|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online September 28, 2006
doi: 10.1242/10.1242/dev.02567
1 DFG-Center of Molecular Physiology of the Brain, Department of Developmental
Biochemistry, University of Goettingen, Justus-von-Liebig-Weg 11, 37077
Goettingen, Germany.
2 Laboratoire Gènes, Développement et Neurogenèse, UMR CNRS
8080, Bâtiment 445, Université Paris XI, 91405 Orsay,
France.
3 Laboratoire d'Embryologie Moléculaire, Université Libre de
Bruxelles, Institut de Biologie et de Médecine Moléculaires
(IBMM), rue des Profs. Jeener et Brachet 12, 6041 Gosselies, Belgium.
Authors for correspondence (e-mail:
muriel.perron{at}ibaic.u-psud.fr
and
tpieler{at}gwdg.de)
Accepted 4 August 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: bHLH, Hes2, Gliogenesis, Neurogenesis, Retina, Cell cycle, Xenopus
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
)
(reviewed by Hatakeyama and Kageyama,
2004). However, mechanisms allowing the generation of glial versus
neuronal cells remain to be defined in detail.
Retinal Müller glial cells and neurons differentiate from a common
multipotent precursor (Turner and Cepko,
1987; Wetts and Fraser,
1988). Gliogenic activities of Notch signalling have been reported
in this context (for reviews, see Perron
and Harris, 2000; Pujic and
Malicki, 2004). Activation of Notch signalling indeed promotes
Müller glia differentiation (Bao and
Cepko, 1997; Furukawa et al.,
2000; Hojo et al.,
2000; Scheer et al.,
2001). Conversely, blocking Notch activity forces progenitors to
differentiate prematurely, leading to a decrease in late cell types, including
Müller glial cells (Austin et al.,
1995; Dorsky et al.,
1997; Silva et al.,
2003). More recently, an instructive role of the Notch pathway in
gliogenesis has been proposed, as the inhibition of both Notch and Delta
function in the zebrafish retina prevents Müller glia cells from
differentiating (Bernardos et al.,
2005).
In mammals, it has also been shown that Notch effectors, such as
Hes1 and Hes5, promote gliogenesis at the expense of the
neuronal fate in the retina (Furukawa et
al., 2000; Hojo et al.,
2000; Kageyama and Nakanishi,
1997). Conversely, interfering with Hes1 function reduces the
number of Müller glial cells
(Furukawa et al., 2000;
Takatsuka et al., 2004). Hes
genes are vertebrate homologues of Drosophila hairy and Enhancer
of split [E(spl)] genes, which encode basic helix-loop-helix
(bHLH) transcriptional repressors that negatively regulate neuronal bHLH genes
(Akazawa et al., 1992;
Chen et al., 1997;
Ishibashi et al., 1995;
Sasai et al., 1992;
Tomita et al., 1996).
Gliogenic properties of Hes proteins could result from this anti-neuronal
activity. Interestingly, however, some Hes-related proteins behave differently
in the retina. For example, although Hes1, Hes5 and Hesr2 bias retinal
precursors towards gliogenesis, Hesr1 or Hesr3 do not
(Furukawa et al., 2000;
Hojo et al., 2000;
Satow et al., 2001). The Hes6
protein even promotes neurogenesis (Bae et
al., 2000). The reason for these differences and the functional
relevance for each Hes-related protein in gliogenesis are yet to be
unravelled.
Recent work has provided evidence that cell fate determination is also
linked to cell proliferation (reviewed by
Ohnuma and Harris, 2003). The
timing of cell cycle exit may influence cell fate choice during retinogenesis,
as, according to the `competence model', precursors change their competence
over time (Livesey and Cepko,
2001). A gliogenic phenotype could thus be related to defects in
cell cycle exit. However, molecular pathways involved remain to be
investigated.
To gain further insight into the mechanisms that control neuronal versus glial fate choice, we aimed to identify novel gliogenic genes in the Xenopus retina. We report herein the characterization of one of these, encoding the bHLH-O type protein XHes2. XHes2 is mainly expressed in groups of cells giving rise to sensory organs, including the retina. We show that blocking XHes2 function reduces gliogenesis. Conversely, XHes2 overexpression dramatically increases glial cell production. Analysis of the underlying mechanisms shows that XHes2 forces gliogenesis by repressing neurogenesis and by affecting the timing of cell cycle exit of a subset of precursors. XHes2 may function by inhibition of proneural gene transcription and through its direct interaction with a subset of bHLH proteins, including NeuroD.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Zap cDNA library (Claussen
and Pieler, 2004) were selected for further screening performed
with the ECL Labelling and detection system (Amersham), following the
manufacturer's protocol. The sequence of the longest obtained XHes2
cDNA consists of 1075 nucleotides including 5'- and
3'-untranslated regions, as well as a poly(A) tail (GenBank Accession
Number DQ156231).
Expression constructs
pCS2+XHes2, pCS2+XHes2-
W and pCS2+XHes2-C, respectively,
encode the wild-type XHes2 protein, a shortened XHes2 protein devoid of the
WRPW motif, and a C-terminal truncated XHes2 variant missing the WRPW motif
and 51 additional amino acids, but still containing the Orange domain. These
constructs were generated by cloning the PCR products amplified from pBK-CMV
XHes2 into the pCS2+ vector (Turner and
Weintraub, 1994). pCS2+XHes2-W-VP16 and
pCS2+XHes2-C-VP16 encode XHes2 variants where the WRPW motif or the
C-terminal part was replaced by the VP16 transactivation domain
(Sadowski et al., 1988).
