|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 September 2006
doi: 10.1242/dev.02582
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Naturwissenschaftliche Fakultät III-Biologie und Vorklinische Medizin,
University of Regensburg, D-93040 Regensburg, Germany.
2 Department of Cellular and Developmental Biology of Plants, University of
Bielefeld, Universitätsstrasse 25, D-33615 Bielefeld, Germany.
* Author for correspondence (e-mail: rudy.schmitt{at}biologie.uni-regensburg.de)
Accepted 10 August 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Germ-soma differentiation, regA, Translation control, Upstream AUGs, Ribosome shunting, Volvox carteri
| INTRODUCTION |
|---|
|
|
|---|
96 hours they die (Kirk,
1997
Three types of genes - gls, lag and regA - are
responsible for cell differentiation in V. carteri. The regA
gene is a master control gene that is expressed only in somatic cells, where
it suppresses all reproductive activity. If the regA gene is
defective, the Reg phenotype (Fig.
1C) appears, in which the somatic cells appear to differentiate
normally at first, but then redifferentiate as fully functional reproductive
cells. RegA, the regA gene product, is a protein with features of a
transcriptional repressor that is present in somatic nuclei through most of
the life cycle, but can never be detected in gonidia
(Kirk et al., 1999
;
Stark et al., 2001
). Sixteen
putative targets of RegA repression were found to be nuclear genes encoding
important chloroplast proteins; this led to the hypothesis that regA
blocks reproductive activity in somatic cells by preventing chloroplast
biogenesis, and thereby preventing their growth
(Meissner et al., 1999
).
All of these aspects led to the belief that regA must be regulated
in a very exact manner. Previous studies had shown that the transcription of
regA is regulated primarily by two enhancers and one silencer located
in the introns (Stark et al.,
2001
). But there were also indications that regA might be
regulated at the translational level. First, it was observed that the
synthesis of RegA protein lags behind the appearance of the regA mRNA
by 4 hours (Kirk et al.,
1999
). Second, the level of RegA protein is much lower than might
be expected from the mRNA level. Third, there are eight potential start codons
(AUGs) (Fig. 2) in the 940
nucleotide 5' UTR of the regA mRNA that would have to be
bypassed by the translation initiation complex in some manner, in order to
reach the bona fide initiation codon.
In eukaryotes, three different mechanisms in addition to normal ribosomal
scanning are known to regulate translation initiation: (1) leaky scanning
(Kozak, 2002
); (2)
reinitiation (Kozak, 2002
);
and (3) internal ribosome entry site (IRES)-mediated translation initiation
(Hellen and Sarnow, 2001
). In
leaky scanning the translation initiation complex does not recognize a
potential start codon on the mRNA, because the surrounding sequence deviates
strongly from the ideal, so-called Kozak sequence
(Kozak, 2002
). Thus the
complex moves on, and translation starts at a subsequent start codon.
Reinitiation takes place on mRNAs with short upstream open reading frames
(ORFs); after the translation of such ORFs, the 60S ribosome subunit
dissociates from the mRNA, but the 40S subunit remains bound and continues
scanning until it is again loaded with all initiation factors and initiator
tRNA, whereupon translation initiation can start as soon as the complex
reaches the next start codon (Kozak,
2002
). Such reinitiation can occur up to five times under optimal
conditions (Wang and Rothnagel,
2004
). Both leaky scanning and reinitiation reduce the translation
efficiency of the downstream ORF, because the upstream start codons serve as
ribosome traps. IRESs (Hellen and Sarnow,
2001
) appear in long non-coding regions of virus mRNAs, but also
in certain cellular mRNAs, such as the Gtx mRNA of mouse
(Hu et al., 1999
). The
translation initiation complex is assembled along these non-coding regions,
but not at the 5' cap. So far, no consensus sequence has been
established for the known cellular IRESs
(Hellen and Sarnow, 2001
).
