|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 4 October 2006
doi: 10.1242/dev.02607
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Burnham Institute for Medical Research, 10901 N. Torrey Pines Road, La Jolla,
CA 92037, USA.
2 Biological and Biomedical Sciences Graduate Program, Harvard Medical School,
Boston, MA 02115, USA.
3 Theodor-Boveri-Institute, Physiological Chemistry I, University of Wuerzburg,
D-97074 Wuerzburg, Germany.
4 Departments of Medicine and Cell and Developmental Biology, Vanderbilt
University School of Medicine, Nashville, TN 37232, USA.
* Author for correspondence (e-mail: mmercola{at}burnham.org)
Accepted 31 August 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Notch, Hairy-related transcription factor, HRT, HES, Hey, Gridlock, Atrioventricular canal, T-box, Tbx
| INTRODUCTION |
|---|
|
|
|---|
Models for specification of chamber versus AVC and IC myocardial fate have
begun to emerge that depend on the expression of specific combinations of
transcription factors (Abdelwahid et al.,
2001
; Chan-Thomas et al.,
1993
; Davis et al.,
2001
; Habets et al.,
2002
; Kupershmidt et al.,
1999
; Yamada et al.,
2000
). In particular, chamber-specific programs of gene expression
depend on a cooperative interaction between Tbx5 and the cardiac transcription
factor Nkx2.5, whereas Tbx2 inhibits Tbx5-dependent activation of chamber gene
expression in the AVC and IC (Habets et
al., 2002
; Harrelson et al.,
2004
; Plageman and Yutzey,
2004
; Stennard et al.,
2003
). Consequently, in the absence of Tbx2, the AVC and IC
regions fail to constrict and express early chamber markers
(Harrelson et al., 2004
).
Tbx20 also cooperates with Tbx5 and Tbx2 in the regulation of chamber fate
(Brown et al., 2005
;
Cai et al., 2005
;
Singh et al., 2005
;
Stennard et al., 2005
;
Takeuchi et al., 2005
).
Emerging evidence indicates that localized expression of Bmp2 within the
developing AVC and IC directs the spatiotemporal pattern of Tbx2 transcription
within the tubular heart (Yamada et al.,
2000
). Very little information exists on the signals that
establish the spatial patterns of transcription factor expression that
distinguish chamber from non-chamber myocardium other than Bmp, and the
upstream signals that control Bmp2 expression in the AVC and IC are largely
unknown. Therefore, we tested whether Notch and Hey proteins are involved in
the control of Bmp2 and, hence, AVC and IC identity.
Notch receptors encode transmembrane proteins that control numerous cell
fate decisions during vertebrate embryogenesis through cell-cell interactions
(for a review, see Artavanis-Tsakonas et
al., 1999
). In mammals, four Notch receptors (Notch1-Notch4)
recognize two classes of transmembrane ligands
(Lardelli et al., 1994
;
Uyttendaele et al., 1996
;
Weinmaster et al., 1991
;
Weinmaster et al., 1992
):
Serrate [Serrate1 and 2, commonly termed Jagged in mammals
(Lindsell et al., 1995
;
Shawber et al., 1996
)] and
Delta [comprising Delta-like1, 3 and 4
(Bettenhausen et al., 1995
;
Dunwoodie et al., 1997
;
Shutter et al., 2000
)]. For
canonical Notch signaling, the extracellular binding of ligand induces a
presenilin-dependent cleavage of Notch that releases its intracellular domain
(NotchICD) into the cytoplasm, where it forms a complex with the
DNA-binding protein CSL (CBF-1, Suppressor of Hairless, and Lag-2)
(Honjo, 1996
;
Jarriault et al., 1995
;
Jeffries et al., 2002
;
Tamura et al., 1995
) that in
turn activates the transcription of target genes, such as the Hairy/Enhancer
of Split (HES) family of transcriptional repressors, and the related
Hey1 and Hey2 genes (see below).
Homozygous CSL-/- mutants
(Oka et al., 1995
) and
presenilin1-/-,presenilin2-/- double mutants
(Donoviel et al., 1999
) die
during mid-gestation with widespread cell death and underdeveloped hearts, in
particular a thin, hypoplastic ventricular wall and impaired trabeculation.
Overtly similar defects are seen in homozygous Notch2 hypomorphs
(Hamada et al., 1999
;
McCright et al., 2001
) and
Notch1-/- (Conlon et al.,
1995
; Swiatek et al.,
1994
) embryos. Because CHDs often arise as consequences of
malformations elsewhere in the developing embryo, the direct effects of Notch
on myocardial development are not resolved by these systemic knockouts.
Nonetheless, in humans, attenuated Notch activation causes Alagille syndrome
(AGS), an autosomal dominant disorder characterized by CHDs, as well as
cholestasis, vertebral and eye abnormalities, distinctive facial features,
renal disease and growth retardation
(Krantz et al., 1997
). The
CHDs range from mild to severe and can include tetralogy of Fallot, pulmonary
artery stenosis, pulmonary atresia, truncus arteriosis, and ventricular and
atrial septal defects. Jagged1 mutations leading to haploinsufficiency cause
the syndrome in humans (Li et al.,
1997
; Oda et al.,
1997
) and AGS is phenocopied in the mouse by a reduction of Notch2
function in a heterozygous Jagged1+/null background
(McCright et al., 2002
).
Hey1 and Hey2 (also known as HRT2, CHF1, HESR2, HERP1 and gridlock) are
highly expressed in the developing heart and vasculature
(Chin et al., 2000
;
Kokubo et al., 1999
;
Leimeister et al., 1999
;
Nakagawa et al., 1999
;
Zhong et al., 2000
). In
mammals, these proteins are often referred to as Hairy-related transcriptional
repressors (HRT1 and HRT2, respectively) and the zebrafish homolog of Hey2 is
the product of gridlock. Hey proteins have conserved basic
helix-loop-helix (bHLH) and orange domains, and a YRPW motif near the C
terminus that differs from the WRPW motif found in the structurally related
HES proteins (reviewed by Fischer and
Gessler, 2003
; Iso et al.,
2003
). Disruption of Hey2 in mice causes ventricular
septal defects that are occasionally accompanied by other CHDs and
cardiomyopathy (Donovan et al.,
2002
; Gessler et al.,
2002
; Sakata et al.,
2002
). Hey1-/- mice lack apparent
cardiovascular phenotypes, but the spectrum of Hey2-/-
anomalies is extended in double Hey1/Hey2 homozygous mutants
to include a ubiquitous angiogenic remodeling deficit and strongly impaired
arterial endothelial development, leading to death by E10.5
(Fischer et al., 2004
).
