|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 October 2006
doi: 10.1242/dev.02648
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Center for Neuroscience, and Cell and Developmental Biology Graduate Group,
University of California, Davis, CA 95616, USA.
2 Section of Neurobiology, Physiology and Behavior, College of Biological
Sciences, and Department of Pathology and Laboratory Medicine, School of
Medicine, University of California, Davis, CA 95616, USA.
3 Genome Damage and Stability Centre, University of Sussex, Falmer, Brighton BN1
9RR, UK.
4 Department of Psychiatry and Behavioral Sciences, University of California,
Sacramento, CA 95817, USA.
* Author for correspondence (e-mail: hjcheng{at}ucdavis.edu)
Accepted 15 September 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Axon guidance, Netrin, unc-73, rac, P21-activated kinase
| INTRODUCTION |
|---|
|
|
|---|
During development, the ventral cord commissural motoneurons (VCCMNs),
which include DA, DB, DD, VD and AS neurons, are born on the ventral midline
of the animal. They express both UNC-5 and UNC-40, and their commissural axons
are thereby repelled by UNC-6/netrin located on the ventral side of the animal
(Wadsworth, 2002
). These
commissures migrate circumferentially around the animal along the dorsoventral
axis. The putative chemoattractant UNC-129, a TGFß homolog, is thought to
direct these axons into the dorsal cord
(Yu and Bargmann, 2001
). They
then extend along the dorsal cord, innervating their target muscle cells.
Collectively these VCCMNs function to control forward and reverse locomotion
of the animals. Among them, the cholinergic (DA, DB and AS) motoneurons
activate the dorsal muscles of the animals, while the GABAergic (DD and VD)
motoneurons coordinate firing of the ventral and dorsal muscles
(White et al., 1986
). While
the attractive and repulsive molecules that direct these neurons are fairly
well understood, much less is known about the subcellular signaling events
that interpret these cues. We have taken advantage of this system and used
forward genetics to identify new components in this conserved signaling
pathway (Huang et al., 2002
).
We have identified max-2, a C. elegans p21-activated kinase (PAK)
that is necessary for the dorsal guidance of the VCCMN axons.
PAKs are a group of highly conserved signaling molecules that control
cytoskeletal dynamics. Previous studies have demonstrated that PAKs are
effectors of the rac/cdc42 subfamily of rho type GTPases. PAKs were initially
discovered through their ability to bind activated (GTP-bound) forms of these
small GTPases (Manser et al.,
1994
). Each PAK consists of an N-terminal GTPase-binding domain
and a C-terminal serine/threonine kinase domain. The nominal activation
pathway for conventional PAKs has been described, in which an activated
rac/cdc42 molecule binds a PAK dimer, allowing relief from its self-inhibition
and subsequent activation of its kinase domain
(Bokoch, 2003
). This activated
PAK then goes on to target other downstream effectors, which include multiple
regulators of the cytoskeleton, such as myosin light chain kinase and LIM
kinase. In yeast, PAKs are required for invasive and vegetative growth
(Hofmann et al., 2004
). In
Drosophila, Pak1 is required for photoreceptor axon guidance
(Hing et al., 1999
). In
humans, a deficiency of PAK3 results in non-syndromic mental retardation,
attributed to a loss of dendritic complexity
(Allen et al., 1998
).
Here, we describe and characterize the three C. elegans PAKs. We find that two C. elegans PAKs function redundantly in P cell migrations with UNC-73/Trio and the rac GTPases, but are differentially required for UNC-6/netrin-mediated commissural motor axon guidance. We provide evidence that while PAK-1 is completely redundant with MAX-2 and functions with the rac GTPases during axon guidance, the newly identified max-2 is additionally required in a rac-independent pathway. Finally, we show that MAX-2 functions downstream of the receptor UNC-5 during UNC-6/netrin-mediated axon repulsion.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The following mutant alleles were used in these studies: LG I: unc-40(e1430), dpy-5(e61), unc-73(gm33), unc-73(e936), unc-73(rh40); LG II: max-2(cy2), max-2(nv162), rol-1(e91); LG III: pag-1(ls2); LG IV: unc-5(e53), dpy-20(e1282), unc-129(ev557), eri-1(mg366); LG V: pak-2(ok332), unc-34(e566), him-5(e1490), max-1(cy2); evIs41[Pmec-7::lacZ, Pmec-7::unc-5]; LG X: oxIs12[Punc-47::GFP, lin-15(+)], pak-1(ok448), unc-6(ev400), unc-6(ju152), mig-2(mu28).
