xvent2-sub2 mutant drives a similar expression pattern. By contrast,
transgenic embryos carrying the Xvent2-del2 mutant show random
expression patterns, presumably as a result of integration site-dependent
position effects. These data reinforce the idea that in vivo (as in animal cap
assays) maintenance of an invariant spacer length is crucial for the BRE to
respond positively to Bmp signaling in Xenopus. Thus, BRE function
has the same architectural requirements in Xenopus and
Drosophila, and this constraint on the organization of the element
suggests that the recruitment of a Smad-interacting protein analogous to Shn
could be essential for BRE activity in vertebrates.
Shn proteins stimulate BRE activity in vertebrate cells
Shn proteins have high homology in the paired C2H2 zinc finger domains but
show limited sequence identity outside of these regions
(Fig. 3A) (reviewed by
Wu, 2002
). Generation of a
molecular phylogeny of fly, worm, frog, mouse and human proteins indicates
that Drosophila Shn is most closely related to vertebrate Shn1
(Fig. 3B). Therefore, to
investigate whether Shn proteins play mechanistically similar roles in the Bmp
pathway, we examined whether human Shn1 (hShn1) could stimulate the
BRE-mediated response to Bmp signaling in animal cap assays
(Fig. 3C). We found that
expression of hShn1 alone resulted in an approximately 4-fold stimulation of
the reporter that was further enhanced to 16-fold in the presence of an
activated Bmp receptor. This result suggests that vertebrate Shn-related
proteins could play an important role in mediating Bmp signaling.
Because the Xenopus BRE was Dpp responsive in Drosophila embryos, we were interested in determining whether Drosophila Shn can also elicit a response in Xenopus animal caps. We found that Shn alone did not significantly stimulate the reporter (Fig. 3D). Remarkably, co-injection of Shn and activated Bmp receptor significantly elevated reporter activity (Fig. 3D). Because fly Shn is capable of participating in a Smad complex on the Xvent2-BRE in vitro (see Fig. 1R), these data suggest that Shn can function as a transcriptional activator in Xenopus embryos. This result is striking as, in Drosophila, Shn mediates repression via the same cis-element. This difference in modality suggests that whether Shn drives transcriptional activation or repression is context-dependent rather than an inherent property of the protein.
Vertebrate Shn interacts directly with Smad proteins and assembles a complex on the BRE
The functional similarities between hShn1 and Shn suggest that vertebrate
Shn proteins act as Smad co-factors on the Vent2 BRE. However docking
of Shn to the Mad/Med complex requires zinc fingers 6 and 8
(Pyrowolakis et al., 2004
),
which are not represented in vertebrate Shn proteins (see
Fig. 3A). However, we, and
others, have shown that Drosophila Shn contains at least two
additional Smad-interacting domains (Dai et
al., 2000
; Udagawa et al.,
2000
), raising the possibility that interactions through other
regions contribute to hShn1-Smad complex formation on the Xvent2-BRE.
We therefore sought to identify and localize potential Smad-interacting
regions within hShn1 by co-expressing hShn1 fragments with hSmad1 and an
activated Bmp receptor. Co-immunoprecipitation assays identified two separate
domains (hShn11-599 and hShn11756-2544) that mediate
Smad interactions (Fig. 4A).
The ability of hShn1 to bind hSmad1 was independently confirmed in GST
pull-down assays. As demonstrated in Fig.
4B, fragments hShn11-702 and hShn11756-2544
bind GST-Smad1 strongly and GST-Smad4 with lower affinity, suggesting that
Shn/Smad interactions are conserved in vertebrate proteins. To determine
whether hShn1 binding to Smads results in the formation of a DNA-protein
complex on the Xvent2-BRE, different hShn1 polypeptides were
subjected to gel shift analysis using Drosophila Smads. We found that
hShn11-599 and hShn11496-2213 could bind and supershift
a BRE oligonucleotide (Fig.