A fourth mechanism of translational regulation that operates on various
viral messengers and at least one eukaryotic mRNA is ribosome shunting
(Ryabova et al., 2002
;
Yueh and Schneider, 1996
;
Yueh and Schneider, 2000
). In
it, scanning of the 5' UTR starts normally and proceeds until the
initiation complex encounters a stable secondary structure in the mRNA,
whereupon the complex dissociates from the mRNA but then binds to it again at
a downstream `landing site', from which it continues scanning
(Xi et al., 2004
). In certain
cases, such as the 35S mRNA of cauliflower mosaic virus, translation of a
small ORF is required before shunting can occur
(Pooggin et al., 2000
). Here
we report the results of transformation experiments with wild-type (WT) and
modified regA constructs that lead us to propose that ribosome
shunting controls the translation of regA mRNA during normal
development of V. carteri.
|
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Constructs ATG1 to ATG7 were generated by overlap extension PCR
(Higuchi, 1989
) with primers
containing ATG to TGG mutations. The ATG2Stop construct was generated with
primers containing two in-frame stop codons (ATGGCGTATCCTTGC
ATGGCGTAACCTTGA). The
S18 construct was obtained
by mutational insertion of two ClaI cloning sites (base 1237-base
1242: AAAGCC
ATCGAT; base 1289-base 1294: ATCTTG
ATCGAT) and
subsequent deletion of base 1240 to base 1294. The PCR products were cloned in
the pGEM-T vector (Promega, Mannheim, Germany) for amplification and
sequencing. The PCR products have a natural PmeI cloning site at the
5' end and a BglII cloning site at the 3' end with which
they could be inserted in the pVcRegA1 plasmid.
A DNA fragment consisting of five copies of a BamHI linker
sequence was used previously to generate a stable hairpin that blocked
ribosomal scanning but not ribosomal shunting
(Yueh and Schneider, 1996
;
Yueh and Schneider, 2000
). So
we used PCR to construct a fragment containing five copies of the 12
nucleotide BamHI linker sequence CGCGGATCCGCG and inserted it
50
bp upstream of the E3 landing site (Fig.
2) according to Hallmann and Wodniok
(Hallmann and Wodniok, 2006
).
To facilitate cloning, an additional SalI site (GTCGAC) was
introduced into the central loop of the hairpin
(Fig. 6) The first PCR was
performed on plasmid pVcRegA1 with the sense primer
5'-TCGTTGCGTTGGAGACCCTTC and the 64-mer antisense primer
5'-AATATATGTCGACTCCGCGCGCGGATCCGCGCGCGGATCCGCGACTGTGGTTATCCACAGTGAG.
The second PCR was performed on the same template with the 64-mer sense primer
5'-AATATATGTCGACTCCGCGCGCGGATCCGCGCGCGGATCCGCGTGGAGCCTTAGTGACGTTCCT
and the antisense primer 5'-TGTTGGAGTACTAGGCAGGTC. In both of the 64-mer
primers, one third of the bases match the pVcRegA1 sequence at the insertion
site, the remaining sequence carries one half of the hairpin sequence
(underlined), a SalI site (bold and italics), and a short 5'
AT-rich sequence, which disappears upon cloning. The PCR fragments were cloned
into the pGEM-T Easy vector (Promega, Mannheim, Germany) and sequenced. The
PCR fragments were combined via the SalI site and the resulting
fragment was introduced into plasmid pVcRegA1 by replacing the corresponding
hairpin-free fragment, using the natural PmeI and BglII
cloning sites (see above). The hairpin-containing plasmid was then propagated
in Escherichia coli strain SURE (Stratagene, La Jolla, CA).
Volvox strains, cultivation conditions and nuclear transformation
Volvox carteri cultures were maintained in standard
Volvox medium (SVM) at 30°C under a 16:8-hour light:dark cycle
(Kirk and Kirk, 1983
;
Kirk and Kirk, 1985
). SVM
lacking the usual urea or ammonium chloride (SVMN) was used to select for
ability to reduce nitrate after genetic transformation. This transformation
was performed according to Schiedlmeier et al.
(Schiedlmeier et al., 1994
)
with modifications. Cells of the V. carteri strain 153-68, which
carries non-revertible mutations in both the nitA and regA
loci (Kirk et al., 1999
), were
co-bombarded with pVcNR15 (Gruber et al.,
1996
) and various regA constructs that were described
before. Integration of regA constructs after transformation was
tested by PCR as described by Stark et al.
(Stark et al., 2001
).
| RESULTS |
|---|
|
|
|---|
Mutational ablation of AUG1, AUG2 or ORF2 causes a marked reduction of regA expression
Here, we use RNA nomenclature (AUG, etc) when it concerns translation
control, and DNA nomenclature (ATG, etc) when it concerns the regA
gene and the construction of mutant plasmids.