Here, we show that Hey1 and Hey2 repress Bmp2 transcription in chick myocardium, thereby delimiting expression to within the developing AVC and IC as heart looping occurs. Hey-mediated repression of cardiac Bmp genes appears to be evolutionarily conserved in mice and zebrafish, as we observed ectopic cardiac Bmp transcription in mouse and zebrafish embryos with a disrupted Hey2 homolog. In addition, using the chick system, we provide evidence for a feedback mechanism whereby Tbx2, which is induced by Bmp2, inhibits both Hey1 and Hey2 expression, and we propose that this mechanism sharpens the border of Bmp2 transcription where chamber myocardium abuts the AVC and IC. Although both Hey1 and Hey2 suppress early cardiac Bmp2, we find that only Hey1 responds to Notch2 in chick hearts, thus leading to the model that segregation of prospective atrial and ventricular myocardium from AVC and IC regions by Hey proteins occurs in both a Notch-dependent and -independent manner.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-MEM (Gibco),
supplemented with 15% donor calf serum (Gibco), 5% chick serum (Gibco), 75
U/ml penicillin/streptomycin (Gibco), 10 mM HEPES buffer (Omega Scientific),
and 0.3% L-glutamine (Gibco)]. Hearts were then fixed in 4% paraformaldehyde
for 2 hours at room temperature and stored in 100% methanol at -20°C until
they were processed for histology.
Expression plasmids
Each cDNA was cloned into pRS2, a modified pCS2 expression vector, in which
the CMV promoter element was excised and an RSV promoter element cloned into
the SalI/HindIII sites upstream of the multi-cloning site.
Each cDNA was inserted into the pRS2 multi-cloning site as follows:
pRS2-CSL-VP16, CSL-VP16-Myc, BamHI/XbaI (generous gift of J.
Sklar, Brigham and Women's Hospital, MA, USA); pRS2-GFP (Myc-GFP,
BamHI/XbaI); pRS2-Mfng, Man3HA,
HindIII/XbaI (generous gift of T. Vogt, Merck Research
Laboratories, West Point, PA, USA); pRS2-Hey2, FlagHrt2,
HindIII/XhoI (generous gift of D. Srivastava, University of
California, San Francisco, CA, USA); and pRS2-N2ICD,
BamHI/StuI (generous gift of T. Maciag). To fuse PCR cloned
mouse Hey1 to a 5' Myc epitope in the pRS2 vector, R-GFP was
cut with EcoRI and XbaI to excise GFP, and mouse
Hey1 was inserted in frame at these sites.
To clone chick Hey2, HES and Notch cDNA, total RNA was prepared from HH stage 12-16 chick heart explants using TriZol reagent (Gibco) and the following degenerate primer pairs, where B=C,G,T; D=A,G,T; H=A,C,T; M=A,C; N=A,C,G,T; R=A,G; V=A,C,G; W=A,T;Y=C,T:
Hey2, 5'-CCCGCGGATCCAAYAGYTTGTCTGARCTG-3' and 5'-CCCCCGCGGCCGCCCAAGGYCTRTAGGGYTT-3';
Hes, 5'-CCCGCGGATCCAAYAGYTTGTCTGARCTG-3' or 5'-CCCGCGGATCCCARATGACWGTGGAYCAC-3', and 5'-CCCCCGCGGCCGCGTGRTCCACWGTCATYTG-3' or 5'-CCCCCGCGGCCGCCCAAGGYCTRTAGGGYTT-3'; and
Notch, 5'-TGATBCTYGGCHRCBMGVYTGGCHGT-3' and 5'-TTMACVGCNGCNGCCCARTGNARDGC-3'.
To clone mouse Hey1, PCR was performed on the Mouse Brain Marathon-Ready cDNA library (Clontech). The 5' primer (5'-ATGAAGCGCCCTTGTGAGG-3') includes the mouse Hey1 translational start codon, and the 3' primer (5'-TTAAAAGGCTCCAACTTCTG-3') includes the mouse Hey1 stop codon UAA.
In situ hybridization and epitope staining
Chick heart whole-mount in situ hybridization was performed as described
previously (Levin et al.,
1995
), with the following modifications for combined in situ
hybridization and immunohistochemistry. On day 1, after rehydration to PBT
(PBS+0.1% TWEEN), hearts were incubated in RIPA wash with primary monoclonal
antibodies against epitope tags for 45 minutes, followed by three 5-minute
washes in PBT, a second 45-minute RIPA wash with Cy3-conjugated AffiniPure
goat anti-mouse IgG diluted 1:100 (Jackson ImmunoResearch), and two 5-minute
washes in PBT before fixation in 4% paraformaldehyde and 0.2% glutaraldehyde.
Primary antibodies were anti-c-Myc 9E10 (Santa Cruz Biotechnology), anti-V5
antibody (Invitrogen), anti-HA HA.11 monoclonal antibody (Covance) and
anti-FLAG M2 (Sigma), and each was diluted 1:100 in RIPA, with the exception
of HA.11, which was diluted 1:1000 for immunohistochemistry.
Riboprobe templates for electroporated chick heart in situ hybridization were amplified from plasmids by PCR to eliminate the detection of plasmid DNA sequences. Each 3' primer was made with an embedded T7 promoter element. Primer pairs were: Bmp2,5'-ATGTTCGGGCTGAAGC-3' and 5'-GTAATACGACTCACTATAGGGCGATACACTCGCGGTG-3';
Hey1, 5'-ATCATCGAGAAGCGCCGCCGCGACCGCATC-3' and 5'-GAATTCTAATACGACTCACTATAGGGAGGACCGATCTCAGTCCC-3';
Hey2, 5'-AACAGTTTGTCTGAGCTGAGGCGGCTGGTG-3' and 5'-GAATTCTAATACGACTCACTATAGGGACACAGGAAGCAACGCTG-3'; and
Amhc, 5'-CGACGAGCGGGTCCAGCTTCTCCACTCC-3' and 5'-GAAAAATAATACGACTCACTATAGGGAGGCACCTTGACACGCCGC-3'.