pCS2+XHes2-DBM encodes a DNA-binding mutant of XHes2, in which the basic amino
acids 37EKRRRARIN45 within the basic domain were
replaced by the acidic amino acids 37KEEEEAEID45, as was
done to obtain the DNA-binding mutant of ESR6e
(Deblandre et al., 1999), and
was generated by mutagenesis of pCS2+XHes2 using the QuikChange Site-Directed
Mutagenesis Kit (Stratagene). To ensure proper nuclear localization of
XHes2-DBM, pCS2+NLS-XHes2-DBM was constructed by inserting XHes2-DBM into
pCS2+NLS. For pCS2+XHes2(5')-GFP the 5'untranslated and
N-terminal-coding region of XHes2 were amplified by PCR from pBK-CMV XHes2 and
cloned in frame in front of GFP. Finally, pCS2+Flag-XHes2 and pCS2+MT-XHes2,
encoding N-terminal Flag and myc tagged versions of XHes2, were engineered by
subcloning XHes2 ORF from pCS2+XHes2 into pCS2+Flag and pCS2+MT
(Turner and Weintraub, 1994).
Cloning and mutagenesis primer sequences are available upon request. All other
expression constructs used in this study have been previously described: nLacZ
(Chitnis et al., 1995); MT-GFP
(Rubenstein et al., 1997);
Noggin5' (Smith and Harland,
1992); Notch ICD (Chitnis et
al., 1995); MT-XNgnr1 (Ma et
al., 1996); MT-NeuroD (Lee et
al., 1995); MT-Xath3, Flag-Xhairy1, Flag-Xhairy2b, Flag-ESR9 and
Flag-XHes6r (Taelman et al.,
2004); and MT-Xath5 (Kanekar
et al., 1997).
Morpholinos
Two non-overlapping antisense morpholino oligonucleotides (Mo) (Gene Tools)
against XHes2 were designed: Mo1 (ACAGACTAGGCAGCGGTGCT TC CAG) and
Mo2 (CTGCGAGCGCTACATTGGGAGCCAT). The control Mo (Con-Mo) corresponds to Mo2
with five mismatches (in lowercase, CTcCGAcCGCTAgATTGcGAGCgAT). Two types of
Mo have been used: crude Mo (for blastomere injection experiments); and
`Special Delivery' Mo, where the non-ionic crude morpholinos are paired to a
complementary carrier DNA (for lipofection experiments)
(Ohnuma et al., 2002).
In situ hybridization
Digoxigenin (DIG)-labelled antisense RNA probes for in situ hybridization
were generated according to the manufacturer's instructions (Roche).
XHes2 riboprobe was transcribed with T7 RNA polymerase from
the EcoRI linearized pBK-CMV-XHes2 vector. All other probes used have
been already described: NeuroD
(Lee et al., 1995),
N-tubulin (Oschwald et al.,
1991), Pax2 (Heller
and Brandli, 1997), Xhox11L2
(Patterson and Krieg, 1999),
Xlim3 (Taira et al.,
1993) and XNgnr1 (Ma
et al., 1996). Whole-mount in situ hybridization analysis was
performed as described by Hollemann et al.
(Hollemann et al., 1999),
except for expression on retinal cross-sections. In this case, we proceeded
according to Shimamura et al. (Shimamura
et al., 1994), with an additional step of bleaching just before
the proteinase K treatment (Broadbent and
Read, 1999). Embryos were then vibratome sectioned.
Embryos, microinjections and animal cap explants
Wild-type and albino Xenopus laevis embryos were obtained by
hormone-induced egg-laying and in vitro fertilization, and staged according to
Nieuwkoop and Faber (Nieuwkoop and Faber,
1994). Capped sense RNAs were transcribed using the mMessage
mMachine SP6 kit (Ambion). They were then injected animally in a
volume of approximately 5 nl into one of two
(Fig. 3B-E), one of eight
(Fig. 6A-I,K-V,
Fig. 7A-F) or two of two
(Fig. 3A,
Fig. 6J,
Fig. 7G,H) blastomeres of
Xenopus laevis embryos. The following amounts of RNA per embryo were
used: (Fig. 3B-E) 50 pg XNgnr1,
100 pg Notch ICD; (Fig. 4I-L)
400 pg XHes2(5')-GFP; (Fig.
6A-I,K-V) 12.5 pg XHes2, XHes2-W and XHes2-W-VP16;
(Fig. 7A-F) 12.5 pg MT-Ngnr1,
125 pg MT-NeuroD, 50 pg XHes2; (Fig.
3A) 100 pg XNgnr1, 300 pg Notch ICD, 500 pg Noggin;
(Fig. 6J) 25 pg
XHes2-C-VP16; (Fig.
7G,H) 100 pg MT-XHes2, MT-XNgnr1, MT-NeuroD, MT-Xath3, MT-Xath5,
Flag-XHes2, Flag-ESR9, Flag-Xhairy1, Flag-Xhairy2b, Flag-XHes6r. nlacZ RNA (50
pg) co-injection was used to visualize injected cells after histochemical
staining for ß-galactosidase activity. For the in vivo translation
experiments, 10 pg of each Mo together with 400 pg XHes2(5')-GFP RNA
were co-injected into two animal blastomeres of the eight cell stage, GFP
fluorescence was judged at stage 11. For the Mo injections, 10 to 20 pg of Mo
were micro-injected into one ventral-animal blastomere at the eight-cell
stage. Animal caps were dissected from stage 9 embryos and cultured until
control siblings had reached the appropriate stages.
Real-time RT-PCR analysis
Total RNA from animal caps or embryos was isolated using the RNeasy Mini
kit (Qiagen) and treated with DNase I (Qiagen). cDNA synthesis was carried out
with the Gene Amp RNA PCR core kit (Perkin-Elmer) followed by real-time PCR
analysis using gene specific primer pairs (available upon request), the iQ
SYBR Green Supermix (BioRad) and the iCycler iQ real-time detection system
(BioRad). Measurements of each experiment were done in duplicates. The copy
number of transcripts in the samples was determined for each analyzed gene
using the absolute standard curve method and then normalized to expression
levels of ornithine decarboxylase (ODC). Relative values for each gene were
obtained by relating the absolute copy number of each sample to the highest
absolute copy number which was set to 100.