Genetic mapping
max-2(cy2) was mapped to LG II by standard SNP methods
(Wicks et al., 2001
). Mapping
analysis placed max-2(cy2) between SNPs Y38F1A(41,752) and
W09E7(4,859). dsRNA of open reading frames (ORFs) from within this genomic
region were tested for their ability to elicit a phenotype
(Fraser et al., 2000
). Only
dsRNA from the predicted ORF Y38F1A.10 was found to cause axon guidance
defects. Sequencing of max-2(cy2) genomic DNA found a G-A
transition at Y38F1A (69,599 bp).
Deletion library screening
The max-2(nv162) allele was isolated by PCR screening of
a C. elegans UV/TMP mutagenized deletion library using the following
primers: nv162.f1, CTCTCTCTCAACCCGGCAGGAAG; nv162.f1',
CCGGCAGGAAGACTATATGACTC; nv162.r1, TGTCGTCGCTCTCTCACGCACCT; and nv162.r1',
CACAAAGAGGGAAGAAGATCCTC. Genotyping max-2(nv162) was
subsequently performed by using the inner (nv162.f1' and nv162.r1') primers
along with primer nv162.r2 CCTTCTTCTGATCGGCAAGACTG, which lies inside the
max-2(nv162) deletion.
Molecular biology
Cloning of DNA and generation of transgenes were accomplished by standard
techniques (Hobert, 2002
;
Shevchuk et al., 2004
). cDNAs
were generated by RT-PCR from total N2 RNA samples. One max-2 cDNA
was generated by ligating the 3' end of YK651h1 (gift from Yuji Kohara)
onto the 5' end of one of our cDNAs to generate a full-length
max-2 cDNA free of sequence changes. This was then cloned into a
pBluescript SK(+) vector to give the clone pHJ101. To generate the
max-2 rescue construct, a full-length max-2 cDNA was fused
to the promoter region of max-2 with PCR fusion techniques. Briefly
PCR was used to generate a partial max-2 cDNA (lacking the first two
exons) out of pHJ101 with primers PMM.f1 (CAGAAGTTCAGCGGACTGCCGCAA) and PBK.r1
(CAGCTATGACCATGATTACGCCA). The following primers ex.f
(GTTGCGTGCATATTCCGAACAGT) and ex.r (TTGCGGCAGTCCGCTGAACTTCTG) (complimentary
to PMM.f1) were used to generate a max-2 promoter region through the
beginning of the third exon from genomic DNA. The resulting two PCR fragments
were used as a template to generate the max-2 rescue construct by PCR
with primers mx2r.f' (GCTTGTCGAGTGTGCAATTTGTC) and mx2r.r'
(AATGGTTCAATTCTACAGTTTATAGATT). This PCR fusion product was cloned into a TOPO
XL vector to yield pHJ102.
Scoring of animals
DD and VD commissural defects were scored as previously described
(Huang et al., 2002
). Briefly,
the number of wild-type or defective commissures from a sample population was
counted and percent defects were determined by summing all the defective
commissures and dividing this by the number of commissures expected in the
same number of wild-type animals (17 commissures/animal). A commissure was
deemed to fail to reach the dorsal cord only if no part of the commissure
could be observed to connect to the dorsal cord. For constitutively active rac
experiments, the number of animals scored (n) was the combination of
at least two independently generated lines. All lines assayed showed the same
trends. Constitutively activated rac [rac(GF)] lines were
crossed into the mutant [pak-1(ok448) or
max-2(cy2)] background and
rac(GF);wild type and
rac(GF);mutant animals were isolated. The
rac(GF);wild type and
rac(GF);mutant animals were scored as first
cousins. For rac(GF) RNAi experiments transgenic lines were
generated in an eri-1(mg366)IV;oxIs12X background.
Transgenic animals were picked to a single plate and approximately half were
injected with dsRNA. The progeny of the injected and non-injected animals were
then scored. The rac(GF) constructs were generously donated by Erik Lundquist,
and each contains a rac gene with the equivalent to the canonical G12V
mutation under the control of the unc-115 promoter
(Struckhoff and Lundquist,
2003
).
P cell migration defects were scored by counting the number of laterally displaced VD neurons. VD neurons were identified by the expression of GFP in an oxIs12[Punc-47::GFP] background and by their gross morphology. VD neurons were counted as being laterally displaced if the cells were more than two cell widths from the ventral cord or had no visible connection to the ventral cord.