Chick cDNAs for Cx42 (E. C. Beyer, University of Connecticut,
Farmington, CT, USA) and Irx4 (C. Cepko, Harvard Medical School,
Boston, MA, USA) were inserted in pBS, and Anf was PCR amplified from
cDNA and inserted into pGEM T-easy. Both plasmids have T7 and T3 promoters
flanking the inserts, so corresponding commercial primers were obtained for
amplification of the template (IDT). All probes were transcribed using T7 RNA
polymerase, with the exception of Cx42, which was transcribed with T3
RNA polymerase. Riboprobes for Serrate1, Serrate2 and
Delta-like1 were made as described
(Henrique et al., 1995
;
Laufer et al., 1997
;
Myat et al., 1996
).
Mouse embryo whole-mount in situ hybridization was carried out as described
previously (Leimeister et al.,
1998
). The riboprobe for mouse Bmp2 was generated from a PCR
fragment (GCGGGATCCGTTTGGCCTGAAGCAGAGAC, GCGGAATTCTGACGCTTTTCTCGTTTGTG) cloned
into pCS2. Zebrafish whole-mount in situ hybridization was performed as
described previously (Zhong et al.,
2000
). The Bmp4 riboprobe was as described
(Chen et al., 1997
).
Quantitative analyses
Quantification of the incidence of cells exhibiting altered gene expression
after electroporation in each case reflects cumulative data over greater than
three independent experiments. Identifying sample details were encoded prior
to embedding and histological sections were scored by collaborators lacking
knowledge of the experiments. Individual cells that expressed the
electroporated transgenes (epitope-specific immunostain) were scored as having
reduced, unchanged or elevated levels of the endogenous gene (in situ
hybridization stain) relative to immediately neighboring cells. Thus, a cell
in the midst of a patch of electroporated cells might show reduced expression
relative to non-electroporated cells, but would be scored as unchanged
relative to surrounding electroporated cells; thus, the analysis
underestimates the magnitude of the effects observed.
The atrioventricular length of the Bmp2 expression domain in mouse E9.5-E10.0 embryos was performed using ImageJ (National Institutes of Health, http://rsb.info.nih.gov/ij). AVC length was determined as a straight line in the center of the AVC. Head length was measured along a line drawn from the anterior limit of the olfactory pit to the back surface of the head, intersecting the posterior limit of the mesencephalon.
In situ hybridization and epitope staining
Following culture, samples were processed for combined in situ
hybridization, to detect endogenous gene expression, and immunohistochemistry,
to detect the epitope-tagged proteins expressed from the electroporated pRSV
construct. For immunohistochemistry, embryos were fixed in 4% paraformaldehyde
for 30 minutes at room temperature. Rabbit polycolonal antibody against
Notch2icd was used (Novus) with an alkaline phosphatase-conjugated
secondary antibody, and detection was with BCIP/NBT a substrate.
| RESULTS |
|---|
|
|
|---|
By stage 16, the Serrate expression patterns become complementary to that of Bmp2, which marks the developing AVC and IC (compare Fig. 1K,L with Fig. 1C,D,G,H). Thus, Serrate might distinguish chamber from AVC and IC myocardium by controlling the spatial domain of Bmp2 expression.
Two Notch receptor homologs, Notch1 and Notch2, have been identified in
chick (Hamada et al., 1999
;
Myat et al., 1996
); however,
only Notch2 was detected in the myocardium of the heart between HH stages 10
through 20 and is thus likely to mediate the Serrate signal. Low levels of
Notch2 were first detected in the stage 10 linear heart tube, in particular
within a smattering of cells in the ventral, presumptive ventricle and the
center of the fusing, bilateral atria (Fig.
1M). As looping proceeds, prominent Notch2 expression encompasses
the entire heart tube and persists through at least stage 20
(Fig. 1N-Q). Notch1 was not
detected in the myocardium at these stages, as examined by
immunohistochemistry, in situ hybridization or RT-PCR analysis (not
shown).
Activation of the Notch pathway suppresses Bmp2 gene expression
A whole-heart in vitro electroporation system was devised to study the
effects of misexpressed Notch pathway components
(Fig. 2). Explanted chick
hearts from HH stage 12 embryos were electroporated with RSV promoter-based
expression plasmids to direct production of exogenous proteins and then
cultured for 24 hours to the point when age-matched embryos had developed to
between HH stages 19 and 22. A panel of region-specific markers confirmed
appropriate development of the hearts after the procedure. Exogenous protein
was detected by immunohistochemistry against an epitope tag, and concurrent in
situ hybridization revealed the effect on endogenous marker gene
expression.
Paraffin sections of electroporated hearts revealed that ectopic Notch
pathway activation in the AVC and IC suppressed Bmp2 expression.
Either a Myc-tagged, human CSL DNA-binding region-VP16 transactivator
(CSL-VP16) or a V5 epitope-tagged Notch2ICD
(Small et al., 2003
)
cell-autonomously decreased the level of Bmp2 mRNA relative to that
in surrounding cells in the AVC and IC
(Fig. 3A,B). The response was
quantified by scoring transfected cells as having either increased, decreased
or similar levels of Bmp2 relative to their surrounding neighbors,
revealing reduced expression in 37.9% and 48.3% of CSL-VP16- or
Notch2ICD-expressing cells, respectively
(Fig. 3D). By contrast, a
control plasmid containing GFP fused to a Myc tag (GFP) did not elicit a
reproducible change in Bmp2 expression
(Fig. 3C,D). Notch activation
suppressed Bmp2 with similar efficacy at stages 12, 14 and 16
(Fig. 3E), indicating that
competence persists throughout this time window and might contribute to the
progressive shift in endogenous Serrate and Bmp2 expression
patterns.
It is important to emphasize that all samples in this and subsequent experiments were stripped of experimental identifiers and the identities encoded prior to embedding, so that histological preparation and scoring were performed blind. Moreover, our nearest neighbor analysis of single cells under-represented the magnitude of changes in gene expression, because cells in the midst of a cluster of transfected cells that all showed a similar response were scored as unchanged with respect to their neighbors, even though the entire cluster would be changed relative to untransfected cells.
|
Notch directly activates Hey1, but not Hey2
Electroporation of HH stage 12 hearts with Notch pathway agonists CSL-VP16
and Notch2ICD induced strong activation of endogenous Hey1
in the AVC and IC myocardium, with relative increases occurring in 50.0% and
33.6% of cells, respectively (Fig.
5A,B), implicating Notch signaling in direct activation of
Hey1. Upregulation was also apparent in the ventricular region over
endogenous expression levels, implying a dose-response mechanism (not shown).
As before, misexpression of the control plasmid containing GFP had no effect
(Fig. 5A). Surprisingly,
endogenous Hey2 transcripts were not induced by Notch pathway
agonists (Fig. 5A). To test the
effect of inhibiting Serrate/Notch2 signaling cell autonomously, we next
introduced the Manic Fringe glycosyltransferase, which inhibits responsiveness
to Serrate ligands in a highly selective and cell-autonomous manner
(Shimizu et al., 2001
;
Weinmaster and Kintner, 2003
).
