|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 November 2006
doi: 10.1242/dev.02685
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biology and University of Massachusetts, Amherst, MA 01003,
USA.
2 Molecular and Cellular Biology Program, University of Massachusetts, Amherst,
MA 01003, USA.
* Author for correspondence (e-mail: ajensen{at}bio.umass.edu)
Accepted 5 October 2006
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Inner segment, Outer segment, Renewal, Morphogenesis, Zebrafish
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Tepass et al., 1990;
Roh et al., 2003) and are
important for normal photoreceptor morphogenesis and zonula adherens junction
formation and/or maintenance in Drosophila
(Pellikka et al., 2002;
Izaddoost et al., 2002;
Mehalow et al., 2003;
van de Pavert et al., 2004).
Mutations in human Crumbs Homolog 1 (CRB1) are associated with the inherited
retinal diseases retinitis pigmentosa 12 and Leber's congenital amaurosis
(LCA) and retinal lamination defects have been observed in LCA
(den Hollander et al., 1999;
den Hollander et al., 2001;
Lotery et al., 2001;
Gerber et al., 2002;
Jacobson et al., 2003).
Deficiencies in mouse Crb1 are also associated with retinal abnormalities
(Mehalow et al., 2003;
van de Pavert et al., 2004),
but these are less severe than those observed in humans, and photoreceptor
development appears largely normal under normal light conditions.
Loss-of-crb function in Drosophila photoreceptors causes defects in
zonula adherens formation, stalk length and rhabdomere morphology, but
polarity appears normal (Izaddoost et al.,
2002; Pellikka et al.,
2002).
The small intracellular domains of Crumbs and vertebrate Crumbs orthologs
are highly conserved and encode two important protein interaction domains, a
predicted FERM-(Band 4.1, Ezrin, Radixin, Moesin) binding domain and a
PDZ-binding domain (Wodarz et al.,
1995; den Hollander et al.,
2000; Izaddoost et al.,
2002; Roh et al.,
2003). The orthologous Maguk proteins, Drosophila Stardust and
mammalian Pals1, have been shown to bind to the PDZ-binding domain in
Drosophila Crb and mammalian CRB1 and CRB3
(Bachmann et al., 2001;
Hong et al., 2001;
Kantardzhieva et al., 2005;
Roh et al., 2002). The FERM
protein, DMoesin, has been shown to be in a complex with Crb and
shows some subcellular overlap with Crb in embryonic epithelia
(Medina et al., 2002), but a
direct interaction has not been demonstrated.
We previously reported that zebrafish mosaic eyes (moe),
which encodes a FERM protein, is required for normal retinal lamination and
suggested that it might interact with the predicted FERM-binding domain in
Crumbs proteins (Jensen et al.,
2001; Jensen and Westerfield,
2004). The phenotype of moe mutants is similar to the
phenotype of mutants in nagie oko (nok) (mpp5 -
Zebrafish Information Network), which encodes Pals1
(Wei and Malicki, 2002), and
mutants deficient in both loci are indistinguishable from the single mutants,
suggesting a genetic interaction between the two genes
(Jensen and Westerfield,
2004). In this study we show that Moe interacts directly with Crb
proteins and Nok (Pals1), and also forms a complex with Has (aPKC 
;
Prkci - Zebrafish Information Network). Morpholino knockdown of one of the
zebrafish Crumbs orthologs, crb2a, phenocopies the moe
mutations. Finally, we show that moe is required for normal
photoreceptor morphology; the apical domain is expanded in rod photoreceptors
that lack moe function, suggesting that Moe may negatively regulate
Crumbs protein function.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). The
moeb476 and moeb781 alleles were
crossed into the Rhodopsin-GFP (Xop-GFP) transgenic line
(Fadool, 2003).
UV-opsin GFP transgenic fish construction
UV-opsin GFP transgenic fish were generated by cloning a 7 kb SacI
fragment from a UV-opsin+ PAC clone, including 
870 bases of
the coding region plus 6 kb upstream, into the pG1/pESG GFP vector to generate
a fusion protein that includes most of the UV opsin protein with GFP at the
C-terminus. Linearized plasmid (60 ngµl) was injected into single-cell
embryos; germline founders were identified by PCR.
In situ hybridization
Whole-mount and section in situ hybridizations were performed as previously
described (Jensen and Westerfield,
2004). cDNAs were linearized and transcribed: crb2b XhoI,
SP6; crb2a NotI, SP6; mouse ymo1 BglII, T3; mouse
crb1 (Accession number BM941539) Not1, T3; mouse
crb2 (Accession number BI738283) EcoRI, T7.