For the suppression of ectopic UNC-5 experiments, animals were fixed and
stained as described (Colavita and Culotti,
1998
). Touch receptor cells were scored as reaching the dorsal
cord if any part of the neuron reached the dorsal cord. Only the anteriormost
touch receptor cells (the ALMs and the AVM) were scored. Only animals in which
all of the anterior touch receptor cells could be seen to extend long axons
(or were directed into the DC) were scored.
| RESULTS |
|---|
|
|
|---|
We mapped the max-2(cy2) mutation to an approximately 200
kb region on chromosome II (Fig.
2A). We next used a reverse genetics candidate screen to identify
the max-2 gene. dsRNA from only one of the genes in this area
elicited an axon guidance phenotype. This predicted ORF Y38F1A.10 has homology
to PAKs (Hofmann et al.,
2004
). A partial cDNA clone (a gift from Yuji Kohara) was found to
span this predicted ORF and an adjacent one (F18A11.4) indicating that they
are, in fact, a single gene (Fig.
2A boxed region). Comparison with a syntenic region of C.
briggsae and knowledge of published PAK sequences allowed us to predict a
probable ORF consisting of parts of these two annotated ORFs. Isolation and
analysis of cDNAs confirmed this and demonstrated the genomic organization of
the max-2 gene (Fig.
2B). A minigene consisting of a 5 kb upstream element fused to a
max-2 cDNA (Fig. 2B)
was found to rescue the max-2(cy2) defect
(Fig. 2C).
max-2(cy2) and max-2(nv162) are likely null alleles
The max-2(cy2) allele has a missense mutation in the
ATP-binding region of the kinase domain. The resulting amino acid sequence
change is expected to convert a highly conserved glycine to a glutamate
(Fig. 2B,
Fig. 4A). This glycine is the
third in a group of glycines (gly-X-gly-X-X-gly) that are in the conserved
region of kinase subdomain I (Hanks et
al., 1988
). This change probably impairs the kinase activity by
altering the structure of the ATP-binding pocket. To further examine the
function of max-2, we analyzed the phenotype of
max-2(RNAi) animals and isolated an additional mutant allele
max-2(nv162). We found that RNAi of max-2 caused a
weaker but similar phenotype than either of our two mutants
(Fig. 2D).
|
To test this and to compare the defects of these two mutant alleles, we scored the severity of each mutant defect in the dorsal guidance of the DD and VD neurons. We found that the phenotypes of the two mutants were of similar nature and severity (Fig. 2D). Next we scored the severity of max-2(cy2)/max-2(nv162) animals and found that they were not significantly different from animals homozygous for either allele (data not shown). Taken together, these results indicate that both max-2(cy2) and max-2(nv162) are likely genetic nulls.
max-2 expression is required in neurons for axon guidance
To examine the expression of max-2, we generated promoter-GFP
fusions (Chalfie et al., 1994
;
Fire et al., 1990
). GFP
expression is nearly ubiquitous in the early embryo. At early comma stage
expression becomes intensely focused in the anterior of the embryo
(Fig. 3A). Strong expression is
observed from the pharynx and some unidentified head neurons beginning around
the 1.5-fold stage. After hatching, GFP expression is present in the ALM and
PLM neurons (Fig. 3D).
Beginning in late L1 stages expression comes on in the PVD neurons and some
time later in the AVM (Fig.
3D,E). Despite using the same upstream DNA elements utilized for
our rescue constructs with these promoter-GFP constructs, we did not observe
significant expression of GFP in VCCMNs.
To test whether max-2 functions cell autonomously to guide
motoneurons we expressed max-2 cDNAs under the control of
tissue-specific promoters. There are 26 GABAergic neurons, 19 of these (six DD
and 13 VD) send commissures dorsally and have defects in max-2
mutants. We used promoters from the characterized unc-25 and
unc-47 genes (Jin et al.,
1999
; McIntire et al.,
1997
) to drive expression of a max-2 cDNA specifically in
the GABAergic neurons of max-2(cy2) animals. Both these
promoter-cDNA fusions could rescue the defects of max-2(cy2)
mutants (Fig. 3F). We conclude
that MAX-2 functions cell autonomously in these neurons.
The C. elegans genome contains three p21-activated kinases
A database search of the C. elegans genome demonstrates the
existence of three C. elegans PAKs, including max-2.