HA-tagged mouse Mfng expressed following electroporation into stage 12 hearts
significantly reduced the level of endogenous Hey1 transcripts in
chamber myocardium (28.4% of transfected cells exhibited lowered levels of
expression relative to nearest neighbors), whereas GFP misexpression had no
effect (Fig. 5A,C).
Hey2 was unaffected by Notch pathway antagonists
(Fig. 5A). These experiments
indicate differential regulation of Hey1 and Hey2 in the
linear heart tube.
|
Notch and Hey proteins do not regulate the identity of chamber myocardium directly
Lineage choice by Notch can occur by suppressing and/or promoting
differentiation, depending on context. Two early chamber markers,
Cx42 and Anf, were examined to determine whether
Notch2-mediated suppression of AVC and IC fate was accompanied by a reciprocal
stimulation of chamber identity, which would be apparent by cell-autonomous,
ectopic activation of these genes in the AVC and IC region. Neither ectopic
Notch pathway activation, nor ectopic mouse Hey1 or Hey2 affected either gene
(Fig. 6). Thus, Notch2 in the
myocardium suppresses AVC and IC fate, but another signal must specify chamber
identity.
|
|
|
|
Expansion of the Bmp2 domain in AVC/IC of mouse and zebrafish embryos lacking Hey2 homologs
Having demonstrated that Hey proteins suppress Bmp2 in chick AVC/IC, we
tested whether loss of Hey function would cause a corresponding increase. As
discussed above, Hey2 (also known as HRT2 in mammals) is the only Hey homolog
transcribed in mouse ventricular myocardium (Hey1 is atrial) and targeted
disruption has not been correlated with early AVC defects. When E9.5 embryos
were analyzed by in situ hybridization, however, we found a distinct increase
in the Bmp2 expression domain relative to that of wild-type
littermates (Fig. 8A,B). The
linear length of the domain along the atrioventricular axis of the heart was
expanded approximately 1.7-fold, measured relative to either the head length
of the embryo (Fig. 8C,
P=0.005) or the maximal width of the mandibular arch (not shown,
P=0.005) in order to normalize for natural variation in embryo size
within a litter. Zebrafish gridlock (grl) is the only
Hey homolog expressed in the dorsal aorta and the early looping
heart, where transcripts are localized to ventricular and atrial myocardium
(Fischer et al., 2002
;
Zhong et al., 2000
) (H.J. and
T.P.Z., unpublished). We examined the expression of Bmp genes in the early
looping zebrafish heart at 48 hours postfertilization (hpf) and found that
Bmp4, rather than Bmp2, shows AVC expression
(Fig. 8D). grl mutants
showed ectopic inflow tract expression of Bmp4 and diffuse
ventricular myocardial expression (Fig.
8E). Neither species showed measurable expansion of Tbx2
homologs outside of the normal AVC expression domain (not shown), possibly
reflecting overriding repression by Tbx20 in ventricular myocardium
(Brown et al., 2005
;
Cai et al., 2005
;
Singh et al., 2005
;
Stennard et al., 2005
;
Takeuchi et al., 2005
).
|
| DISCUSSION |
|---|
|
|
|---|
|
|
How might Hey genes contribute to congenital cardiac defects such as those
present in AGS? Jagged1 haploinsufficient AGS patients can exhibit
atrial and ventricular septal defects and tetralogy of Fallot
(Li et al., 1997
;
McCright et al., 2002
;
Oda et al., 1997
). Bmp2, Bmp4
and Tbx2 regulate differentiation of the AVC, IC and outflow tract (OFT)
regions, so that chamber alignment and development of the valves, septa and
conduction system can proceed normally, probably by sustaining the AVC, IC and
OFT regions in what has been characterized as an immature, non-chamber state
(Moorman and Christoffels,
2003
). Our misexpression experiments in chicks, combined with our
analyses of mouse Hey2 and zebrafish grl mutants, suggest
that attenuation of ventricular Hey2 or atrial Hey1 function in human patients
would cause an expansion of Bmp2 into ventricular and atrial
myocardium, respectively, which we predict would have patterning and/or
morphogenetic consequences for structures that form at the border of the AVC
and IC with chamber myocardium. Interestingly, neither Hey2 mutant
mice nor zebrafish gridlock mutants showed a corresponding alteration
in Tbx2 and Tbx2a or Tbx2b, respectively, pointing
to the existence of other factors, such as Tbx20, that modulate responsiveness
downstream of Bmp. The morphological consequences of potential genetic
interactions between such factors and the genetic cascade identified here
would be best characterized using mouse models of loss of Notch2, Hey
and Tbx gene function. Recent studies have demonstrated Notch-dependent
endocardial effects on myocardial development
(Noseda et al., 2004
;
Raya et al., 2003
;
Timmerman et al., 2004
), and
paracrine effects from endocardial and epicardial sources are well established
(Baliga et al., 1999
;
Ford et al., 1999
;
Ozcelik et al., 2002
;
Zhao et al., 1998
),
underscoring the importance of using tissue-specific misexpression strategies
to distinguish intramyocardial effects from confounding indirect effects of
Notch components. Accordingly, we are investigating the myocardial role of
Notch2 in the control of Bmp2 and Hey genes, as well as potential
downstream Tbx, Iroquois and Hand genes, through the use of specific
myocardial conditional mutants that should overcome the severe cardiac
anomalies that are present in mouse embryos that have systemic deletions of
Notch2 or Notch signaling components.
In conclusion, our results indicate that Hey proteins play an unforeseen role in constraining Bmp expression to the AVC and IC during cardiac looping. The data also provide a novel role for Notch2 in this process directly within the developing myocardium that complements previous studies illustrating Notch function in endocardium. AVC malformations are particularly common, and mutations in Jagged/Serrate, Notch2 and both Hey proteins might occur in affected individuals. Indeed, mutations in Hey1 and Hey2 have been observed recently in patients with congenital heart disease (Deepak Srivastava, personal communication).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abdelwahid, E., Rice, D., Pelliniemi, L. J. and Jokinen, E.
(2001). Overlapping and differential localization of Bmp-2,
Bmp-4, Msx-2 and apoptosis in the endocardial cushion and adjacent tissues of
the developing mouse heart. Cell Tissue Res.