4A,C, lanes 4 and 6). These polypeptides correlate well with
fragments that tested positive in the co-immunoprecipitation and GST pull-down
experiments, and suggest that the Smad1-interaction domains are located in the
region of overlap. Collectively, these data strongly suggest that, despite the
difference in modality, vertebrate Shn proteins use a conserved molecular
mechanism to mediate the transcriptional response to Bmp signaling.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
The brk element is a phylogenetically conserved cis-regulatory motif
Our data indicate that a common set of simple parameters - the presence of
Smad1 and Smad4 binding sites with a 5-bp separation - govern the ability of
the Xvent2-BRE to respond to Bmp signaling in both vertebrate cells
and in Drosophila. We establish that the BRE can assemble a Smad/Shn
complex despite a G
T substitution at position 4 (see
Fig. 2A). This was unexpected,
as the change affects one of the two GNCN sites in the brk consensus
site that are thought to bind Mad (Gao and
Laughon, 2006
; Gao et al.,
2005
). One possibility is that protein-protein interactions render
the presence of both GNCN sites unnecessary. Additionally, it has recently
been shown that an A
C substitution at position 5 in the brk
element enhances Mad binding (Gao and
Laughon, 2006
). Interestingly the Xvent2-BRE also
contains a C at this position that could play a compensatory role and aid
complex formation. Thus, our study suggests a modified consensus recognition
site GRCKNC(N5)GTCTG for the Shn/Smad complex. The conservation of both
sequence and function in the BRE is unexpected. For example, even
skipped (eve) stripe 2 enhancers from the related species D.
yakuba and D. melanogaster, which drive expression in similar
patterns and are functionally equivalent, show considerable sequence
divergence, suggesting that `turnover' in transcription factor binding sites
and their relative spacing is likely to be common, with co-evolutionary
changes being necessary to retain essential functions
(Ludwig, 2002
;
Tautz, 2000
). The stability of
the Shn/Smad site differs from the eve element and is reminiscent of
the cross-phyla conservation of enhancers in the Dorsal/NF
B and wound
healing pathways in Drosophila and vertebrates
(Gonzalez-Crespo and Levine,
1994
; Mace et al.,
2005
).
|
A previous study has implicated another Smad-interacting factor, OAZ, in
activation of Xvent2 transcription
(Hata et al., 2000
). Although
it remains possible that OAZ may contribute to Xvent2 expression in
some tissues, the OAZ expression pattern is insufficient to explain all
aspects of Xvent2 synexpression with Bmps. In addition, the OAZ site
GCTCCA (that overlaps with the GRCKNC Smad1 motif) was retained in the
Xvent2-del2 mutation that abolished Bmp responsiveness in animal caps
and embryos (see Fig. 2), which
suggests that OAZ may not have a crucial role in Xvent2
regulation.
Shn proteins display context-dependent modalities
A striking feature of the Shn complex assembled at the BRE is that it leads
to opposite outputs in Drosophila and Xenopus. In
Drosophila, the brk element appears to exclusively mediate
repression both in cell culture and in vivo
(Gao et al., 2005
;
Muller et al., 2003
).
Repression is dependent upon recruitment of Shn to a Mad/Med complex, and this
suggested that Shn might function as an obligate repressor
(Pyrowolakis et al., 2004
).
Consistent with this view, a 1-bp increase or decrease in the brk
spacer prevents Shn recruitment and changes the response from repression to
activation in cell culture assays (Gao et
al., 2005
). The results presented in this work do not fit such a
model. Although Shn/Mad/Med bound to the Xenopus BRE mediates
repression in Drosophila (see Fig.
1), in Xenopus Shn elicits activation through the same
response element (see Fig. 3D).
Thus the crucial determinant of whether the complex mediates activation or
repression appears to be the cellular milieu rather than the presence of Shn.
Human Shn1 similarly behaves as a transcriptional repressor in flies and as an
activator in Xenopus (see Fig.