In vivo lipofection
DNA were transfected into the presumptive region of the retina of stage
17-18 embryos as reported (Holt et al.,
1990; Ohnuma et al.,
2002). Mo (0.5 mM) in vivo lipofection was performed as previously
described (Boy et al., 2004).
For retinal cell types distribution analysis, GFP-positive cells were counted
on cryostat sections and identified based upon their laminar position and
morphology, as previously described
(Dorsky et al., 1995).
BrdU injection, immunohistochemistry and TUNEL assay
BrdU was injected intra-abdominally and was detected after a 45 minute
treatment in 2 N HCl. Immunohistochemistry was performed on 4%
paraformaldehyde fixed tissues. Cryostat sections (12 µm) were incubated
with primary antibodies (monoclonal anti-BrdU, Roche; polyclonal anti-GFP,
Molecular Probes; polyclonal anti-CRALB, a gift from Jack Saari), and specific
binding sites were visualized using anti-mouse or anti-rabbit fluorescent
secondary antibodies (Alexa, Molecular Probes). Detection of cell apoptosis
was carried out with the DeadEnd fluorometric TUNEL system (Promega),
following the manufacturer's instructions.
Immunoprecipitation and western-blot analysis
Immunoprecipitation experiments and western analysis were performed on
animal cap homogenates, as previously reported
(Taelman et al., 2004).
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Ledent et al., 2002). Further
database analysis identified two additional, closely related sequences from
zebrafish and Xenopus tropicalis. The phylogenetic relationship of
the Xenopus Hes2 proteins with mammalian and zebrafish Hes2 proteins
is underscored by a significant conservation of amino acids within and
flanking the bHLH and Orange (O) domains, which are crucial for DNA-binding
and dimerization (Davis and Turner,
2001; Leimeister et al.,
2000; Taelman et al.,
2004), and by the presence of a C-terminal WRPW motif, which is
known to bind the co-repressor groucho
(Fisher et al., 1996;
Grbavec and Stifani, 1996;
Paroush et al., 1994). Taken
together, these vertebrate Hes2 proteins exhibit typical features of both the
Hairy and E(spl) subfamilies of bHLH-O proteins
(Davis and Turner, 2001)
(Fig. 1A,B).
XHes2 is mainly expressed in developing sensory organs during Xenopus embryogenesis
The spatial and temporal distribution of XHes2 transcripts during
embryogenesis of Xenopus laevis was analyzed using whole-mount in
situ hybridization. Maternal XHes2 transcripts are present in the
animal half of early cleavage stage embryos until the beginning of
gastrulation (stage 10, data not shown). At stage 11, isolated
XHes2-positive cells can be detected in a scattered pattern in the
animal sphere of the embryo (Fig.
2A).
During neurulation and organogenesis, developing otic vesicles and retina
emerge as the two main expression domains for XHes2. As early as
stage 13.5 (early neural plate stage), two groups of cells, found at the
lateroanterior borders of the neural plate and corresponding to the
prospective otic placodes, are XHes2 positive
(Fig. 2B); these become even
more prominent as embryogenesis proceeds
(Fig. 2C,H), and eventually
persist in the dorsal region of the otic vesicles at stage 30 and beyond
(Fig. 2J-M). XHes2
transcripts are also transiently found in the olfactory placodes
(Fig. 2I). In addition, a weak
expression of XHes2 can be detected in discrete groups of cells,
first within the neuroectoderm during neurula stages and later in the brain
(see Fig. 2 legend for
details). In order to investigate whether XHes2 is expressed in primary
neurons, double in situ hybridization against XHes2 and
N-tubulin were performed (Fig.
2D). The stripes where XHes2 is expressed at stage 14.5
do indeed seem to overlap with the domains where primary neurons are present.
We further prepared cross-sections from embryos stained for XHes2 or
N-tubulin, respectively, in order to compare precisely their
expression patterns (Fig.
2E,F). XHes2 appears to be expressed in the superficial
layer where neuronal precursors continue to proliferate
(Chalmers et al., 2002),
whereas the N-tubulin-positive cells are present in the deeper layer
containing primary neurons. This suggests that XHes2 expression is
restricted to cycling neuronal precursor cells.
|
; Perron et al.,
1998).
|
;
Iso et al., 2003;
Koyano-Nakagawa et al., 1999;
Koyano-Nakagawa et al., 2000;
Lamar and Kintner, 2005;
Wettstein et al., 1997).
Similarly, overexpression of XNgnr1 resulted in a significant induction of
XHes2 expression in the animal cap assay
(Fig. 3A). In whole embryos,
misexpression of XNgnr1 abrogated the endogenous domains of XHes2
expression, whereas isolated scattered XHes2 positive cells appeared
ectopically, mainly in the non-neural ectoderm
(Fig. 3B,C). Such differential
regulation of XHes2 in ectoderm and neuroectoderm differs from what
has been observed for some other bHLH-O genes, such as ESR1 and
ESR7, which are uniformly activated in neuroectodermal and ectodermal
cells of whole embryos upon XNgnr1 misexpression
(Koyano-Nakagawa et al., 2000;
Lamar and Kintner, 2005).
Altogether, these data suggest that the XHes2 response to XNgnr1
depends on tissue/cell type-specific regulation.