Caenorhabditis elegans pak-1 has previously been cloned by degenerate PCR
and has been shown to co-localize with CED-10 and CDC-42 at late embryonic
stages (Chen et al., 1996
). Few
data exist on the other PAK (C45B11.1), which we find is SL1 transspliced and
will be hereafter referred to as C. elegans pak-2. Presented in
Fig. 4A is a kinase domain
alignment of the three C. elegans PAKs and some closely
related PAKs from other species. The overall structural differences of the
C. elegans PAKs are also compared in
Fig. 4B. These differences are
striking with respect to the site and number of the putative SH3-binding
motifs. An analysis of the PAK sequences from worms, flies and humans
demonstrates that C. elegans PAK-1 is most closely related to group
I/A PAKs and C. elegans PAK-2 is most closely related to group II/B
PAKs (Fig. 4C). The kinase
domain of MAX-2 is most closely related to group I/A PAKs
(Fig. 4A), while the N-terminal
region is more divergent than classic group I/A PAKs
(Zhao and Manser, 2005
). In
this respect, MAX-2 is most similar to Drosophila DmPAK3.
|
The double PAK mutants max-2(cy2);pak-1(ok448) were severely defective for DD and VD axon guidance (Fig. 5D,E). These animals were also uncoordinated, defective in egg laying and in DTC migrations, and exhibited ventral enclosure defects. RNAi was used to confirm these results independently (data not shown). max-2(cy2);pak-2(ok332) animals were superficially wild type and did not have DD and VD defects significantly worse than max-2(cy2) animals (Fig. 5E). pak-1(ok448);pak-2(ok332) animals had defects in embryogenesis and exhibited L1 lethality, but escapers were wild type for VCCMN guidance and appeared relatively coordinated. We conclude that PAK-2 does not play a role in the axon guidance of the VCCMNs, while max-2 and pak-1 function with some redundancy to control axon guidance.
PAK mutants are phenotypically similar to unc-73/Trio and rac mutants
PAKs are activated by racs. Racs are rho family GTPases, implicated in
controlling cell migrations and axon guidance by acting as molecular switches
that can relay and amplify cellular signals
(Hall, 1998
;
Lundquist, 2003
;
Luo et al., 1997
). Racs are
activated by guanine exchange factors (GEFs). Of the rac activators, which
coordinate rac activity during axon guidance, UNC-73/Trio is the best known
(Steven et al., 1998
). In
C. elegans, unc-73/Trio mutants have major defects in cell
migrations, axon outgrowth and axon guidance. The three C. elegans
racs (MIG-2, CED-10 and RAC-2) are activated during multiple developmental
processes by the GEF UNC-73/Trio
(Lundquist et al., 2001
;
Wu et al., 2002
;
Zipkin et al., 1997
).
Consistent with C. elegans PAKs being used in this UNC-73/Trio-rac
pathway, we found that
max-2(cy2);pak-1(ok448) double mutants
were phenotypically very similar to unc-73 mutants and also
ced-10(n1993);mig-2(mu28) double rac
mutant animals with respect to their mutant phenotypes in DD and VD axon
guidance and also in P cell migrations
(Fig. 5 and
Table 1). We chose to examine
in detail the roles that the C. elegans PAKs play during these two
different cellular processes. We first present data on PAK function in P cell
migrations and then examine PAK function in the UNC-6/netrin VCCMN
axon repulsion pathway.
|
|
We found that either max-2(cy2) or pak-1(ok448) only slightly increased the P cell migration defect of a weak unc-73 allele [unc-73(rh40)]. Interestingly, a double mutant of max-2(cy2) and a strong allele of unc-73 [unc-73(gm33)] did not increase the average number of ectopic P cells per animal found in the unc-73(gm33) allele alone (Table 1). It is important to note that null alleles of unc-73 are lethal, which precludes a definite conclusion that the PAKs act entirely with UNC-73 during P cell migrations. However, our observation that a loss of max-2 did not enhance the strong unc-73 allele, along with the weak enhancement observed in PAK;unc-73(rh40) double mutants, indicates that the two C. elegans PAKs (MAX-2 and PAK-1) act with UNC-73 in guiding P cell migrations. Finally, we found that any combination of rac;PAK double mutants either did not enhance, or only weakly enhanced, the defects of the single mutants (Table 1). This indicates that the PAKs function linearly with the racs to guide this process.
The C. elegans PAKs function differentially to control UNC-6/netrin-mediated VCCMN axon guidance
Of all the C. elegans rac and PAK single mutants, only
max-2 animals had significant defects in UNC-6/netrin-mediated VCCMN
axon guidance (Fig. 6A). To
determine if these molecules act together or in parallel, we systematically
analyzed double mutant combinations. Double mutants of either of the two rac
genes (ced-10 or mig-2) with pak-1 did not cause
defects in VCCMN guidance greater than any single mutant
(Fig. 6A). This is consistent
with PAK-1 and the racs acting linearly in this VCCMN guidance pathway.