3B, Fig. 4) further
emphasizing the fact that the transcriptional polarity of Shn proteins may
depend on differential interaction with co-repressors and co-activators
(Fig. 6). Furthermore, there is
evidence that Drosophila Shn need not be an obligate repressor in
flies. We have previously shown that Shn can directly stimulate the expression
of Ubx, a Dpp target gene, both in vivo and in cell culture
(Dai et al., 2000
) (see
Fig. 6). Likewise, Shn proteins
may not be obligate activators in vertebrate cells. Mouse Shn1 represses
expression of collagen2
1 through the recruitment of SPEN, a protein
that interacts with co-repressors SMRT/NCoR and HDAC
(Yang et al., 2005
). Thus, the
outcome of Shn interactions with the BRE may not be a species-specific
phenomenon. Instead, our observations suggest that the modality of Shn is
regulated in a celltype specific manner. This has several ramifications.
First, it identifies Shn co-activators and co-repressors as additional, and as
yet uncharacterized, players in the Bmp pathway. Second, the ability of human
Shn proteins to repress genes in Drosophila leads us to speculate
that at least some of the co-repressors are evolutionarily conserved, and that
vertebrate Shn proteins may also be involved in the downregulation of Bmp
targets.
In Shn, zinc fingers 6 and 8 that mediate complex formation with Mad/Med
and an adjacent 113 amino acid domain are essential for repression
(Pyrowolakis et al., 2004
).
Surprisingly, hShn1 that does not contain either the Smad interaction domain
or the `repression domain' can nevertheless effectively repress
brk-lacZ expression in flies (see
Fig. 5). As we have
demonstrated, hShn1 can assemble a complex on the BRE through two independent
Smad-interacting regions (see Fig.
4C), thus it appears that co-repressor recruitment may depend on
structural motifs/charge interactions that are not apparent from the primary
sequence.
Shn function in vertebrate Bmp signaling
Our results show that Shn1 can transduce a Bmp signal in Xenopus
and Drosophila embryos, as well as in cell culture (see Figs
3,
5; S.P. and R.W., unpublished).
The transcript distribution of Shn1 in Xenopus has
significant overlap with, and could explain, the Bmp-dependent synexpression
pattern of the Xvent2 gene from which the BRE was derived
(Durr et al., 2004
;
Niehrs and Pollet, 1999
;
Onichtchouk et al., 1996
).
However, a complete understanding of the role of Shn proteins in vertebrates
will require loss-of-function analyses. Recent studies of knockouts for the
closely related Shn2 gene has shown that it contributes to
Bmp-responsive transcriptional activation of PPAR
2, a key regulator of
adipocyte differentiation. Consistent with this, although Shn2 null
mice are viable and fertile, they have reduced adipose tissue. Interestingly,
although Shn2 also forms a complex with Smad1/Smad4 in response to Bmp
signaling, it mediates transcriptional activation via a distinct mechanism
(Jin et al., 2006
). The
sequence recognized by the complex does not resemble the BRE and in fact lacks
a Smad1 site. Instead, activation of PPAR
2 expression by Shn2 requires
sites for Smad4 and the transcription factor C/EBP-
(see
Fig. 6). Mice lacking
Shn3 are also viable and fertile, but they show defects in immune
function. Shn3 has been shown to act downstream of the T cell and Tnf
receptors (Oukka et al., 2002
;
Oukka et al., 2004
), but
whether these events are linked to Bmp signaling remains to be explored.
All three vertebrate Shn proteins contain the zinc finger domains
implicated in Smad interaction
(Pyrowolakis et al., 2004
;
Jin et al., 2006
) (this work),
raising questions about how related Shn proteins contribute to Bmp signaling.