In Notch ICD-injected embryos, ectopic XHes2-positive cells were
only detected along the lateral border of the neural plate
(Fig. 3D,E); similar effects
were observed following injection of the constitutively active Notch mediator
XSu(H)-Ank (data not shown). In the animal cap explant system, Notch ICD was
unable to induce XHes2 to any significant degree, both in naive and
neuralized animal caps (Fig.
3A). By contrast, the bHLH-O genes ESR1 and ESR7
were markedly induced by Notch ICD both in neuralized caps
(Fig. 3A) and in neuroectoderm
and ectoderm of neurula stage embryos
(Koyano-Nakagawa et al., 2000)
(data not shown). Thus, the transcriptional regulation of XHes2 is
clearly distinct from the one of other bHLH-O genes, such as ESR1 and
ESR7.
Perturbation of XHes2 activity in retinal progenitor cells affects gliogenesis and neuronal cell fate
As XHes2 is strongly expressed in the developing eye, we analysed whether
it might function in the context of retinogenesis. For this purpose, XHes2 was
overexpressed in the developing retina by in vivo lipofection. Retinal cell
clones overexpressing XHes2 contained a dramatic increase of Müller-like
cells (ranging from 45 to 75%), based on their morphology and position in the
retina, compared with less than 5% in control retinas
(Fig. 4A). Müller cell
identity could be confirmed by immunostaining using an anti-CRALBP antibody, a
marker of mature Müller glial cells
(Bunt-Milam and Saari, 1983);
in XHes2 lipofected retinas, 93.8% of GFP-positive cells exhibiting a
Müller cell morphology were indeed co-stained with the anti-CRALBP
antibody (n=210 cells, Fig.
4B-F). Thus, overexpression of XHes2 in the retina
strongly affects precursor cell fate decision, leading to a dramatic increase
of glial cells at the expense of neurons. Of note, retinas overexpressing a
mutant version of XHes2 [impaired in its DNA-binding activity
(XHes2-DBM)] did not exhibit any change in retinal cell distribution
when compared with the controls (n=1648 analysed cells for the
control and 923 for XHes2-DBM, data not shown), suggesting that the
DNA binding domain is necessary for XHes2 to promote the glial fate.
To confirm the gliogenic function of XHes2 during retinogenesis, we performed loss-of-function analysis using two antisense morpholino oligonucleotides against XHes2 (Mo1 and Mo2; Fig. 4G-L). In vivo lipofection of both morpholinos led to a significant decrease in Müller cells (Fig. 4M). This result, consistent with the above overexpression data, reinforces the view of XHes2 being critically involved in the control of gliogenesis. Of note, none of the other neuronal cell types showed any significant and reproducible change in its distribution (data not shown). Co-injection of Mo1 and a XHes2 construct devoid of the Mo1 target sequence rescued the loss-of-function phenotype and led to an increase in Müller cells similar to that observed with XHes2 alone.
|
W and
XHes2-W-VP16, respectively, see
Fig. 4N). As observed with
morpholinos, both mutants induced a significant decrease of Müller cells
upon expression in the developing retina
(Fig. 4O). Notably,
XHes2-W also generated a significant decrease of
ganglion cells and amacrine cells, associated with a significant increase of
photoreceptor cells (Fig. 4O).
Thus, disrupting XHes2 function by XHes2-W
not only affects gliogenesis, but also alters cell fate decisions of retinal
neurons. One could expect an even more severe phenotype if XHes2-W-VP16
is employed, considering its transcriptional activation capability.
Unexpectedly though, it produces the opposite effect on the distribution of
neurons, i.e. a decrease of photoreceptor cells, as well as an increase of
ganglion and amacrine cells (Fig.
4O). Thus, beside its role in gliogenesis, XHes2 could also be
involved in neuronal cell type specification.
XHes2 overexpression affects the proliferation of retinal precursors and the timing of Müller cell generation
To gain more insight into the mechanisms underlying XHes2 gliogenic
activity, we decided to investigate whether XHes2 affects precursor cell
proliferation. We therefore performed BrdU injection at various stages of
retinogenesis after prior lipofection with XHes2. At stage 30 and
33/34, the proportion of BrdU-positive cells among GFP clones in
XHes2-overexpressing retinas did not differ from that observed in
control retinas (Fig. 5A,B-G).
However, it was found to be significantly increased at both stage 35/36 and
stage 37/38 (Fig. 5A,H-M). This
excessive proliferation was not due to enhanced cell survival, as assessed by
the similar percentage of apoptotic cells found in GFP or
XHes2-overexpressing clones at stage 37 (1.58%±0.59,
n=442 cells and 1.69%±0.63, n=415 cells,
respectively). Therefore, these data strongly suggests that, from stage 34
onwards, XHes2 maintains a subset of precursors that should have exit the cell
cycle in a proliferative state. As Müller cells are normally the last
cell type to be born, such an increase in the proportion of late progenitor
cells surely contributes to the extra glial cell production. However this may
not be sufficient to explain the huge predominance of Müller cells among
retinal cell types. We thus investigated whether some Müller cells could
have been born before stage 34, despite the absence of proliferation defects.
For this purpose, we performed birthdating experiments by injecting BrdU into
stage 34 to stage 41 embryos lipofected with XHes2. Such experiments
allow to evaluate the timing of cell cycle exit of each differentiated cell
type. We observed that the percentage of BrdU-positive Müller glial cells
was significantly decreased in XHes2 lipofected retinas compared with
control retinas (Fig. 5N-Q).
Thus, a fraction of Müller cells observed in XHes2 transfected
retinas at stage 41 were born prematurely.
As a whole, the above data reveal that XHes2-dependent excessive gliogenesis occurs during the whole course of retinogenesis. Before stage 34, XHes2 seems to drive some early born cells, that would normally have given rise to neurons, to adopt a glial fate, apparently without affecting their proliferation. Thereafter, XHes2 is also able to prolong proliferation of a subset of precursors resulting in a second wave of extra Müller cell production.