Six mutant versions of the regA gene were tested for their ability
to cure the Reg phenotype. The constructs tested were all modified versions of
the plasmid pVcRegA1 (Kirk et al.,
1999
), which contains the native regA locus
(Fig. 2) and which was also
used as the positive control for all the transformation experiments reported
here. In each mutant construct one of the upstream ATGs was changed to TGG,
and if the preceding nucleotide had been an A, it was also changed (to a C).
Mutations of ATG4 and ATG8 were not tested, because those two ATGs were
followed almost immediately by stop codons (ATGCCATAA and
ATGTAA, respectively). (Furthermore, ATG8 is located in exon 4,
which can be deleted, together with the non-coding part of exon 5 without any
effect; M. Lichtinger, personal communication.) Co-transformation with
constructs carrying mutations of ATG3 to ATG7 restored the WT phenotype with
frequencies (60-82%) that were not greatly different from the positive
control, A1 (100%; Fig. 1A).
This finding indicated that those four upstream AUGs play no crucial role in
regulating regA expression. By contrast, constructs with mutations of
ATG1 or ATG2 restored the WT phenotype with substantially lower frequencies
(22 and 35%, respectively; Fig.
1A), indicating that those two regions of the UTR are involved in
some way in the regulation of regA expression.
An open reading frame that we call ORF2 starts at ATG2 and is the longest
ORF in the regA 5' UTR (Fig.
2). It has 142 codons, and the sequence surrounding the AUG shows
the highest similarity of all the upstream ORFs of the regA mRNA to
the Kozak sequence of Chlamydomonas reinhardtii, a close relative of
V. carteri (Ikeda and Miyasaka,
1998
; Rausch et al.,
1989
). A comparison of this region from three different formas
(subspecies) of V. carteri revealed 82-88% DNA-sequence conservation,
indicating the possible importance of the region. To test for a possible role
of ORF2 in controlling regA expression, we inserted two in-frame stop
codons just downstream of ATG2 (ATG2Stop; ATGGCGTATCCTTGC
ATGGCGTAACCTTGA) and tested the resulting construct by
co-transformation. The result was dramatic
(Fig. 1A): the insertion of the
stop codons nearly abolished the ability of the regA gene to cure the
mutant phenotype. Only two co-transformants with non-Reg phenotypes were
found, but they did not show the WT phenotype. Rather, they exhibited the
so-called M-Reg phenotype (Fig.
1D), in which some - but not all - somatic cells are restored to
the WT condition, and which is thought to be a result of too little RegA
protein being produced to maintain the non-reproductive character of all
somatic cells (Kirk,
1998
).
The foregoing results pointed to the importance of the ORF2 region for full expression of regA. However, we were never able to detect any ORF2 translation product, even when we attached a hemagglutin (HA) tag in frame with ORF2 and performed sensitive tests for HA expression with a specific antibody. This led us to suspect that it might be the secondary structure of this region of the mRNA, and neither the translation of ORF2 nor the action of its translation product that renders this region essential for regA translation. Accordingly, we attempted to assess the possibility that regA translation was controlled by ribosome shunting.
The regA RNA has several features that are required for ribosome shunting
In viruses, ribosome shunting requires certain recognizable mRNA features,
including stable hairpin structures that interfere with ribosome scanning, and
`take-off' and `landing' sites that allow the 40S ribosomal subunit to bypass
the hairpins (Ryabova et al.,
2002
). We therefore analysed the secondary structure of the
5' UTR of regA mRNA with the computer program mfold
(Zuker, 2003
). The
thermodynamically most probable structure turned out to include a triple
hairpin (Fig. 3) between
positions 215 and 277, which is a reminder of the structure of adenovirus that
is required for ribosome shunting in that case
(Yueh and Schneider, 2000
).
This is also the region in which two of our introduced mutations - namely,
ATG2 and ATG2Stop - were located (Fig.
3). Parallel analyses of secondary structures for the ATG2 and
ATG2Stop mutant mRNAs predicted that in both mutants the third hairpin would
be lacking. Our calculations of the energy that would be required to open the
62 nucleotide regions of sequence between positions 215 and 277
(Fig. 3, encircled) indicated
that opening this region of the mutant 5' UTRs for ribosomal scanning
would take 43% less energy than would be required to open the corresponding
region of the WT RNA.