One possibility is that all Shn proteins can interact with Smads but that each
paralog recruits different sets of cofactors. Thus, each Shn protein would
regulate a distinct subset of targets, allowing Bmp signaling to control a
wide range of target genes in a selective manner. Alternatively, vertebrate
Shn proteins may share the ability to interact with common co-factors and have
redundant or partially overlapping functions. In light of this, it is
interesting that Shn2 and Shn3 mutant mice are viable, in
contrast to the embryonic lethality of mutations in Bmp ligands, receptors and
Smads (reviewed by Zhao,
2003
). Mouse Shn1 and Shn2 are widely expressed
in overlapping tissues during embryogenesis and in adults, whereas
Shn3 shows restricted expression, suggesting that it may have a more
limited role (reviewed by Wu,
2002
). A more complete understanding of how Shn proteins
contribute to Bmp signaling in mice will require the analysis of mouse
Shn1 knockouts, as well as the generation of double and triple null
animals. Our attempts to knockdown Shn1 function in X. tropicalis
using splice-site directed morpholino oligonucleotides have been unsuccessful
(I.L.B. and K.W.Y.C., unpublished). Given that all three genes are
ubiquitously distributed in gastrula stage embryos and continue to be
expressed throughout early development
(Durr et al., 2004
), one
possibility is that vertebrate Shn proteins are functionally redundant.
Alternatively, because the morpholinos do not target mature mRNA, the absence
of a phenotype may be due to perdurance of the maternal message. The
conservation of the size and organization of Shn-like proteins suggests that
their structural properties may contribute to their function. One possibility
is that they act as molecular scaffolds for the assembly of the
transcriptional machinery that mediates Bmp responsiveness (see
Fig. 6). Shn proteins could
also serve an architectural function by promoting bending or looping of the
DNA, by binding at more than one location.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Affolter, M., Marty, T., Vigano, M. A. and Jazwinska, A. (2001). Nuclear interpretation of Dpp signaling in Drosophila. EMBO J. 20,3298 -3305.[CrossRef][Medline]
Arora, K., Dai, H., Kazuko, S. G., Jamal, J., O'Connor, M. B., Letsou, A. and Warrior, R. (1995). The Drosophila schnurri gene acts in the Dpp/TGFß signaling pathway and encodes a transcription factor homologous to the human MBP family. Cell 81,781 -790.[CrossRef][Medline]
Barolo, S., Carver, L. A. and Posakony, J. W. (2000). GFP and beta-galactosidase transformation vectors for promoter/enhancer analysis in Drosophila. Biotechniques 29,726 -732.[Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Bray, S. J. and Kafatos, F. C. (1991).
Developmental function of Elf-1: an essential transcription factor during
embryogenesis in Drosophila. Genes Dev.
5,1672
-1683.
Campbell, G. and Tomlinson, A. (1999). Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation of Dpp targets by brinker. Cell 96,553 -562.[CrossRef][Medline]
Candia, A. F., Watabe, T., Hawley, S. H., Onichtchouk, D., Zhang, Y., Derynck, R., Niehrs, C. and Cho, K. W. (1997). Cellular interpretation of multiple TGF-beta signals: intracellular antagonism between activin/BVg1 and BMP-2/4 signaling mediated by Smads. Development 124,4467 -4480.[Abstract]
Dai, H., Hogan, C., Gopalakrishnan, B., Torres-Vazquez, J., Nguyen, M., Park, S., Raftery, L. A., Warrior, R. and Arora, K. (2000). The zinc finger protein schnurri acts as a Smad partner in mediating the transcriptional response to decapentaplegic. Dev. Biol. 227,373 -387.[CrossRef][Medline]
Dorfman, R. and Shilo, B. Z. (2001). Biphasic activation of the BMP pathway patterns the Drosophila embryonic dorsal region. Development 128,965 -972.[Abstract]
Durr, U., Henningfeld, K. A., Hollemann, T., Knochel, W. and Pieler, T. (2004). Isolation and characterization of the Xenopus HIVEP gene family. Eur. J. Biochem. 271,1135 -1144.[Medline]
Fan, C. M. and Maniatis, T. (1990). A
DNA-binding protein containing two widely separated zinc finger motifs that
recognize the same DNA sequence. Genes Dev.
4, 29-42.
Furriols, M. and Bray, S. (2001). A model Notch response element detects Suppressor of Hairless-dependent molecular switch. Curr. Biol. 11,60 -64.[CrossRef][Medline]
Gao, S. and Laughon, A. (2006). DPP-responsive
silencers contain overlapping mad binding sites. J. Biol.
Chem. Doi: 10.1074/jbc.M603371200.
Gao, S., Steffen, J. and Laughon, A. (2005).