Morpholino knockdown
crb2a splice-blocking morpholinos were targeted to the intron
(810 bases) between the second and third coding exons. Donor morpholino
sequence was TTGCACTTCAATTACCTGTATATCC and acceptor was
ACAGTTTACACCTACAGAGATCACA. Injection of donor morpholino (200 µmol/l)
produced no discernable abnormality, while injection of acceptor morpholino
(200 µmol/l) produced a weak moe-like phenotype in about 50% of
injected embryos. Co-injection of both morpholinos (each 200 µmol/l)
produced a moe-like phenotype in all injected wild-type embryos.
Morpholino activity was tested by RT-PCR on RNA isolated from 60 30-hpf
injected embryos. Primers used for RT-PCR were: RT, GCGGTCGTGGCAAAGTC); PCR,
GGCGAGACCTGTGAAGAAGACC and CCGTTTTGACAGGGATTTGACTC. Co-injection of
nok splice-blocking morpholinos (each 200 µmol/l; donor,
GTTTATGACACCCACCTAGTAAAGC; acceptor, CTCCAGCTCTGAAAGTACAAACACA) produced a
phenotype indistinguishable from nok mutants (not shown).
Construction and expression of fusion proteins
GST-tagged Crbintra proteins: sequences encoding the
intracellular domains of Crb proteins plus variable amounts of transmembrane
domain were cloned into pGEX-4T-1 (Amersham); Crb1, Crb2a, Crb2b, Crb3a and
Crb3b are 40, 42, 42, 61 and 65 amino acids, respectively. A Moe fragment (EST
accession number CD750925) encoding amino acids 1-434 was cloned into pRSET-A
to make His-Moe_FERM. For MBP Moe_FERM and MBP-Moe_C-terminus sequence
encoding residues 59-383 and sequence encoding residues 383-772, respectively,
was cloned into pMal C2X (NEB). To make His-Nok proteins, full-length Nok and
a fragment encoding the first 411 amino acids (Nok-N, including the PDZ
domain) were cloned into pRSET-A or -B (Invitrogen). To make GST-Nok-Int, a
468 bp internal StuI-PstI fragment of Nok encoding the
predicted Band 4.1 interacting region was cloned into pGEX4T-1.
Antibody production
Polyclonal antibodies to Moe were generated by immunizing rabbits (UMASS
antibody facility) and guinea pigs (Rockland Immunochemicals) with purified
His-Moe_C term fusion protein (amino acids 383-772, Accession number
CD750925).
Biochemical assays
Co-immunoprecipitation
About 190 adult zebrafish eyes were homogenized with 5 ml cold IP lysis
buffer, incubated for 1 hour at 4°C, centrifuged, and supernatant
collected. For each reaction, 500 µl lysate was pre-cleared with 20 µl
normal rabbit serum and 50 µl protein A/G Plus-Agarose (Santa Cruz
Biotech). Pre-cleared lysate was collected by centrifugation and incubated
with 20 µl normal rabbit serum or 10 µl anti-CRB3 antibodies at 4°C
overnight. Twenty-five microliters of protein A/G Plus-Agarose and 300 µg
BSA were added subsequently to capture the immunocomplex and incubated for 2
hours at 4°C. Resin was washed six times with lysis buffer.
Coimmunoprecipitated proteins were eluted with reducing sample buffer and
analyzed by western blotting.
Western blot analysis
Western blot analysis was performed on whole embryo or larval lysates,
affinity-purified proteins or purified fusion proteins. Proteins were resolved
by SDS-PAGE and transferred to nitrocellulose membrane, blocked in blotto,
incubated overnight in primary antibody at 4°C; anti-CRB3 (1:1500),
anti-GST-HRP (1:9000-1:20000; Amersham), rabbit anti-Moe (1:1500), guinea pig
anti-Moe (1:750), anti-Nok (1:2500), anti-PKC
(1:1000; Santa Cruz
Biotech, C-20), mouse anti-
-tubulin (1:2000; 12G10 DSHB), washed,
incubated in anti-rabbit-HRP (1:70000-100000; Pierce), anti-guinea pig-HRP
(1:15000, Jackson), or anti-mouse-HRP (1:20000; Pierce), washed, detected with
SuperSignal West Dura (Pierce) or West Pico (Pierce) substrate and exposed to
X-ray film.