305, 67-78.[CrossRef][Medline]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Baliga, R. R., Pimental, D. R., Zhao, Y. Y., Simmons, W. W.,
Marchionni, M. A., Sawyer, D. B. and Kelly, R. A. (1999).
NRG-1-induced cardiomyocyte hypertrophy. Role of PI-3-kinase, p70(S6K), and
MEK-MAPK-RSK. Am. J. Physiol.
277,H2026
-H2037.[Medline]
Bettenhausen, B., Hrabe de Angelis, M., Simon, D., Guenet, J. L.
and Gossler, A. (1995). Transient and restricted expression
during mouse embryogenesis of Dll1, a murine gene closely related to
Drosophila Delta. Development
121,2407
-2418.[Abstract]
Brown, D. D., Martz, S. N., Binder, O., Goetz, S. C., Price, B.
M., Smith, J. C. and Conlon, F. L. (2005). Tbx5 and Tbx20 act
synergistically to control vertebrate heart morphogenesis.
Development 132,553
-563.
Bruneau, B. G., Nemer, G., Schmitt, J. P., Charron, F.,
Robitaille, L., Caron, S., Conner, D. A., Gessler, M., Nemer, M., Seidman, C.
E. et al. (2001). A murine model of Holt-Oram syndrome
defines roles of the T-box transcription factor Tbx5 in cardiogenesis and
disease. Cell 106,709
-721.[CrossRef][Medline]
Cai, C. L., Zhou, W., Yang, L., Bu, L., Qyang, Y., Zhang, X.,
Li, X., Rosenfeld, M. G., Chen, J. and Evans, S. (2005).
T-box genes coordinate regional rates of proliferation and regional
specification during cardiogenesis. Development
132,2475
-2487.
Chan-Thomas, P. S., Thompson, R. P., Robert, B., Yacoub, M. H.
and Barton, P. J. (1993). Expression of homeobox genes Msx-1
(Hox-7) and Msx-2 (Hox-8) during cardiac development in the chick.
Dev. Dyn. 197,203
-216.[Medline]
Chen, J. N., van Eeden, J. M., Warren, K. S., Chin, A.,
Nusslein-Volhard, C., Haffter, P. and Fishman, M. C. (1997).
Left-right pattern of cardiac BMP4 may drive asymmetry of the heart
in zebrafish. Development
124,4373
-4382.[Abstract]
Chin, M. T., Maemura, K., Fukumoto, S., Jain, M. K., Layne, M.
D., Watanabe, M., Hsieh, C. M. and Lee, M. E. (2000).
Cardiovascular basic helix loop helix factor 1, a novel tanscriptional
repressor expressed preferentially in the developing and adult cardiovascular
system. J. Biol. Chem.
275,6381
-6387.
Conlon, R. A., Reaume, A. G. and Rossant, J.
(1995). Notch1 is required for the coordinate segmentation of
somites. Development
121,1533
-1545.[Abstract]
Davis, D. L., Edwards, A. V., Juraszek, A. L., Phelps, A.,
Wessels, A. and Burch, J. B. (2001). A GATA-6 gene
heart-region-specific enhancer provides a novel means to mark and probe a
discrete component of the mouse cardiac conduction system. Mech.
Dev. 108,105
-119.[CrossRef][Medline]
de Jong, F., Opthof, T., Wilde, A. A., Janse, M. J., Charles,
R., Lamers, W. H. and Moorman, A. F. (1992). Persisting zones
of slow impulse conduction in developing chicken hearts. Circ.
Res. 71,240
-250.
Delorme, B., Dahl, E., Jarry-Guichard, T., Briand, J. P.,
Willecke, K., Gros, D. and Theveniau-Ruissy, M. (1997).
Expression pattern of connexin gene products at the early developmental stages
of the mouse cardiovascular system. Circ. Res.
81,423
-437.
Donovan, J., Kordylewska, A., Jan, Y. N. and Utset, M. F.
(2002). Tetralogy of fallot and other congenital heart defects in
Hey2 mutant mice. Curr. Biol.
12,1605
-1610.[CrossRef][Medline]
Donoviel, D. B., Hadjantonakis, A.-K., Ikeda, M., Zheng, H.,
Hyslop, P. and Bernstein, A. (1999). Mice lacking both
presenilin genes exhibit early embryonic patterning defects. Genes
Dev. 13,2801
-2810.
Dunwoodie, S. L., Henrique, D., Harrison, S. M. and Beddington,
R. S. (1997). Mouse Dll3: a novel divergent Delta gene which
may complement the function of other Delta homologues during early pattern
formation in the mouse embryo. Development
124,3065
-3076.[Abstract]
Dunwoodie, S. L., Clements, M., Sparrow, D. B., Sa, X., Conlon,
R. A. and Beddington, R. S. (2002). Axial skeletal defects
caused by mutation in the spondylocostal dysplasia/pudgy gene Dll3 are
associated with disruption of the segmentation clock within the presomitic
mesoderm. Development
129,1795
-1806.
Fischer, A. and Gessler, M. (2003). Hey genes
in cardiovascular development. Trends Cardiovasc. Med.
13,221
-226.[CrossRef][Medline]
Fischer, A., Leimeister, C., Winkler, C., Schumacher, N., Klamt,
B., Elmasri, H., Steidl, C., Maier, M., Knobeloch, K. P., Amann, K. et al.
(2002). Hey bHLH factors in cardiovascular development.
Cold Spring Harb. Symp. Quant. Biol.
67, 63-70.[CrossRef][Medline]
Fischer, A., Schumacher, N., Maier, M., Sendtner, M. and
Gessler, M. (2004). The Notch target genes Hey1 and Hey2 are
required for embryonic vascular development. Genes
Dev. 18,901
-911.
Fishman, M. C. and Chien, K. R. (1997).
Fashioning the vertebrate heart: earliest embryonic decisions.
Development 124,2099
-2117.[Abstract]
Ford, B. D., Loeb, J. A. and Fischbach, G. D.
(1999). Neuregulin stimulates DNA synthesis in embryonic chick
heart cells. Dev. Biol.
214,139
-150.[CrossRef][Medline]
Gessler, M., Knobeloch, K. P., Helisch, A., Amann, K.,
Schumacher, N., Rohde, E., Fischer, A. and Leimeister, C.
(2002). Mouse gridlock: no aortic coarctation or deficiency, but
fatal cardiac defects in Hey2 -/- mice. Curr. Biol.
12,1601
-1604.[CrossRef][Medline]
Habets, P. E., Moorman, A. F., Clout, D. E., van Roon, M. A.,
Lingbeek, M., van Lohuizen, M., Campione, M. and Christoffels, V. M.