XHes2 inhibits neuronal differentiation by repressing proneural gene transcription
XHes2 could act either as an instructive gliogenic factor or as a repressor
of neurogenesis. To test whether XHes2 has the ability to inhibit proneural
gene transcription, we analyzed specific gene expression during the process of
primary neurogenesis, following XHes2 overexpression or XHes2 knock-down.
Ectopic XHes2 inhibited expression of both XNgnr1 and
N-tubulin at the open neural plate stage
(Fig. 6A,B). Repression of
proneural and neuronal gene transcription persisted to late neurula stage
(Fig. 6K,M,O). Conversely,
inhibition of XHes2 expression with antisense morpholino oligonucleotides
resulted in ectopic expression of XNgnr1 in the presumptive otic
placode (Fig. 6C-E), strongly
suggesting that XHes2 acts physiologically as a repressor of neurogenesis in
its endogenous domain of expression.
|
W failed to inhibit XNgnr1 expression but still
repressed N-tubulin (Fig.
6F,H). This suggests that, at least during primary neurogenesis,
recruitment of transcriptional co-repressors through the WRPW motif
(Fisher et al., 1996;
Grbavec and Stifani, 1996;
Paroush et al., 1994) is not
an obligatory mechanism for XHes2 repressor activity. As XHes2 represses
proneural gene transcription, we tested whether antimorphic variants could
activate it. In an animal cap assay (Fig.
6J), overexpression of XHes2-C-VP16
induced XNgnr1 and NeuroD expression in explants cultivated
until the equivalent of early neurula stages; prolonged cultivation was found
to be necessary to observe the induction of late neuronal markers such as
N-tubulin and Xath3. We thus propose that
XHes2-C-VP16 is effective in promoting neuronal differentiation, albeit
in a delayed manner. Accordingly, XHes2-W-VP16
misexpression in whole embryos also promoted ectopic expression of
XNgnr1 in the non-neural ectoderm as early as the open neural plate
stage (Fig. 6G1-G3, 6L),
whereas ectopic expression of N-tubulin could only be observed in
later embryos (compare Fig. 6P with
6I). In order to determine the identity of these ectopic neurons,
we performed in situ analysis using probes against
sensory-(XHox11L2), motor-(Xlim3) or interneuron
(Pax2) markers. Expression of these genes was repressed by XHes2. By
contrast, XHes2-W-VP16 inhibited Xlim3 and Pax2, but
induced a strong ectopic expression of XHox11L2. Consequently, the
ectopic neurons forming in response to XHes2-W-VP16 can be classified
as sensory neurons (Fig.
6Q-V).
|
C-VP16
misexpression (Fig. 6J)
suggests that both genes constitute potential transcriptional targets of
XHes2. To investigate whether other mechanisms could also account for XHes2
anti-neuronal activity, we performed co-injection experiments of either
XNgnr1 or NeuroD together with XHes2. XHes2
repressed the XNgnr1-induced ectopic activation of N-tubulin
(Fig. 7A,B) and NeuroD
(Fig. 7C,D) suggesting that
XHes2 has the ability to repress NeuroD transcription downstream of
XNgnr1. Furthermore, we observed that NeuroD RNA injection
could not rescue the XHes2-dependent inhibition of neurogenesis
(Fig. 7E,F). These observations
clearly indicate that XHes2 serves a function downstream of NeuroD
gene regulation.
bHLH-O proteins have been reported to inhibit neuronal differentiation not
only as homodimers, but also by formation of heterodimers with other bHLH
proteins, thereby blocking their ability to activate the transcription of
downstream target genes (for reviews, see
Davis and Turner, 2001;
Iso et al., 2003). To
investigate whether the inhibitory effect of XHes2 on neurogenesis could
result from physical interactions with some bHLH proteins,
co-immunoprecipitation experiments were carried out on animal cap explants
misexpressing selected epitope tagged proteins. As shown in
Fig. 7G, XHes2 has the ability
to form homomeric complexes. In addition, it was also found to interact with
NeuroD, Xath3, Xhairy1 and XHes6r, but not with other bHLH proteins tested,
including XNgnr1 (Fig.
7G,H).
|
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Embryonic XHes2 expression profile is mainly restricted to developing sensory organs
The main expression characteristics of XHes2 are clearly distinct from
those of other known bHLH-O proteins in Xenopus. The most prominent
expression domains of XHes2 define groups of cells giving rise to
sensory organs. Some other bHLH-O genes, such as XHRT1, are also
specifically expressed in a subset of cells of the nervous system
(Pichon et al., 2002). By
contrast, many others, such as Hes5-like genes, are expressed in
general territories of primary neurogenesis and somitogenesis in
Xenopus (Koyano-Nakagawa et al.,
2000; Li et al.,
2003; Schneider et al.,
2001). Furthermore, XHes2 responsiveness to Notch
signalling or proneural bHLH proteins differs from that of E(spl) related
genes that are thought to be involved in lateral inhibition during primary
neurogenesis in Xenopus
(Koyano-Nakagawa et al., 1999;
Koyano-Nakagawa et al., 2000;
Lamar and Kintner, 2005;
Wettstein et al., 1997).
Indeed, injection of Notch ICD failed to induce XHes2
expression in naive or neuralized animal cap explants, as well as in
ectodermal and most neuroectodermal cells of intact embryos. Moreover,
XHes2 is activated only in a subset of ectodermal cells in whole
embryos by ectopic XNgnr1 and is even inhibited within the neural plate. These
findings are not compatible with the idea of XHes2 being a primary
target for Notch and being inducible by XNgnr1, at least in the early phases
of neurogenesis. A few other bHLH-O genes also display differences in the way
they are regulated by Notch signalling and XNgnr1, such as Xhairy2 or
XHRT1 (Lamar and Kintner,
2005; Lopez et al.,
2005; Pichon et al.,
2002), indicating a specific context-dependent control of bHLH-O
gene expression. Promoter analysis may be required to bring more insights into
the transcriptional regulation of XHes2.