Adding to the potential significance of the foregoing observations - and
reinforcing the possibility that translation of regA mRNA involves
ribosome shunting - was the fact that when a parallel structural analysis was
performed for the regA mRNA of another subspecies of Volvox
carteri - V. carteri forma kawasakiensis
(Duncan et al., 2006
) - we
found that the triple-hairpin structure was strongly conserved.
In addition to a stable hairpin capable of blocking ribosomal scanning,
ribosome shunting also requires `take-off' and `landing' sites that permit the
40S ribosomal subunit to bypass the hairpin. In the case of adenovirus,
several regions were identified that exhibit complementarity to parts of the
3' end of the 18S rRNA (Fig.
4A), and that are postulated to function as the take-off and
landing sites (Yueh and Schneider,
2000
). A similar sequence has been found in the human
hsp70-1 gene (Yueh and Schneider,
2000
). In the regA mRNA of V. carteri f.
nagariensis we detected three such regions
(Fig. 2,
Fig. 4B): two possible take-off
sites, E1.1 and E1.2, upstream of AUG2 and a potential landing site, E3,
downstream of AUG7, near the end of exon 3. All those regions of
complementarity are fully conserved in V. carteri f.
kawasakiensis (Fig.
4B), reinforcing the idea that they are functionally
significant.
|
|
Another powerful test of the ribosome-shunting hypothesis was provided by
previous studies demonstrating that an artificial hairpin that is too stable
to be opened by the translation machinery does not impose a barrier to
translation of the message, provided that it is inserted upstream of the
landing site used for ribosome shunting
(Futterer et al., 1993
;
Yueh and Schneider, 1996
). To
employ this test, we introduced an especially stable stem-loop structure
50 bp upstream of the putative E3 landing site
(Fig. 2). With a calculated
G of -87 kcal/mole, this stem-loop structure
(Fig. 6) is even more stable
than those employed in previous studies (-61 kcal/mole or -80 kcal/mole,
respectively) (Kozak, 1989
;
Yueh and Schneider, 1996
).
When we tested this construct by transformation, 82% of the co-transformants
exhibited phenotypic rescue. (However, 28% of the co-transformants exhibited
the M-Reg, rather than the WT, phenotype, indicating that in them the level of
regA expression was adequate to repress reproductive activity in
most, but not all, somatic cells.) These results make it clear that
regA can be expressed in spite of the presence of a very stable
hairpin in the 5' UTR, and thus they provide additional strong support
for the hypothesis that ribosome shunting is the major mechanism controlling
the translation of the regA gene in V. carteri.
|
|
| DISCUSSION |
|---|
|
|
|---|
In many eukaryotic mRNAs, AUGs and small ORFs in the 5' UTR act as
potential ribosome traps that must be bypassed in order for the initiation
complex to reach the true initiation codon and begin translating the real
message (Kozak, 2002
). Four
mechanisms for bypassing such potential ribosome traps are known. We will
consider the evidence for and against the involvement of each of those four
mechanisms in the case of regA translation.
Leaky scanning and reinitiation
In leaky scanning, the initiation complex sometimes fails to recognize a
potential start codon on the mRNA, because the surrounding sequence deviates
from the ideal, so-called Kozak sequence
(Kozak, 2002
), so (with some
finite frequency) it bypasses that codon. Reinitiation occurs when a 40S
ribosomal subunit remains attached to the mRNA after the translation of a
short upstream ORF has been completed, and it then continues scanning until it
reaches another start codon and a new initiation complex has been assembled
(Kozak, 2002
). Although
ribosomes can get beyond upstream AUGs and ORFs by either of these methods, in
both cases these upstream elements retard the ribosomes in their journey to
the real initiation codon. Therefore, removal of upstream AUGs and ORFs that
would otherwise need to be bypassed by one of these mechanisms always causes
an increased rate of translation of the main message
(Wang and Rothnagel, 2004
). In
the case of regA, however, the opposite effect was observed: although
mutational ablation of AUG3-AUG8 had little effect, mutations of AUG1, AUG2
and ORF2 all caused marked decreases in regA expression
(Fig. 1A). This led us to
exclude both leaky scanning and reinitiation as potential mechanisms
regulating the rate of regA translation.
Internal ribosome entry site
Many viral mRNAs and some long, eukaryotic cellular mRNAs possess an IRES
at which an initiation complex is assembled, rather than at the 5' cap
(Hellen and Sarnow, 2001
).