Surprisingly, we found that max-2 double mutants with either of these
two rac genes greatly enhanced the VCCMN defects of max-2
(Fig. 6A). This indicates that
MAX-2 functions in parallel to the racs and PAK-1 during VCCMN guidance.
|
To further address whether this parallel rac-independent pathway exists, we
tested whether a loss of function in PAK gene activity could suppress the
defects resulting from constitutively active racs. We hypothesized that the
defects caused by a constitutively active molecule would be decreased when one
of its downstream effectors was lost, or conversely the loss of parallel
activity would cause an increase in these defects. We generated transgenic
animals that express constitutively active C. elegans racs under a
pan-neuronal promoter (Struckhoff and
Lundquist, 2003
). We found that loss of function in
pak-1(ok448) significantly suppressed the axon guidance
defects caused by the constitutively active rac, MIG-2
(Fig. 6B). We also found
consistent but nonsignificant suppression of the defects caused by
constitutively active CED-10 when we used RNAi to knock out pak-1
function. Generally, RNAi yields a weaker phenotype than null mutants,
particularly in neurons. For this reason we cannot conclude that PAK-1 does
not function downstream of CED-10. However, our results are consistent with
PAK-1 acting downstream of at least some of the rac GTPases.
Unlike pak-1, a loss of function in max-2 considerably enhanced the defects caused by constitutively active racs in all cases (Fig. 6C). This indicates that max-2 functions in a rac-independent pathway during commissural axon guidance. It is important to note that this does not exclude MAX-2 from functioning downstream of the racs as well. In our assay, the loss of MAX-2 parallel activity may have masked any suppression [of the rac(GF) induced defects] that was occurring. Collectively, our results indicate that PAK-1 functions with the racs, downstream of MIG-2 (at least) and that MAX-2 functions in parallel (at least partly) to this UNC-73-rac-PAK-1 pathway to guide the VCCMN axons.
|
The axon guidance defects caused by ectopic expression of the UNC-6/netrin receptor UNC-5 are partially suppressed by a loss of max-2
To test directly whether max-2 functions downstream of UNC-5 and
UNC-6/netrin, we determined whether a loss of max-2 function could
suppress the axon guidance effects of ectopically expressed UNC-5. Previously,
Hamelin and colleagues (Hamelin et al.,
1993
) demonstrated that if UNC-5 is ectopically expressed in the
touch receptor cells their axonal processes are re-routed away from
UNC-6/netrin. This effect absolutely requires UNC-6/netrin and demonstrates
that the machinery necessary for UNC-5 signaling is present in these cells.
This is the basis for a classic screen that has identified many genes required
for UNC-5 repulsion (Colavita and Culotti,
1998
). Our max-2 expression studies indicate that MAX-2
is present in several of these touch receptor cells. In particular, high
expression was observed in the anteriormost touch receptor cells (the ALMs and
the AVM) (Fig. 3D,E). We
reasoned that MAX-2 might be part of the signaling machinery usurped by the
ectopically expressed UNC-5, to misguide these axonal projections.
max-2(cy2) was crossed into the ectopic UNC-5 expressing strain NW798 (a gift from Joseph Culotti). max-2(cy2) mutants suppressed the guidance effects caused by the ectopic UNC-5 (Fig. 7A-C). We also found that in the max-2 mutant background the touch cell receptor axons that reach the dorsal cord take a less direct route, often stretching anteriorly for approximately half their length before turning toward the dorsal cord. The lack of absolute suppression observed from a loss of max-2 was quite similar to the defects observed in max-2 mutants. In both cases an apparently relatively small portion of UNC-5 signaling was lost. Our ectopic UNC-5 suppression results are therefore highly correlative to the situation found with the guidance of the VCCMNs, where a loss of max-2 is far less severe than a loss of unc-5. This confirms previous observations that there are multiple signaling pathways downstream of UNC-5, in UNC-6/netrin-induced axonal repulsion, and implicates MAX-2 as being integral to at least one of these cascades.
| DISCUSSION |
|---|
|
|
|---|
Each of the three C. elegans PAKs represents a distinct group of PAKs
In mammals, the PAK family is divided into two subgroups (I/A and II/B)
based on structural differences. Members from both PAK groups are implicated
in neuronal morphogenesis. The human PAK3, a group I/A PAK, is mutated in an
X-linked mental retardation (Allen et al.,
1998
). Knockout mice deficient for PAK4, a group II/B PAK, show
clear neuronal migration defects (Qu et
al., 2003
).