Expression profiles of several Hes genes have been characterized
during murine retinogenesis. Hesr1, Hesr2, Hesr3, Hes1, Hes5 and
Hes6 are all first expressed in the ventricular zone of the retina,
which contains common, multipotent precursors for neurons and glial cells
(Bae et al., 2000;
Hojo et al., 2000;
Satow et al., 2001;
Tomita et al., 1996). As
development proceeds, some of them are maintained in differentiating or
differentiated retinal cell types. Hesr1 is expressed in both the
inner and outer region of the inner nuclear layer (INL), that contain amacrine
and horizontal cells, respectively (Satow
et al., 2001). Hesr2 expression is restricted to the
middle region of the INL containing bipolar and Müller cells
(Satow et al., 2001).
Hes5 is found in differentiating, but not mature, Müller cells
(Hojo et al., 2000).
Hes6 is expressed in ganglion cells and in the INL
(Bae et al., 2000). Thus, these
Hes genes are likely to act at several steps of retinogenesis. By contrast,
but similar to murine Hes1 and Hesr3
(Satow et al., 2001;
Tomita et al., 1996),
XHes2 is restricted to precursor cells, suggesting that it could be
involved in retinal cell fate decisions.
XHes2 acts as a gliogenic factor in the retina
In the rodent retina, Hes1, Hes5 and Hesr2 have been shown to promote
gliogenesis (Furukawa et al.,
2000; Hojo et al.,
2000; Satow et al.,
2001), while Hes6 has an opposite inhibitory effect upon
overexpression (Bae et al.,
2000). By contrast, Hesr1 and Hesr3 do not seem to play any role
in retinoblast fate decisions (Satow et
al., 2001). These observations demonstrate that Hairy/Enhancer of
Split family members expressed in the retina have distinct functions during
retinogenesis.
In the present paper, we show that XHes2 overexpression during retinogenesis in Xenopus leads to a dramatic increase of glial cells at the expense of neurons. Furthermore, XHes2 loss of function results in the opposite effect, i.e. a decrease of Müller cells. Two different hypotheses can be considered. As Müller cells are the latest cells to be born during retinogenesis, XHes2 overexpression could simply delay differentiation of retinal precursors. Alternatively, XHes2 could specifically promote gliogenesis and/or inhibit neurogenesis. In the first case, XHes2 overexpression should lead to an increase of all late born cells, including bipolar cells, combined with a decrease of early-born cells, such as ganglion cells. However, as we did not observe such a phenotype, we do not favour this hypothesis. Consequently, we propose that XHes2 is involved in the choice of glial versus neuronal cell fate. Some Hes genes expressed broadly in the nervous system may be part of a common genetic cascade controlling gliogenesis. By contrast, the restricted expression profile of XHes2 suggests that this repressor could control specific aspects of gliogenesis in sensory organs.
XHes2 gliogenic activity relies on its ability to repress neurogenesis through different mechanisms
Accumulating evidence suggests that components of the cell cycle molecular
machinery influence cell fate decision in the nervous system (for reviews, see
Ohnuma et al., 2001;
Ohnuma and Harris, 2003). In
line with this idea, we observed that XHes2-dependent excessive generation of
Müller cells correlates with a delayed timing of cell cycle arrest for
some retinal precursor cells. This is consistent with the recent finding that
the Hes-related gene Hes1 directly controls proliferation through
transcriptional repression of the cyclin-dependent kinase inhibitor, p27(Kip1)
(Murata et al., 2005).
However, whether XHes2 directly affects cell cycle exit and whether this is
the underlying mechanism for excessive Müller cell generation remains to
be elucidated. Alternatively, prolonged proliferation for XHes2-overexpressing
progenitors could be a consequence of instructive Müller cell fate
induction.
Besides, our results suggest that these changes in cell cycle exit timing are restricted to a subpopulation of retinal progenitors. Indeed, wild-type and XHes2 overexpressing retina exhibited a similar proportion of cell cycle withdrawal between stage 30 and 33/34. This suggests that XHes2 does not affect cell cycle exit timing of early-born cell types. Nevertheless, these early progenitors are sensitive to XHes2 gliogenic activity because, as inferred by our birthdating experiment, they also give rise to Müller cells following cell cycle arrest. We therefore propose that in addition to maintaining some precursors longer in the cell cycle, XHes2 is also able to re-direct early born cell types, that would otherwise have given rise to neurons, towards a glial fate. This most probably results from the ability of XHes2 to inhibit proneural gene activity. In the wild-type retina, cells that are born first express proneural genes, which lead them along the neurogenic pathway and inhibit gliogenesis. In view of our genetic interaction data, we propose that XHes2 overexpression prevents neurogenesis of early-born cells by inhibiting the activity of proneural genes, such as XNgnr1 or NeuroD. Consequently, the alternative fate is the Müller glial one. Further investigations would be necessary to know whether, in addition to inhibiting neurogenesis, XHes2 also possesses an instructive gliogenic activity. In addition, the putative coupling between the effects of XHes2 on the cell cycle and its neurogenesis inhibiting activity remains to be investigated.