Three observations reported here speak to the issue of whether regA
translation depends on initiation at an IRES. (1) Point mutations at different
positions in the 5' UTR should not all lead to reduced expression
(Hellen and Sarnow, 2001
;
Pelletier et al., 1988
),
except a putative IRES would span the whole 779 nucleotides from AUG1 to the
end of exon 3 [but we are not aware of any IRES longer than 395 nucleotides
(Bernstein et al., 1997
)]. (2)
A stable hairpin at a site downstream of an IRES should block progression of
any initiation complex that was formed at that IRES, but we have found that a
stable hairpin inserted into exon 3 does not prevent regA expression
(Fig. 5). This appears to rule
out the possibility that regA translation is dependent on an IRES
upstream of exon 3. (3) One of our colleagues has established that no
significant reduction of regA expression occurs when both exon 4 and
the untranslated portion of exon 5 are deleted (M. Lichtinger, personal
communication). This appears to rule out the possibility that an IRES
downstream of exon 3 is required for regA expression. These
observations, taken together, make it extremely unlikely that translation of
regA mRNA relies to any significant extent on an IRES.
Ribosome shunting
Ribosome shunting is a mechanism in which a ribosome bypasses a region of
stable secondary structure in the mRNA by first dissociating from the RNA at a
`take-off' element upstream of the blocking structure, and then reassociating
with the message downstream of the structure, at a `landing site' element.
Here we have found evidence that the regA mRNA contains all three
types of elements that are required for shunting: namely, a region of stable
secondary structure, two potential take-off sites and one potential landing
site.
The potential block to scanning that we discovered by secondary structure
analysis of WT regA mRNA (Fig.
3) is a region of stable secondary structure that lies between
nucleotides 215 and 277 and shows a triple hairpin structure that appears to
be a reminder of the hairpin structure of adenovirus that is required for
ribosome shunting in that case (Yueh and
Schneider, 2000
). Further secondary structure analysis revealed
that the mutations in AUG2 and ORF2 that caused such marked decreases in
regA expression also changed the nature of the most probable
secondary structure in the nucleotide 215-277 region, removing the third
hairpin. Furthermore, the structural changes resulting from these simple
mutational changes reduced by nearly half the amount of energy that would be
required to open up this region and permit passage of a scanning ribosome!
Once past this region of the mutant RNAs, of course, the scanning ribosome
would then encounter six additional AUGs before it could reach the true start
codon, AUG9, explaining why these mutations caused such a marked decline in
regA expression.
The putative ribosomal take-off and landing sites that we located in regA mRNA, like those found in human adenovirus mRNA and other messages exhibiting ribosomal shunting, are short regions of complementarity to the 3' end of the 18S rRNA (Fig. 4). To test whether the putative landing site, E3, really had any important role to play in controlling regA expression, we used transformation to test how effective a regA construct lacking this region of the sequence would be in rescuing a Reg mutant. The result (Fig. 5) was unambiguous: such a construct was totally inactive - wholly incapable of rescuing the Reg-mutant phenotype - just as our ribosome-shunting hypothesis predicted it would be.
Further strong support for our ribosome-shunting hypothesis came from the experiment in which an extremely stable synthetic hairpin was inserted just upstream of the putative ribosome-landing site (Fig. 2). Insertion of a stable hairpin in this location had no discernible effect on the ability of the regA transgene to rescue a Reg mutant (Fig. 5), which was once again fully consistent with our ribosome-shunting hypothesis.
The only alternative to the ribosome-shunting hypothesis that we can think of to explain the fact that a stable hairpin in exon 3 does not diminish regA expression would be an assumption that there is an IRES located somewhere downstream of exon 3. However, that possibility can be ruled out, because it has previously been demonstrated that deletion of all of exon 4, plus the untranslated part of exon 5, has no discernible effect on regA expression (M. Lichtinger, personal communication).
In short, the most viable hypothesis at the moment clearly is that
translation of the Volvox carteri regA gene involves ribosome
shunting. As far as we are aware, this is the first case in which ribosome
shunting has been invoked with respect to translational control in a green
eukaryote, and only the second time it has been invoked in print with respect
to any eukaryotic cellular mRNA. [The only precedent we are aware of involves
the human hsp70 mRNA (Yueh and
Schneider, 2000
).] But it would be truly unusual if a control
mechanism that is used by many viruses, a green alga and humans were not used
elsewhere in the Eukaryota. Hence we would strongly encourage colleagues to
consider ribosome shunting seriously as a possible mechanism employed in other
cases of eukaryotic translational regulation.