Drosophila melanogaster has three PAKs. The Drosophila
group I/A PAK (Pak1; previously know as Dpak1) has been shown to be required
along with NCK/Dock and UNC-73/Trio, for the guidance of photoreceptor axons
(Hing et al., 1999
;
Newsome et al., 2000
) and has
also been shown to function downstream of the chemorepellent slit in midline
axon guidance (Fan et al.,
2003
). The Drosophila group II/B PAK (Mbt), is believed
to regulate neuronal morphogenesis, rather than axon guidance
(Melzig et al., 1998
). A third
Drosophila PAK (Pak3) has sequence similarity to both group I/A and
group II/B PAKs (Mentzel and Raabe,
2005
). In vivo functional data on Drosophila Pak3 have
yet to be reported.
We found that there are three PAKs in the C. elegans genome.
Humans and mice contain six PAKs. Interestingly, we have found that the C.
elegans PAKs consist of single representative members from the two
mammalian PAK groups (I/A and II/B) and also a third more divergent member of
the PAK family. This phenomenon has previously been reported of D.
melanogaster (Mentzel and Raabe,
2005
). The differences in PAK representatives between mammals and
invertebrates may imply that an expanded repertoire of PAKs in both groups can
replace the functions of more divergent PAKs. The expansion probably suggests
a specialization of PAK activity for members within each group. Studying and
comparing PAK functions will lead to a better understanding of the signaling
specificity of different PAK member activities in vivo.
A model for PAK activity in P cell migration and VCCMN axon guidance
The C. elegans PAKs function redundantly in the UNC-73/Trio-rac
pathway to control the migration of P cells. Mutations in the individual PAK
genes did not lead to defects. However, double mutants of pak-1 and
max-2 did have defects in P cell migration. PAK mutants only weakly
enhanced unc-73(rh40). Mutations in max-2 did not
enhance the defects of a strong unc-73/Trio allele. These data
indicate that these PAKs function with UNC-73/Trio (see Fig. S2 in the
supplementary material). Loss of either of two of the rac genes
(mig-2 or ced-10) in either a max-2 or
pak-1 mutant background either weakly enhanced or had no defect
greater than any of the single mutants. These data indicate that the PAKs
function with the racs during this process. By examining the average number of
ectopic cells per animal, we noted that in the double PAK mutant the severity
of the P cell migration defects were less than that of the double rac
mutant, which in turn was less severe than the strong
unc-73(gm33) allele (Fig.
5F and Table 1).
This is consistent with a model in which a fraction of the P cell migration
activity of UNC-73 is controlled by the racs, and a fraction of this rac
activity is controlled by the PAKs (see Fig. S2 in the supplementary
material). This supports previous findings that UNC-73/Trio also stimulates
rho activity (in addition to racs), which in turn activates the rho kinase
(LET-502), facilitating the migration of P cells
(Spencer et al., 2001
).
|
It is interesting to note that several lines of evidence indicate a subtle preference by the racs for the PAKs. We found that for P cell migrations double mutants of ced-10 and pak-1 were weakly enhanced, while double mutants of mig-2 and pak-1 were not. We found that max-2 had a reversed relationship (Table 1). Additionally, we found that a loss of pak-1 significantly suppressed the defects caused by a constitutively active MIG-2 but did so to a lesser extent for CED-10. Conversely, a loss of max-2 greatly enhanced the defects of constitutively active MIG-2 but did so to a lesser extent for CED-10 (Fig. 6). Finally, double mutants of mig-2 and max-2 were enhanced much more than double mutants of ced-10 and max-2 (Fig. 6A). A subtle opposite relationship could also be seen for pak-1 (Fig. 6A). These data collectively argue that the preferred PAK for CED-10 is MAX-2, while the preferred PAK for MIG-2 is PAK-1. However, the fact that double mutants of max-2;mig-2 or pak-1;ced-10 do not equal a double PAK mutant indicate that either rac can use either PAK (Table 1).
|
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/22/4549/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allen, K. M., Gleeson, J. G., Bagrodia, S., Partington, M. W., MacMillan, J. C., Cerione, R. A., Mulley, J. C. and Walsh, C. A. (1998). PAK3 mutation in nonsyndromic X-linked mental retardation. Nat. Genet. 20, 25-30.[CrossRef][Medline]
Bokoch, G. M. (2003). Biology of the p21-activated kinases. Annu. Rev. Biochem. 72,743 -781.[CrossRef][Medline]
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. and Prasher, D.
C. (1994). Green fluorescent protein as a marker for gene
expression. Science 263,802
-805.
Chen, W., Chen, S., Yap, S. F. and Lim, L.
(1996). The Caenorhabditis elegans p21-activated kinase (CePAK)
colocalizes with CeRac1 and CDC42Ce at hypodermal cell boundaries during
embryo elongation. J. Biol. Chem.