Our data highlight different possible mechanisms through which XHes2 could
exert its neuronal inhibiting activity. As the DNA-binding domain appeared
necessary for XHes2 to inhibit neurogenenesis, XHes2 is likely to operate
through transcriptional control of target genes. We observed that endogenous
expression of XNgnr1 and NeuroD is repressed upon ectopic
expression of XHes2 in whole embryos. In addition, both genes are
simultaneously induced in early animal cap explants upon XHes2-C-VP16
misexpression. We cannot exclude the possibility that such effects may arise
from non-specific action of the overexpressed XHes2 constructs on any Hes
target genes sharing the same binding sites. However, the observation that
inhibition of endogenous XHes2 with morpholino oligonucleotides results in
ectopic XNgnr1 expression in presumptive otic placodal cells strongly
suggests that some proneural genes may indeed constitute potential
transcriptional targets of XHes2.
The observation that neither XNgnr1 nor NeuroD RNA
injection could rescue the XHes2-dependent inhibition of neurogenesis
suggested that XHes2 may also act through alternative mechanism(s), in
addition to its transcriptional repressing activity. Our data support the idea
that XHes2 forms multi-protein inhibitory complexes with proneural
transcription factors. XHes2 was found to co-immunoprecipitate in vivo with
NeuroD and Xath3, but not with XNgnr1 and Xath5 proneural bHLH proteins
(Kanekar et al., 1997;
Lee et al., 1995;
Ma et al., 1996;
Perron et al., 1999;
Takebayashi et al., 1997),
implying that XHes2 may antagonize NeuroD and Xath3 function via
protein-protein interactions. Furthermore, XHes2 interacts with the bHLH-O
proteins Xhairy1 and XHes6r (an allelic version of XHes6; M.S., unpublished).
Previous studies suggested that Hes6 promotes neuronal differentiation by
blocking the function of Hes1 proteins (Bae
et al., 2000; Gratton et al.,
2003; Koyano-Nakagawa et al.,
2000). The formation of XHes2-XHes6r heterodimers implies that
XHes6r may also antagonize XHes2 activity. Further investigations will be
necessary to confirm that XHes2 indeed inhibits proneural genes and proteins
in the retina. Nevertheless, the above data strongly suggest that XHes2 acts
as a gliogenic factor by taking part in the complex bHLH-O network of
interactions that finely control neurogenesis through mutual
cross-regulations.
XHes2 is involved in neural cell fate decision during retinogenesis
Overexpression of the XHes2 dominant-negative constructs, XHes2-
W and XHes2-W-VP16, decreases the
number of Müller cells but also alters the proper ratio of neuronal cell
types. This result suggests that XHes2, in addition to controlling the
neuron-glia ratio, may also be involved in neuronal cell fate decisions.
Surprisingly, lipofection of XHes2-W and XHes2-W-VP16 resulted
in opposite effects on neuron distribution. XHes2-W significantly
increased photoreceptors at the expense of ganglion and amacrine neurons,
whereas XHes2-W-VP16 increased ganglion and amacrine neurons at the
expense of photoreceptors. The different modes of action of XHes2-W and
XHes2-W-VP16 could explain such a discrepancy. As XHes2 acts as a
repressor, XHes2-W, which cannot bind the co-repressor groucho but
still binds DNA, may act in a dominant-negative manner, leading to a release
of XHes2-mediated gene inhibition. However, XHes2-W-VP16 possesses a
transcriptional activation domain and thus probably stimulates the
transcription of XHes2 target genes over a basal level. Consequently, it is
probable that the expression level of XHes2 target genes is different in
retinas lipofected with XHes2-W or with XHes2-W-VP16. The
balance in gene expression could thus differentially influence neuronal cell
fate decisions. The Hes1-knock out phenotype indirectly suggested a role of
Hes1 in controlling neuronal cell fate. Hes1-null mice develop severe
developmental eye defects, resulting from impaired morphogenesis, premature
differentiation and changes in cell type distribution, i.e. increase of
amacrine cells and decrease of bipolar cells
(Tomita et al., 1996). Our
loss-of-function analysis in the Xenopus retina allowed us to address
the impact of XHes2 on cell fate decisions directly, without affecting early
eye morphogenesis. We thus propose that XHes2 not only controls gliogenesis in
the retina but also influences the proper ratio of the different retinal
neurons.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Akazawa, C., Sasai, Y., Nakanishi, S. and Kageyama, R.
(1992). Molecular characterization of a rat negative regulator
with a basic helix-loop-helix structure predominantly expressed in the
developing nervous system. J. Biol. Chem.
267,21879
-21885.
Austin, C. P., Feldman, D. E., Ida, J. A., Jr and Cepko, C. L. (1995). Vertebrate retinal ganglion cells are selected from competent progenitors by the action of Notch. Development 121,3637 -3650.[Abstract]
Bae, S., Bessho, Y., Hojo, M. and Kageyama, R. (2000). The bHLH gene Hes6, an inhibitor of Hes1, promotes neuronal differentiation. Development 127,2933 -2943.[Abstract]
Bao, Z. Z. and Cepko, C. L. (1997). The
expression and function of Notch pathway genes in the developing rat eye.
J. Neurosci. 17,1425
-1434.
Bernardos, R. L., Lentz, S. I., Wolfe, M. S. and Raymond, P. A. (2005). Notch-Delta signaling is required for spatial patterning and Muller glia differentiation in the zebrafish retina. Dev. Biol. 278,381 -395.[CrossRef][Medline]
Boy, S., Souopgui, J., Amato, M. A., Wegnez, M., Pieler, T. and
Perron, M. (2004). XSEB4R, a novel RNA-binding protein
involved in retinal cell differentiation downstream of bHLH proneural genes.
Development 131,851
-862.
Broadbent, J. and Read, E. M. (1999). Wholemount in situ hybridization of Xenopus and zebrafish embryos. Methods Mol. Biol. 127,57 -67.[CrossRef][Medline]
Bunt-Milam, A. H. and Saari, J. C. (1983).
Immunocytochemical localization of two retinoid-binding proteins in vertebrate
retina. J. Cell Biol.