Far western
One microgram of bait fusion protein was resolved on SDS-PAGE, transferred
to nitrocellulose, blocked with blotto and incubated with interacting fusion
protein (2.5 µg/ml) in 3% milk/PBSTw at 4°C overnight. Bound fusion
protein was detected by using anti-GST or anti-MBP (1:10000; NEB) or anti-Omni
(1:1000; Santa Cruz Biotech). Immunoreactivity was revealed as above.
Pulldown assays
About 1000 3d zebrafish were homogenized in 1 ml cold lysis buffer plus
protease inhibitors, centrifuged, supernatant isolated, and TritonX-100 added
to 1%. One milligram of purified His-Moe_FERM or His-lacZ was
immobilized on Ni-NTA resin (Qiagen), washed, incubated with 1 ml lysate for 1
hour at 4°C, resin was washed with 10 ml HEPES column buffer (with and
without 1% TritonX-100) and proteins eluted with reducing sample buffer, 20-30
µl eluant (total eluant volume, 700 µl), resolved by SDS-PAGE, 0.5-1.5%
of the lysate was included on the gel and analyzed by western blot. In
parallel, 500 3d Nok morpholino-injected zebrafish were homogenized and 200
µg His-Moe_FERM was used for pulldown as described above. Five hundred
microliters of adult eye lysate was incubated with either 200 µg
immobilized His-Moe_FERM or His-lacZ overnight at 4°C. Resin was
washed and proteins eluted with 90 µl sample buffer.
In vitro GST pulldowns
For Moe-Crb protein interactions, 10 µg His-Moe_FERM was bound to NHS
resin (Amersham). Residual reactive sites were blocked with 100 mmol/l
ethanolamine. The resin was incubated with 10 µg GST-Crb1, GST-Crb2a or
Crb2b for 1 hour at 4°C. Bound proteins were eluted with sample buffer.
For Moe-Nok interactions, 10 µg GST or GST Nok-fusion proteins were bound
to GST microspin columns (Amersham), washed and incubated with 20 µg BSA in
PBS for 2 hours at 4°C, incubated overnight at 4°C with the GST-tagged
protein in PBS (plus 20 µg BSA). Columns were washed, protein
glutathione-eluted and analyzed by western blot with tag antibodies.
Immunocytochemistry and microscopy
Zebrafish were fixed in 4% PFA, and sections (18 or 30 µm) permeabilized
with 0.1% SDS for 15 minutes, washed in PBSTw, and incubated in blocking
solution then with primary antibody overnight at 4°C: rabbit anti-Moe
1:1000; guinea pig anti-Moe 1:500; anti-CRB3 1:400; anti-Nok 1:400;
anti-aPKC 1:1000; mouse anti-ZO-1 1:10; rabbit anti-GFP 1:300 (Molecular
Probes); mouse anti-Rhodopsin 1:100; mouse Zn5 1:5 (ZIRC); anti-phospho-H3
1:1000 (Upstate Biotech). Sections were washed, incubated with secondary
antibody [-FITC/-TRITC (Molecular Probes) 1:200, -CY5 1:100 (Jackson)] and
analyzed with a Zeiss LSM 510 Meta Confocal System. Confocal images are a
single scan (four to eight averaged), optical thickness 1 µm. Images
in Fig. 2 were taken with the
same settings.
Blastomere transplantations and generation of retina mosaics
Donor embryos were produced by incrossing
Rhodopsin-GFP;moeb781/+ fish. At the high stage to dome
stage, 20-40 cells were transplanted from labeled-donor embryos into
wild-type host embryos (Jensen et al.,
2001). Larvae were placed in the dark for 2 hours and were fixed
and sectioned (30 µm) as described above. Confocal z-stack images (1
µm optical thickness) were acquired every 0.38 µm. Cell volume was
approximated by accumulating the area of the cell on each z-section: cell area
was outlined and measured in each z-section and for each cell the area from
the z-sections was summed to represent volume. Only cells completely captured
in the z-stack were included in the calculations. Measurements were repeated
and averaged to reduce sampling error. Donor cells were not lineage traced
with rhodamine dextran for the experiments localizing panCrb and ZO-1 in
GFP+ rods so that rhodamine could be used for antibody
localization.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
van den Hurk et al., 2005;
Makarova et al., 2003). In
order to test our hypothesis that Moe forms a complex with Crumbs proteins, we
had to clone zebrafish crumbs genes. We used sequences from the
zebrafish genome project to clone crb1, crb2a, crb2b and
crb3b, and found an EST for crb3a. These are the same
crumbs genes recently described by Omori and Malicki
(Omori and Malicki, 2006). To
determine whether any of these crumbs orthologs are coexpressed in
the same cells and tissues as moe, we performed in situ hybridization
in embryos and eyes. At 30 hours post-fertilization (hpf), moe and
crb2a were expressed in the skin, nose and epiphysis, and
ubiquitously in the brain and eye; crb2b was very weak in the brain
but highly expressed in the epiphysis and nose
(Fig. 1A). At 7 days
post-fertilization (dpf), moe and crb2a were expressed in
photoreceptors, cells in the inner nuclear layer, proliferating cells in the
peripheral margin, and cells in the anterior chamber
(Fig. 1B); crb2b was
detected in a small number of newly differentiating photoreceptors in the
periphery and cells in the anterior chamber
(Fig. 1B). At 3 dpf, we
observed high expression of crb2b in newly differentiating
photoreceptors and no expression of crb1, crb3a or crb3b in
the retina (data not shown) like that observed by Omori and Malicki
(Omori and Malicki, 2006). In
adults, moe and crb2a were expressed in photoreceptors and
cells in the inner nuclear layer (Fig.