271,26362
-26368.
Colavita, A. and Culotti, J. G. (1998). Suppressors of ectopic UNC-5 growth cone steering identify eight genes involved in axon guidance in Caenorhabditis elegans. Dev. Biol. 194,72 -85.[CrossRef][Medline]
Colavita, A., Krishna, S., Zheng, H., Padgett, R. W. and
Culotti, J. G. (1998). Pioneer axon guidance by UNC-129, a C.
elegans TGF-beta. Science
281,706
-709.
Dickson, B. J. (2002). Molecular mechanisms of
axon guidance. Science
298,1959
-1964.
Fan, X., Labrador, J. P., Hing, H. and Bashaw, G. J. (2003). Slit stimulation recruits Dock and Pak to the roundabout receptor and increases Rac activity to regulate axon repulsion at the CNS midline. Neuron 40,113 -127.[CrossRef][Medline]
Fire, A., Harrison, S. W. and Dixon, D. (1990). A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93,189 -198.[CrossRef][Medline]
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S. E. and Mello, C. C. (1998). Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391,806 -811.[CrossRef][Medline]
Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000). Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408,325 -330.[CrossRef][Medline]
Hall, A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.
Hamelin, M., Zhou, Y., Su, M. W., Scott, I. M. and Culotti, J. G. (1993). Expression of the UNC-5 guidance receptor in the touch neurons of C. elegans steers their axons dorsally. Nature 364,327 -330.[CrossRef][Medline]
Hanks, S. K., Quinn, A. M. and Hunter, T.
(1988). The protein kinase family: conserved features and deduced
phylogeny of the catalytic domains. Science
241, 42-52.
Hedgecock, E. M., Culotti, J. G. and Hall, D. H. (1990). The unc-5, unc-6, and unc-40 genes guide circumferential migrations of pioneer axons and mesodermal cells on the epidermis in C. elegans. Neuron 4,61 -85.[CrossRef][Medline]
Hing, H., Xiao, J., Harden, N., Lim, L. and Zipursky, S. L. (1999). Pak functions downstream of Dock to regulate photoreceptor axon guidance in Drosophila. Cell 97,853 -863.[CrossRef][Medline]
Hobert, O. (2002). PCR fusion-based approach to create reporter gene constructs for expression analysis in transgenic C. elegans. Biotechniques 32,728 -730.[Medline]
Hofmann, C., Shepelev, M. and Chernoff, J.
(2004). The genetics of Pak. J. Cell Sci.
117,4343
-4354.
Huang, X., Cheng, H.-J., Tessier-Lavigne, M. and Jin, Y. (2002). MAX-1, a novel PH/MyTH4/FERM domain cytoplasmic protein implicated in netrin-mediated axon repulsion. Neuron 34,563 -576.[CrossRef][Medline]
Iino, Y. and Yamamoto, M. (1998). Expression pattern of the C. elegans P21-activated protein kinase, CePAK. Biochem. Biophys. Res. Commun. 245,177 -184.[CrossRef][Medline]
Ishii, N., Wadsworth, W. G., Stern, B. D., Culotti, J. G. and Hedgecock, E. M. (1992). UNC-6, a laminin-related protein, guides cell and pioneer axon migrations in C. elegans. Neuron 9,873 -881.[CrossRef][Medline]
Jin, Y., Jorgensen, E., Hartwieg, E. and Horvitz, H. R.
(1999). The Caenorhabditis elegans gene unc-25 encodes glutamic
acid decarboxylase and is required for synaptic transmission but not synaptic
development. J. Neurosci.
19,539
-548.
Lundquist, E. A. (2003). Rac proteins and the control of axon development. Curr. Opin. Neurobiol. 13,384 -390.[CrossRef][Medline]
Lundquist, E. A., Reddien, P. W., Hartwieg, E., Horvitz, H. R. and Bargmann, C. I. (2001). Three C. elegans Rac proteins and several alternative Rac regulators control axon guidance, cell migration and apoptotic cell phagocytosis. Development 128,4475 -4488.