(2002). Cooperative action of Tbx2 and Nkx2.5 inhibits ANF
expression in the atrioventricular canal: implications for cardiac chamber
formation. Genes Dev.
16,1234
-1246.
Hamada, Y., Kadokawa, Y., Okabe, M., Ikawa, M., Coleman, J. R.
and Tsujimoto, Y. (1999). Mutation in ankyrin repeats of the
mouse Notch2 gene induces early embryonic lethality.
Development 126,3415
-3424.[Abstract]
Hamburger, V. and Hamilton, H. L. (1951). A
series of normal stages in the development of the chick embryo. J.
Morphol. 88,49
-92.[CrossRef]
Harrelson, Z., Kelly, R. G., Goldin, S. N., Gibson-Brown, J. J.,
Bollag, R. J., Silver, L. M. and Papaioannou, V. E. (2004).
Tbx2 is essential for patterning the atrioventricular canal and for
morphogenesis of the outflow tract during heart development.
Development 131,5041
-5052.
Hayashi, H., Mochii, M., Kodama, R., Hamada, Y., Mizuno, N.,
Eguchi, G. and Tachi, C. (1996). Isolation of a novel chick
homolog of Serrate and its coexpression with C-Notch-1 in chick development.
Int. J. Dev. Biol. 40,1089
-1096.[Medline]
Henrique, D., Adam, J., Myat, A., Chitnis, A., Lewis, J. and
Ish-Horowicz, D. (1995). Expression of a Delta homologue in
prospective neurons in the chick. Nature
375,787
-790.[CrossRef][Medline]
Honjo, T. (1996). The shortest path from the
surface to the nucleus: RBP-J kappa/Su(H) transcription factor.
Genes Cells 1,1
-9.[Medline]
Icardo, J. M. and Fernandez-Teran, A. (1987).
Morphologic study of ventricular trabeculation in the embryonic chick heart.
Acta Anat. Basel 130,264
-274.[Medline]
Iso, T., Sartorelli, V., Chung, G., Shichinohe, T., Kedes, L.
and Hamamori, Y. (2001). HERP, a new primary target of Notch
regulated by ligand binding. Mol. Cell. Biol.
21,6071
-6079.
Iso, T., Kedes, L. and Hamamori, Y. (2003). HES
and HERP families: multiple effectors of the Notch signaling pathway.
J. Cell Physiol. 194,237
-255.[CrossRef][Medline]
Jarriault, S., Brou, C., Logeat, F., Schroeter, E. H., Kopan, R.
and Israel, A. (1995). Signalling downstream of activated
mammalian Notch. Nature
377,355
-358.[CrossRef][Medline]
Jeffries, S., Robbins, D. J. and Capobianco, A. J.
(2002). Characterization of a high-molecular-weight Notch complex
in the nucleus of Notch(ic)-transformed RKE cells and in a human T-cell
leukemia cell line. Mol. Cell. Biol.
22,3927
-3941.
Kokubo, H., Lun, Y. and Johnson, R. L. (1999).
Identification and expression of a novel family of bHLH cDNAs related to
Drosophila hairy and enhancer of split. Biochem. Biophys. Res.
Commun. 260,459
-465.[CrossRef][Medline]
Krantz, I. D., Piccoli, D. A. and Spinner, N. B.
(1997). Alagille syndrome. J. Med. Genet.
34,152
-157.
Kupershmidt, S., Yang, T., Anderson, M. E., Wessels, A.,
Niswender, K. D., Magnuson, M. A. and Roden, D. M. (1999).
Replacement by homologous recombination of the minK gene with lacZ reveals
restriction of minK expression to the mouse cardiac conduction system.
Circ. Res. 84,146
-152.
Lardelli, M., Dahlstrand, J. and Lendahl, U.
(1994). The novel Notch homologue mouse Notch 3 lacks specific
epidermal growth factor-repeats and is expressed in proliferating
neuroepithelium. Mech. Dev.
46,123
-136.[CrossRef][Medline]
Laufer, E., Dahn, R., Orozco, O. E., Yeo, C. Y., Pisenti, J.,
Henrique, D., Abbott, U. K., Fallon, J. F. and Tabin, C.
(1997). Expression of Radical fringe in limb-bud ectoderm
regulates apical ectodermal ridge formation. Nature
386,366
-373.[CrossRef][Medline]
Leimeister, C., Bach, A. and Gessler, M.
(1998). Developmental expression patterns of mouse sFRP genes
encoding members of the secreted frizzled related protein family.
Mech. Dev. 75,29
-42.[CrossRef][Medline]
Leimeister, C., Externbrink, A., Klamt, B. and Gessler, M.
(1999). Hey genes: a novel subfamily of hairy- and enhancer of
split related genes specifically expressed during mouse embryogenesis.
Mech. Dev. 85,173
-177.[CrossRef][Medline]
Leimeister, C., Dale, K., Fischer, A., Klamt, B., Hrabe de
Angelis, M., Radtke, F., McGrew, M. J., Pourquie, O. and Gessler, M.
(2000). Oscillating expression of c-Hey2 in the presomitic
mesoderm suggests that the segmentation clock may use combinatorial signaling
through multiple interacting bHLH factors. Dev. Biol.
227,91
-103.[CrossRef][Medline]
Levin, M., Johnson, R. L., Stern, C. D., Kuehn, M. and Tabin,
C. (1995). A molecular pathway determining left-right
asymmetry in chick embryogenesis. Cell
82,803
-814.[CrossRef][Medline]
Li, L., Krantz, I. D., Deng, Y., Genin, A., Banta, A. B.,
Collins, C. C., Qi, M., Trask, B. J., Kuo, W. L., Cochran, J. et al.
(1997). Alagille syndrome is caused by mutations in human
Jagged1, which encodes a ligand for Notch1. Nat.
Genet. 16,243
-251.[CrossRef][Medline]
Lindsell, C. E., Shawber, C. J., Boulter, J. and Weinmaster,
G. (1995). Jagged: a mammalian ligand that activates Notch1.
Cell 80,909
-917.[CrossRef][Medline]
Maier, M. M. and Gessler, M. (2000).
Comparative analysis of the human and mouse Hey1 promoter: Hey genes are new
Notch target genes. Biochem. Biophys. Res. Commun.
275,652
-660.[CrossRef][Medline]
McCright, B., Gao, X., Shen, L., Lozier, J., Lan, Y., Maguire,
M., Herzlinger, D., Weinmaster, G., Jiang, R. and Gridley, T.