Dpp-responsive silencers are bound by a trimeric Mad-Medea complex.
J. Biol. Chem. 280,36158
-36164.
Gonzalez-Crespo, S. and Levine, M. (1994).
Related target enhancers for Dorsal and NF-
B signaling pathways.
Science 264,255
-258.
Grieder, N. C., Nellen, D., Burke, R., Basler, K. and Affolter, M. (1995). schnurri is required for Drosophila Dpp signaling and encodes a zinc finger protein similar to the mammalian transcription factor PRDII-BF1. Cell 81,791 -800.[CrossRef][Medline]
Hata, A., Seoane, J., Lagna, G., Montalvo, E., Hemmati-Brivanlou, A. and Massague, J. (2000). OAZ uses distinct DNA- and protein-binding zinc fingers in separate BMP-Smad and Olf signaling pathways. Cell 100,229 -240.[CrossRef][Medline]
Hayward, D. C., Samuel, G., Pontynen, P. C., Catmull, J., Saint,
R., Miller, D. J. and Ball, E. E. (2002). Localized
expression of a dpp/BMP2/4 ortholog in a coral embryo. Proc. Natl.
Acad. Sci. USA 99,8106
-8111.
Henningfeld, K. A., Rastegar, S., Adler, G. and Knochel, W.
(2000). Smad1 and Smad4 are components of the bone morphogenetic
protein-4 (BMP-4)-induced transcription complex of the Xvent-2B promoter.
J. Biol. Chem. 275,21827
-21835.
Holstein, T. W., Hobmayer, E. and Technau, U. (2003). Cnidarians: an evolutionarily conserved model system for regeneration? Dev. Dyn. 226,257 -267.[CrossRef][Medline]
Jin, W., Takagi, T., Kanesashi, S. N., Kurahashi, T., Nomura, T., Harada, J. and Ishii, S. (2006). Schnurri-2 controls BMP-dependent adipogenesis via interaction with Smad proteins. Dev. Cell 10,461 -471.[Medline]
Johnson, K., Kirkpatrick, H., Comer, A., Hoffmann, F. M. and
Laughon, A. (1999). Interaction of Smad complexes with
tripartite DNA-binding sites. J. Biol. Chem.
274,20709
-20716.
Karaulanov, E., Knochel, W. and Niehrs, C. (2004). Transcriptional regulation of BMP4 synexpression in transgenic Xenopus. EMBO J. 23,844 -856.[CrossRef][Medline]
Kim, J., Johnson, K., Chen, H. J., Carroll, S. and Laughon, A. (1997). Drosophila Mad binds to DNA and directly mediates activation of vestigial by Decapentaplegic. Nature 388,304 -308.[CrossRef][Medline]
Kirov, N., Childs, S., O'Connor, M. and Rushlow, C.
(1994). The Drosophila dorsal morphogen represses the tolloid
gene by interacting with a silencer element. Mol. Cell.
Biol. 14,713
-722.
Kroll, K. L. and Amaya, E. (1996). Transgenic Xenopus embryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation. Development 122,3173 -3183.[Abstract]
Liang, J., Lints, R., Foehr, M. L., Tokarz, R., Yu, L., Emmons,
S. W., Liu, J. and Savage-Dunn, C. (2003). The Caenorhabditis
elegans schnurri homolog sma-9 mediates stage- and cell type-specific
responses to DBL-1 BMP-related signaling. Development
130,6453
-6464.
Ludwig, M. Z. (2002). Functional evolution of noncoding DNA. Curr. Opin. Genet. Dev. 12,634 -639.[CrossRef][Medline]
Mace, K. A., Pearson, J. C. and McGinnis, W.
(2005). An epidermal barrier wound repair pathway in Drosophila
is mediated by grainy head. Science
308,381
-385.
Marty, T., Muller, B., Basler, K. and Affolter, M. (2000). Schnurri mediates Dpp-dependent repression of brinker transcription. Nat. Cell Biol. 2, 745-749.[CrossRef][Medline]
Massague, J., Seoane, J. and Wotton, D. (2005).