Luo, L., Jan, L. Y. and Jan, Y. N. (1997). Rho family GTP-binding proteins in growth cone signalling. Curr. Opin. Neurobiol. 7,81 -86.[CrossRef][Medline]
Manser, E., Leung, T., Salihuddin, H., Zhao, Z. S. and Lim, L. (1994). A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature 367, 40-46.[CrossRef][Medline]
McIntire, S. L., Reimer, R. J., Schuske, K., Edwards, R. H. and Jorgensen, E. M. (1997). Identification and characterization of the vesicular GABA transporter. Nature 389,870 -876.[CrossRef][Medline]
Melzig, J., Rein, K. H., Schafer, U., Pfister, H., Jackle, H., Heisenberg, M. and Raabe, T. (1998). A protein related to p21-activated kinase (PAK) that is involved in neurogenesis in the Drosophila adult central nervous system. Curr. Biol. 8,1223 -1226.[CrossRef][Medline]
Mentzel, B. and Raabe, T. (2005). Phylogenetic and structural analysis of the Drosophila melanogaster p21-activated kinase DmPAK3. Gene 349,25 -33.[CrossRef][Medline]
Newsome, T. P., Schmidt, S., Dietzl, G., Keleman, K., Asling, B., Debant, A. and Dickson, B. J. (2000). Trio combines with dock to regulate Pak activity during photoreceptor axon pathfinding in Drosophila. Cell 101,283 -294.[CrossRef][Medline]
Qu, J., Li, X., Novitch, B. G., Zheng, Y., Kohn, M., Xie, J. M.,
Kozinn, S., Bronson, R., Beg, A. A. and Minden, A. (2003).
PAK4 kinase is essential for embryonic viability and for proper neuronal
development. Mol. Cell. Biol.
23,7122
-7133.
Serafini, T., Kennedy, T. E., Galko, M. J., Mirzayan, C., Jessell, T. M. and Tessier-Lavigne, M. (1994). The netrins define a family of axon outgrowthpromoting proteins homologous to C. elegans UNC-6. Cell 78,409 -424.[CrossRef][Medline]
Shevchuk, N. A., Bryksin, A. V., Nusinovich, Y. A., Cabello, F.
C., Sutherland, M. and Ladisch, S. (2004). Construction of
long DNA molecules using long PCR-based fusion of several fragments
simultaneously. Nucleic Acids Res.
32, e19.
Spencer, A. G., Orita, S., Malone, C. J. and Han, M.
(2001). A RHO GTPase-mediated pathway is required during P cell
migration in Caenorhabditis elegans. Proc. Natl. Acad. Sci.
USA 98,13132
-13137.
Steven, R., Kubiseski, T. J., Zheng, H., Kulkarni, S., Mancillas, J., Ruiz Morales, A., Hogue, C. W., Pawson, T. and Culotti, J. (1998). UNC-73 activates the Rac GTPase and is required for cell and growth cone migrations in C. elegans. Cell 92,785 -795.[CrossRef][Medline]
Struckhoff, E. C. and Lundquist, E. A. (2003).
The actin-binding protein UNC-115 is an effector of Rac signaling during axon
pathfinding in C. elegans. Development
130,693
-704.
Sulston, J. E. and Horvitz, H. R. (1977). Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev. Biol. 56,110 -156.[CrossRef][Medline]
Tessier-Lavigne, M. and Goodman, C. S. (1996).
The molecular biology of axon guidance. Science
274,1123
-1133.
Wadsworth, W. G. (2002). Moving around in a worm: netrin UNC-6 and circumferential axon guidance in C. elegans. Trends Neurosci. 25,423 -429.[CrossRef][Medline]
White, J., Southgate, E., Thomson, J. and Brenner, S. (1986). The structure of the nervous system of the nematode Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. Biol. Sci. 314,1 -340.
Wicks, S. R., Yeh, R. T., Gish, W. R., Waterston, R. H. and Plasterk, R. H. (2001). Rapid gene mapping in Caenorhabditis elegans using a high density polymorphism map. Nat. Genet. 28,160 -164.[CrossRef][Medline]
Wu, Y. C., Cheng, T. W., Lee, M. C. and Weng, N. Y. (2002). Distinct rac activation pathways control Caenorhabditis elegans cell migration and axon outgrowth. Dev. Biol. 250,145 -155.[CrossRef][Medline]
Yu, T. W. and Bargmann, C. I. (2001). Dynamic regulation of axon guidance. Nat. Neurosci. Suppl. 4,1169 -1176.
Zhao, Z. S. and Manser, E. (2005). PAK and other Rho-associated kinases - effectors with surprisingly diverse mechanisms of regulation. Biochem. J. 386,201 -214.[CrossRef][Medline]
Zipkin, I. D., Kindt, R. M. and Kenyon, C. J. (1997). Role of a new Rho family member in cell migration and axon guidance in C. elegans. Cell 90,883 -894.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. J. Coniglio, S. Zavarella, and M. H. Symons Pak1 and Pak2 Mediate Tumor Cell Invasion through Distinct Signaling Mechanisms Mol. Cell. Biol., June 15, 2008; 28(12): 4162 - 4172. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||