(2001). Defects in development of the kidney, heart and eye
vasculature in mice homozygous for a hypomorphic Notch2 mutation.
Development 128,491
-502.[Abstract]
McCright, B., Lozier, J. and Gridley, T.
(2002). A mouse model of Alagille syndrome: Notch2 as a genetic
modifier of Jag1 haploinsufficiency. Development
129,1075
-1082.[Medline]
Moorman, A. F. and Christoffels, V. M. (2003).
Cardiac chamber formation: development, genes, and evolution.
Physiol. Rev. 83,1223
-1267.
Myat, A., Henrique, D., Ish-Horowicz, D. and Lewis, J.
(1996). A chick homologue of Serrate and its relationship with
Notch and Delta homologues during central neurogenesis. Dev.
Biol. 174,233
-247.[CrossRef][Medline]
Nakagawa, O., Nakagawa, M., Richardson, J. A., Olson, E. N. and
Srivastava, D. (1999). HRT1, HRT2, and HRT3: a new subclass
of bHLH transcription factors marking specific cardiac, somitic, and
pharyngeal arch segments. Dev. Biol.
216, 72-84.[CrossRef][Medline]
Nakagawa, O., McFadden, D. G., Nakagawa, M., Yanagisawa, H., Hu,
T., Srivastava, D. and Olson, E. N. (2000). Members of the
HRT family of basic helix-loop-helix proteins act as transcriptional
repressors downstream of Notch signaling. Proc. Natl. Acad. Sci.
USA 97,13655
-13660.
Noseda, M., McLean, G., Niessen, K., Chang, L., Pollet, I.,
Montpetit, R., Shahidi, R., Dorovini-Zis, K., Li, L., Beckstead, B. et al.
(2004). Notch activation results in phenotypic and functional
changes consistent with endothelial-to-mesenchymal transformation.
Circ. Res. 94,910
-917.
Oda, T., Elkahloun, A. G., Pike, B. L., Okajima, K., Krantz, I.
D., Genin, A., Piccoli, D. A., Meltzer, P. S., Spinner, N. B., Collins, F. S.
et al. (1997). Mutations in the human Jagged1 gene are
responsible for Alagille syndrome. Nat. Genet.
16,235
-242.[CrossRef][Medline]
Oka, C., Nakano, T., Wakeham, A., de la Pompa, J. L., Mori, C.,
Sakai, T., Okazaki, S., Kawaichi, M., Shiota, K., Mak, T. W. et al.
(1995). Disruption of the mouse RBP-J kappa gene results in early
embryonic death. Development
121,3291
-3301.[Abstract]
Ozcelik, C., Erdmann, B., Pilz, B., Wettschureck, N., Britsch,
S., Hubner, N., Chien, K. R., Birchmeier, C. and Garratt, A. N.
(2002). Conditional mutation of the ErbB2 (HER2) receptor in
cardiomyocytes leads to dilated cardiomyopathy. Proc. Natl. Acad.
Sci. USA 99,8880
-8885.
Plageman, T. F., Jr and Yutzey, K. E. (2004).
Differential expression and function of Tbx5 and Tbx20 in cardiac development.
J. Biol. Chem. 279,19026
-19034.
Raya, A., Koth, C. M., Buscher, D., Kawakami, Y., Itoh, T.,
Raya, R. M., Sternik, G., Tsai, H. J., Rodriguez-Esteban, C. and
Izpisua-Belmonte, J. C. (2003). Activation of Notch signaling
pathway precedes heart regeneration in zebrafish. Proc. Natl. Acad.
Sci. USA 100 Suppl.
1, 11889-11895.
Rones, M. S., Woda, J., Mercola, M. and McLaughlin, K. A.
(2002). Isolation and characterization of Xenopus Hey-1: A
downstream mediator of Notch signaling. Dev. Dyn.
225,554
-560.[CrossRef][Medline]
Sakata, Y., Kamei, C. N., Nakagami, H., Bronson, R., Liao, J. K.
and Chin, M. T. (2002). Ventricular septal defect and
cardiomyopathy in mice lacking the transcription factor CHF1/Hey2.
Proc. Natl. Acad. Sci. USA
99,16197
-16202.
Shawber, C., Boulter, J., Lindsell, C. E. and Weinmaster, G.
(1996). Jagged2: a serrate-like gene expressed during rat
embryogenesis. Dev. Biol.
180,370
-376.[CrossRef][Medline]
Shimizu, K., Chiba, S., Saito, T., Kumano, K., Takahashi, T. and
Hirai, H. (2001). Manic fringe and lunatic fringe modify
different sites of the Notch2 extracellular region, resulting in different
signaling modulation. J. Biol. Chem.
276,25753
-25758.
Shutter, J. R., Scully, S., Fan, W., Richards, W. G.,
Kitajewski, J., Deblandre, G. A., Kintner, C. R. and Stark, K. L.
(2000). Dll4, a novel Notch ligand expressed in arterial
endothelium. Genes Dev.
14,1313
-1318.
Singh, M. K., Christoffels, V. M., Dias, J. M., Trowe, M. O.,
Petry, M., Schuster-Gossler, K., Burger, A., Ericson, J. and Kispert, A.
(2005). Tbx20 is essential for cardiac chamber differentiation
and repression of Tbx2. Development
132,2697
-2707.
Small, D., Kovalenko, D., Soldi, R., Mandinova, A., Kolev, V.,
Trifonova, R., Bagala, C., Kacer, D., Battelli, C., Liaw, L. et al.
(2003). Notch activation suppresses fibroblast growth
factor-dependent cellular transformation. J. Biol.
Chem. 278,16405
-16413.
Small, E. M. and Krieg, P. A. (2003).
Transgenic analysis of the atrialnatriuretic factor (ANF) promoter: Nkx2-5 and
GATA-4 binding sites are required for atrial specific expression of ANF.
Dev. Biol. 261,116
-131.[CrossRef][Medline]
Srivastava, D. and Olson, E. N. (2000). A
genetic blueprint for cardiac development. Nature
407,221
-226.[CrossRef][Medline]
Stennard, F. A., Costa, M. W., Elliott, D. A., Rankin, S.,
Haast, S. J., Lai, D., McDonald, L. P., Niederreither, K., Dolle, P., Bruneau,
B. G. et al. (2003). Cardiac T-box factor Tbx20 directly
interacts with Nkx2-5, GATA4, and GATA5 in regulation of gene expression in
the developing heart. Dev. Biol.