How do we imagine that ribosome shunting occurs on the regA mRNA?
The translation initiation complex would be assembled at the 5' cap
and would then scan along the regA mRNA until it recognized the first
start codon, AUG1, and translated the adjacent short ORF1. This ORF has only
14 codons, resulting in a brief translation event that, in other cases that
have been studied, favours continued scanning and reinitiation at the next AUG
(Kozak, 2002
;
Wang and Rothnagel, 2004
).
After leaving ORF1, however, the 40S subunit would be stopped by the
triple-hairpin structure before it could reach AUG2. It would then be shunted
from the take-off site, E1.1, to the landing site at the end of exon 3, E3,
thereby bypassing AUG2 to AUG7. Because AUG8 is followed immediately by a UAA
stop codon, it is not likely to be mistaken for an initiation site
(Pooggin et al., 2000
), so
translational initiation would start at AUG9, causing the RegA protein to be
produced.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Babinger, P., Kobl, I., Mages, W. and Schmitt, R.
(2001). A link between DNA methylation and epigenetic silencing
in transgenic Volvox carteri. Nucleic Acids Res.
29,1261
-1271.
Bernstein, J., Sella, O., Le, S. Y. and Elroy-Stein, O.
(1997). PDGF2/c-sis mRNA leader contains a differentiation-linked
internal ribosomal entry site (D-IRES). J. Biol. Chem.
272,9356
-9362.
Duncan, L., Nishii, I., Howard, A., Kirk, D. and Miller, S. M. (2006). Orthologs and paralogs of regA, a master cell-type regulatory gene in Volvox carteri. Curr. Genet. 50, 61-72.[CrossRef][Medline]
Futterer, J., Kiss-Laszlo, Z. and Hohn, T. (1993). Nonlinear ribosome migration on cauliflower mosaic virus 35S RNA. Cell 73,789 -802.[CrossRef][Medline]
Gruber, H., Kirzinger, S. H. and Schmitt, R. (1996). Expression of the Volvox gene encoding nitrate reductase: mutation-dependent activation of cryptic splice sites and intron-enhanced gene expression from a cDNA. Plant Mol. Biol. 31,1 -12.[CrossRef][Medline]
Hallmann, A. and Wodniok, S. (2006). Swapped green algal promoters: aphVIII-based gene constructs with Chlamydomonas flanking sequences work as dominant selectable markers in Volvox and vice versa. Plant Cell Rep. 25,582 -591.[CrossRef][Medline]
Hellen, C. U. and Sarnow, P. (2001). Internal
ribosome entry sites in eukaryotic mRNA molecules. Genes
Dev. 15,1593
-1612.
Higuchi, R. (1989). Using PCR to engineer DNA. In PCR Technology. Principles and Applications for DNA Amplification (ed. H. A. Erlich), pp.61 -70. New York: Stockton Press.
Hu, M. C., Tranque, P., Edelman, G. M. and Mauro, V. P.
(1999). rRNA-complementarity in the 5' untranslated region
of mRNA specifying the Gtx homeodomain protein: evidence that base-pairing to
18S rRNA affects translational efficiency. Proc. Natl. Acad. Sci.
USA 96,1339
-1344.
Ikeda, K. and Miyasaka, H. (1998). Compilation of mRNA sequences surrounding the AUG translation initiation codon in the green alga Chlamydomonas reinhardtii. Biosci. Biotechnol. Biochem. 62,2457 -2459.[CrossRef][Medline]
Kirk, D. L. (1997). The genetic program for germ-soma differentiation in Volvox. Annu. Rev. Genet. 31,359 -380.[CrossRef][Medline]
Kirk, D. L. (1998). Volvox: Molecular Genetic Origins of Multicellularity and Cellular Differentiation. Cambridge: Cambridge University Press.