97,703
-712.
Chalmers, A. D., Welchman, D. and Papalopulu, N. (2002). Intrinsic differences between the superficial and deep layers of the Xenopus ectoderm control primary neuronal differentiation. Dev. Cell 2,171 -182.[CrossRef][Medline]
Chen, H., Thiagalingam, A., Chopra, H., Borges, M. W., Feder, J.
N., Nelkin, B. D., Baylin, S. B. and Ball, D. W. (1997).
Conservation of the Drosophila lateral inhibition pathway in human lung
cancer: a hairy-related protein (HES-1) directly represses achaete-scute
homolog-1 expression. Proc. Natl. Acad. Sci. USA
94,5355
-5360.
Chitnis, A., Henrique, D., Lewis, J., Ish-Horowicz, D. and Kintner, C. (1995). Primary neurogenesis in Xenopus embryos regulated by a homologue of the Drosophila neurogenic gene Delta. Nature 375,761 -766.[CrossRef][Medline]
Claussen, M. and Pieler, T. (2004). Xvelo1 uses a novel 75-nucleotide signal sequence that drives vegetal localization along the late pathway in Xenopus oocytes. Dev. Biol. 266,270 -284.[CrossRef][Medline]
Davis, R. L. and Turner, D. L. (2001). Vertebrate hairy and Enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene 20,8342 -8357.[CrossRef][Medline]
Deblandre, G. A., Wettstein, D. A., Koyano-Nakagawa, N. and Kintner, C. (1999). A two-step mechanism generates the spacing pattern of the ciliated cells in the skin of Xenopus embryos. Development 126,4715 -4728.[Abstract]
Dorsky, R. I., Rapaport, D. H. and Harris, W. A. (1995). XNotch inhibits cell differentiation in the Xenopus retina. Neuron 14,487 -496.[CrossRef][Medline]
Dorsky, R. I., Chang, W. S., Rapaport, D. H. and Harris, W. A. (1997). Regulation of neuronal diversity in the Xenopus retina by Delta signalling. Nature 385, 67-70.[CrossRef][Medline]
Fisher, A. L., Ohsako, S. and Caudy, M. (1996). The WRPW motif of the hairy-related basic helix-loop-helix repressor proteins acts as a 4-amino-acid transcription repression and protein-protein interaction domain. Mol. Cell. Biol. 16,2670 -2677.[Abstract]
Furukawa, T., Mukherjee, S., Bao, Z. Z., Morrow, E. M. and Cepko, C. L. (2000). rax, Hes1, and notch1 promote the formation of Muller glia by postnatal retinal progenitor cells. Neuron 26,383 -394.[CrossRef][Medline]
Gratton, M. O., Torban, E., Jasmin, S. B., Theriault, F. M.,
German, M. S. and Stifani, S. (2003). Hes6 promotes cortical
neurogenesis and inhibits Hes1 transcription repression activity by multiple
mechanisms. Mol. Cell. Biol.
23,6922
-6935.
Grbavec, D. and Stifani, S. (1996). Molecular interaction between TLE1 and the carboxyl-terminal domain of HES-1 containing the WRPW motif. Biochem. Biophys. Res. Commun. 223,701 -705.[CrossRef][Medline]
Hatakeyama, J. and Kageyama, R. (2004). Retinal cell fate determination and bHLH factors. Semin. Cell Dev. Biol. 15,83 -89.[CrossRef][Medline]
Heller, N. and Brandli, A. W. (1997). Xenopus Pax-2 displays multiple splice forms during embryogenesis and pronephric kidney development. Mech. Dev. 69, 83-104.[CrossRef][Medline]
Hojo, M., Ohtsuka, T., Hashimoto, N., Gradwohl, G., Guillemot, F. and Kageyama, R. (2000). Glial cell fate specification modulated by the bHLH gene Hes5 in mouse retina. Development 127,2515 -2522.[Abstract]
Hollemann, T., Panitz, F. and Pieler, T. (1999). In situ hybridization techniques with Xenopus embryos. In A Comparative Methods: Approach to the Study of Oocytes and Embryos (ed. J. D. Richter), pp.279 -290. Oxford: Oxford University Press.
Holt, C. E., Garlick, N. and Cornel, E. (1990). Lipofection of cDNAs in the embryonic vertebrate central nervous system. Neuron 4,203 -214.[CrossRef][Medline]
Ishibashi, M., Sasai, Y., Nakanishi, S. and Kageyama, R. (1993). Molecular characterization of HES-2, a mammalian helix-loop-helix factor structurally related to Drosophila hairy and Enhancer of split. Eur. J. Biochem. 215,645 -652.[Medline]
Ishibashi, M., Ang, S. L., Shiota, K., Nakanishi, S., Kageyama,
R. and Guillemot, F. (1995). Targeted disruption of mammalian
hairy and Enhancer of split homolog-1 (HES-1) leads to up-regulation of neural
helix-loop-helix factors, premature neurogenesis, and severe neural tube
defects. Genes Dev. 9,3136
-3148.
Iso, T., Kedes, L. and Hamamori, Y. (2003). HES and HERP families: multiple effectors of the Notch signaling pathway. J. Cell Physiol. 194,237 -255.[CrossRef][Medline]
Kageyama, R. and Nakanishi, S. (1997). Helix-loop-helix factors in growth and differentiation of the vertebrate nervous system. Curr. Opin. Genet. Dev. 7, 659-665.[CrossRef][Medline]
Kanekar, S., Perron, M., Dorsky, R., Harris, W. A., Jan, L. Y., Jan, Y. N. and Vetter, M. L. (1997). Xath5 participates in a network of bHLH genes in the developing Xenopus retina. Neuron 19,981 -994.[CrossRef]