262,206
-224.[CrossRef][Medline]
Stennard, F. A., Costa, M. W., Lai, D., Biben, C., Furtado, M.
B., Solloway, M. J., McCulley, D. J., Leimena, C., Preis, J. I., Dunwoodie, S.
L. et al. (2005). Murine T-box transcription factor Tbx20
acts as a repressor during heart development, and is essential for adult heart
integrity, function and adaptation. Development
132,2451
-2462.
Swiatek, P. J., Lindsell, C. E., Franco del Amo, F., Weinmaster,
G. and Gridley, T. (1994). Notch1 is essential for
postimplantation development in mice. Genes Dev.
8, 707-719.
Takeuchi, J. K., Mileikovskaia, M., Koshiba-Takeuchi, K., Heidt,
A. B., Mori, A. D., Arruda, E. P., Gertsenstein, M., Georges, R., Davidson,
L., Mo, R. et al. (2005). Tbx20 dose-dependently regulates
transcription factor networks required for mouse heart and motoneuron
development. Development
132,2463
-2474.
Tamura, K., Taniguchi, Y., Minoguchi, S., Sakai, T., Tun, T.,
Furukawa, T. and Honjo, T. (1995). Physical interaction
between a novel domain of the receptor Notch and the transcription factor
RBP-J kappa/Su(H). Curr. Biol.
5,1416
-1423.[CrossRef][Medline]
Timmerman, L. A., Grego-Bessa, J., Raya, A., Bertran, E.,
Perez-Pomares, J. M., Diez, J., Aranda, S., Palomo, S., McCormick, F.,
Izpisua-Belmonte, J. C. et al. (2004). Notch promotes
epithelial-mesenchymal transition during cardiac development and oncogenic
transformation. Genes Dev.
18, 99-115.
Uyttendaele, H., Marazzi, G., Wu, G., Yan, Q., Sassoon, D. and
Kitajewski, J. (1996). Notch4/int-3, a mammary
proto-oncogene, is an endothelial cell-specific mammalian Notch gene.
Development 122,2251
-2259.[Abstract]
Weinmaster, G. and Kintner, C. (2003).
Modulation of Notch signaling during somitogenesis. Annu. Rev. Cell
Dev. Biol. 19,367
-395.[CrossRef][Medline]
Weinmaster, G., Roberts, V. J. and Lemke, G.
(1991). A homolog of Drosophila Notch expressed during mammalian
development. Development
113,199
-205.[Abstract]
Weinmaster, G., Roberts, V. J. and Lemke, G.
(1992). Notch2: a second mammalian Notch gene.
Development 116,931
-941.[Abstract]
Yamada, M., Revelli, J. P., Eichele, G., Barron, M. and
Schwartz, R. J. (2000). Expression of chick Tbx-2, Tbx-3, and
Tbx-5 genes during early heart development: evidence for BMP2 induction of
Tbx2. Dev. Biol. 228,95
-105.[CrossRef][Medline]
Zhao, Y. Y., Sawyer, D. R., Baliga, R. R., Opel, D. J., Han, X.,
Marchionni, M. A. and Kelly, R. A. (1998). Neuregulins
promote survival and growth of cardiac myocytes. Persistence of ErbB2 and
ErbB4 expression in neonatal and adult ventricular myocytes. J.
Biol. Chem. 273,10261
-10269.
Zhong, T. P., Rosenberg, M., Mohideen, M.-A. P. K., Weinstein,
B. and Fishman, M. C. (2000). gridlock, an HLH gene required
for assembly of the aorta in zebrafish. Science
287,1820
-1824.
This article has been cited by other articles:
![]() |
V. M. Christoffels and A. F.M. Moorman Development of the Cardiac Conduction System: Why Are Some Regions of the Heart More Arrhythmogenic Than Others? Circ Arrhythm Electrophysiol, April 1, 2009; 2(2): 195 - 207. [Full Text] [PDF] |
||||
![]() |
K. R. Cordes and D. Srivastava MicroRNA Regulation of Cardiovascular Development Circ. Res., March 27, 2009; 104(6): 724 - 732. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J.D. Boukens, V. M. Christoffels, R. Coronel, and A. F.M. Moorman Developmental Basis for Electrophysiological Heterogeneity in the Ventricular and Outflow Tract Myocardium As a Substrate for Life-Threatening Ventricular Arrhythmias Circ. Res., January 2, 2009; 104(1): 19 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Collesi, L. Zentilin, G. Sinagra, and M. Giacca Notch1 signaling stimulates proliferation of immature cardiomyocytes J. Cell Biol., October 6, 2008; 183(1): 117 - 128. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Campa, R. Gutierrez-Lanza, F. Cerignoli, R. Diaz-Trelles, B. Nelson, T. Tsuji, M. Barcova, W. Jiang, and M. Mercola Notch activates cell cycle reentry and progression in quiescent cardiomyocytes J. Cell Biol., October 6, 2008; 183(1): 129 - 141. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Niessen and A. Karsan Notch Signaling in Cardiac Development Circ. Res., May 23, 2008; 102(10): 1169 - 1181. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Chi, R. M. Shaw, S. De Val, G. Kang, L. Y. Jan, B. L. Black, and D. Y.R. Stainier Foxn4 directly regulates tbx2b expression and atrioventricular canal formation Genes & Dev., March 15, 2008; 22(6): 734 - 739. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Stroud, V. Gaussin, J. B.E. Burch, C. Yu, Y. Mishina, M. D. Schneider, G. I. Fishman, and G. E. Morley Abnormal Conduction and Morphology in the Atrioventricular Node of Mice With Atrioventricular Canal Targeted Deletion of Alk3/Bmpr1a Receptor Circulation, November 27, 2007; 116(22): 2535 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Jia, I. N. King, S. S. Chopra, H. Wan, T. T. Ni, C. Jiang, X. Guan, S. Wells, D. Srivastava, and T. P. Zhong Vertebrate heart growth is regulated by functional antagonism between Gridlock and Gata5 PNAS, August 28, 2007; 104(35): 14008 - 14013. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wagner and M. A. Q. Siddiqui Signal Transduction in Early Heart Development (II): Ventricular Chamber Specification, Trabeculation, and Heart Valve Formation Experimental Biology and Medicine, July 1, 2007; 232(7): 866 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kokubo, S. Tomita-Miyagawa, Y. Hamada, and Y. Saga Hesr1 and Hesr2 regulate atrioventricular boundary formation in the developing heart through the repression of Tbx2 Development, February 15, 2007; 134(4): 747 - 755. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||