Kirk, D. L. (2001). Germ-soma differentiation in Volvox. Dev. Biol. 238,213 -223.[CrossRef][Medline]
Kirk, D. L. and Kirk, M. M. (1983). Protein synthetic patterns during the asexual life cycle of Volvox carteri.Dev. Biol . 96,493 -506.[CrossRef][Medline]
Kirk, M. M. and Kirk, D. L. (1985). Translational regulation of protein synthesis, in response to light, at a critical stage of Volvox development. Cell 41,419 -428.[CrossRef][Medline]
Kirk, M. M., Stark, K., Miller, S. M., Müller, W., Taillon, B. E., Gruber, H., Schmitt, R. and Kirk, D. L. (1999). regA, a Volvox gene that plays a central role in germ-soma differentiation, encodes a novel regulatory protein. Development 126,639 -647.[Abstract]
Kozak, M. (1989). Circumstances and mechanisms
of inhibition of translation by secondary structure in eucaryotic mRNAs.
Mol. Cell. Biol. 9,5134
-5142.
Kozak, M. (2002). Pushing the limits of the scanning mechanism for initiation of translation. Gene 299, 1-34.[CrossRef][Medline]
Meissner, M., Stark, K., Cresnar, B., Kirk, D. L. and Schmitt, R. (1999). Volvox germline-specific genes that are putative targets of RegA repression encode chloroplast proteins. Curr. Genet. 36,363 -370.[CrossRef][Medline]
Pelletier, J., Flynn, M. E., Kaplan, G., Racaniello, V. and
Sonenberg, N. (1988). Mutational analysis of upstream AUG
codons of poliovirus RNA. J. Virol.
62,4486
-4492.
Pommerville, J. C. and Kochert, G. D. (1981). Changes in somatic cell structure during senescence of Volvox carteri.Eur. J. Cell Biol. 24,236 -243.[Medline]
Pommerville, J. and Kochert, G. (1982). Effects of senescence on somatic cell physiology in the green alga Volvox carteri.Exp. Cell Res . 140,39 -45.[CrossRef][Medline]
Pooggin, M. M., Hohn, T. and Futterer, J.
(2000). Role of a short open reading frame in ribosome shunt on
the cauliflower mosaic virus RNA leader. J. Biol.
Chem. 275,17288
-17296.
Rausch, H., Larsen, N. and Schmitt, R. (1989). Phylogenetic relationships of the green alga Volvox carteri deduced from small-subunit ribosomal RNA comparisons. J. Mol. Evol. 29,255 -265.[CrossRef][Medline]
Ryabova, L. A., Pooggin, M. M. and Hohn, T. (2002). Viral strategies of translation initiation: ribosomal shunt and reinitiation. Prog. Nucleic Acid Res. Mol. Biol. 72,1 -39.[Medline]
Schiedlmeier, B., Schmitt, R., Müller, W., Kirk, M. M.,
Gruber, H., Mages, W. and Kirk, D. L. (1994). Nuclear
transformation of Volvox carteri. Proc. Natl. Acad. Sci.
USA 91,5080
-5084.
Schmitt, R. (2003). Differentiation of germinal and somatic cells in Volvox carteri. Curr. Opin. Microbiol. 6,608 -613.[CrossRef][Medline]
Stark, K., Kirk, D. L. and Schmitt, R. (2001).
Two enhancers and one silencer located in the introns of regA control
somatic cell differentiation in Volvox carteri. Genes
Dev. 15,1449
-1460.
Starr, R. C. (1969). Structure, reproduction and differentiation in Volvox carteri f. nagariensis IYENGAR, strains HK9 and HK10. Arch. Protistenkunde 111,204 -222.
Starr, R. C. (1970). Control of differentiation in Volvox. Symp. Soc. Dev. Biol. 29, 59-100.[Medline]
Wang, X. Q. and Rothnagel, J. A. (2004).
5'-untranslated regions with multiple upstream AUG codons can support
low-level translation via leaky scanning and reinitiation. Nucleic
Acids Res. 32,1382
-1391.
Xi, Q., Cuesta, R. and Schneider, R. J. (2004).
Tethering of eIF4G to adenoviral mRNAs by viral 100k protein drives ribosome
shunting. Genes Dev. 18,1997
-2009.
Yueh, A. and Schneider, R. J. (1996). Selective
translation initiation by ribosome jumping in adenovirus-infected and
heat-shocked cells. Genes Dev.
10,1557
-1567.
Yueh, A. and Schneider, R. J. (2000).
Translation by ribosome shunting on adenovirus and hsp70 mRNAs facilitated by
complementarity to 18S rRNA. Genes Dev.
14,414
-421.
Zuker, M. (2003). Mfold web server for nucleic
acid folding and hybridization prediction. Nucleic Acids
Res. 31,3406
-3415.
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||