Smad transcription factors. Genes Dev.
19,2783
-2810.
Muller, B., Hartmann, B., Pyrowolakis, G., Affolter, M. and Basler, K. (2003). Conversion of an extracellular Dpp/BMP morphogen gradient into an inverse transcriptional gradient. Cell 113,221 -233.[CrossRef][Medline]
Niehrs, C. and Pollet, N. (1999). Synexpression groups in eukaryotes. Nature 402,483 -487.[CrossRef][Medline]
Onichtchouk, D., Gawantka, V., Dosch, R., Delius, H., Hirschfeld, K., Blumenstock, C. and Niehrs, C. (1996). The Xvent-2 homeobox gene is part of the BMP-4 signalling pathway controlling [correction of controling] dorsoventral patterning of Xenopus mesoderm. Development 122,3045 -3053.[Abstract]
Oukka, M., Kim, S. T., Lugo, G., Sun, J., Wu, L. C. and Glimcher, L. H. (2002). A mammalian homolog of Drosophila schnurri, KRC, regulates TNF receptordriven responses and interacts with TRAF2. Mol. Cell 9,121 -131.[CrossRef][Medline]
Oukka, M., Wein, M. N. and Glimcher, L. H.
(2004). Schnurri-3 (KRC) interacts with c-Jun to regulate the
IL-2 gene in T cells. J. Exp. Med.
199, 15-24.
Padgett, R. W., Wozney, J. M. and Gelbart, W. M.
(1993). Human BMP sequences can confer normal dorsal-ventral
patterning in the Drosophila embryo. Proc. Natl. Acad. Sci.
USA 90,2905
-2909.
Pyrowolakis, G., Hartmann, B., Muller, B., Basler, K. and Affolter, M. (2004). A simple molecular complex mediates widespread BMP-induced repression during Drosophila development. Dev. Cell 7,229 -240.[CrossRef][Medline]
Raftery, L. A. and Sutherland, D. J. (1999). TGF-beta family signal transduction in Drosophila development: from Mad to Smads. Dev. Biol. 210,251 -268.[CrossRef][Medline]
Rastegar, S., Friedle, H., Frommer, G. and Knochel, W. (1999). Transcriptional regulation of Xvent homeobox genes. Mech. Dev. 81,139 -149.[CrossRef][Medline]
Sampath, T. K., Rashka, K. E., Doctor, J. S., Tucker, R. F. and
Hoffmann, F. M. (1993). Drosophila transforming growth factor
beta superfamily proteins induce endochondral bone formation in mammals.
Proc. Natl. Acad. Sci. USA
90,6004
-6008.
Shi, Y. and Massague, J. (2003). Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113,685 -700.[CrossRef][Medline]
Staehling-Hampton, K., Laughon, A. S. and Hoffmann, F. M. (1995). Drosophila protein related to the human zinc finger transcription factor PRDII/MBPI/HIV-EP1 is required for dpp signaling. Development 121,3393 -3403.[Abstract]
Sutherland, D. J., Li, M., Liu, X. Q., Stefancsik, R. and
Raftery, L. A. (2003). Stepwise formation of a SMAD activity
gradient during dorsal-ventral patterning of the Drosophila embryo.
Development 130,5705
-5716.
Suzuki, A., Thies, R. S., Yamaji, N., Song, J. J., Wozney, J.
M., Murakami, K. and Ueno, N. (1994). A truncated bone
morphogenetic protein receptor affects dorsal-ventral patterning in the early
Xenopus embryo. Proc. Natl. Acad. Sci. USA
91,10255
-10259.
Tanimoto, H., Itoh, S., ten Dijke, P. and Tabata, T. (2000). Hedgehog creates a gradient of DPP activity in Drosophila wing imaginal discs. Mol. Cell 5, 59-71.[CrossRef][Medline]
Tautz, D. (2000). Evolution of transcriptional regulation. Curr. Opin. Genet. Dev. 10,575 -579.[CrossRef][Medline]
Torres-Vazquez, J., Warrior, R. and Arora, K. (200