1C).
|
) and van den Hurk and colleagues
(van den Hurk et al., 2005),
although we did not detect crb2 expression in the retinal ganglion
layer or in bipolar cells like that reported by van den Hurk and colleagues
(van den Hurk et al., 2005).
Coexpression in the same populations of cells of moe and
crb2a/b genes in zebrafish and the orthologous genes in mouse is
consistent with the idea that the genes/proteins interact.
Morpholino knockdown of crb2a phenocopies moe mutations
To test whether loss-of-function of zebrafish crumbs orthologs
would phenocopy the moe mutations, we targeted knockdown of
crb2a gene function, because its expression most closely resembles
moe expression. Injection of crb2a splice-blocking
morpholinos into one to two-cell wild-type embryos (hereafter called
crb2a morphants) inhibited splicing as tested by RT-PCR (see Fig. S1A
in the supplementary material) and produced a phenotype that is
indistinguishable from moe mutants, including reduced brain
ventricles, edema of the heart cavity and patchy retinal pigmented epithelium
(see Fig. S1C,D in the supplementary material). The similarity in phenotype
between crb2a morphants and moe mutants extended to loss of
retinal lamination and the ectopic localization of retinal ganglion cells and
rod photoreceptors (see Fig. S1E-P in the supplementary material).
crb2a morphants died around 5-6 dpf, similar to moe mutants.
The observation that moe and crb2a loss of function cause
similar phenotypes further supports the idea that moe and
crumbs genes/proteins interact. Omori and Malicki
(Omori and Malicki, 2006)
reported recently that the ome locus is crb2a and our
ome morphant phenotype was like their ome morphants.
Localization of Moe and Crumbs proteins requires reciprocal protein function
If Moe forms a complex in vivo with Crb proteins, the proteins should show
some colocalization. To examine the localization of Moe protein, we generated
Moe polyclonal antibodies and showed by western blot that a protein of
110 kDa was recognized by the antibody in wild type and was absent in all
moe mutant alleles (Fig.
2A). The molecular weight of Moe protein is larger than predicted
(89 kDa), suggesting that it may be modified post-translationally. To
examine the localization of Crumbs proteins, we determined by western blot
that the antibody raised against the intracellular domain of human CRB3
(Makarova et al., 2003)
recognized the recombinant intracellular domains of all the zebrafish Crumbs
proteins we identified (Fig.
2B), and thus anti-CRB3 should be considered a pan-Crb antibody in
zebrafish, and hereafter is referred to as anti-panCrb.
We examined the localization of Moe and panCrb in wild-type embryos and
whether their localization depends on the function of moe, nok
(pals1), crb2a/ome and has (aPKC).
We included has mutants
(Horne-Badovinac et al., 2001)
because its phenotype is similar to moe, ome and nok mutants
and crb2a morphants. In addition, the Par complex, which includes
aPKC, interacts with Crumbs complexes
(Wodarz et al., 2000;
Hurd et al., 2003;
Lemmers et al., 2004;
Nam and Choi, 2003), and in
Drosophila, Crumbs is a target of DaPKC
(Sotillos et al., 2004). In 30
hpf wild-type embryos, both Moe and panCrb were concentrated at the apical
surface of the brain and retinal neuroepithelium; Moe also localized
cortically in all neuroepithelial cells
(Fig. 2C,D). In moe
mutants, Moe was lost, and apical panCrb in the brain and retinal
neuroepithelium was lost (Fig.
2E,F). In crb2a morphants, ome and nok
mutants, apical Moe and panCrb were lost, although in nok mutants
disorganized plaques of Moe labeling were observed near the brain midline
(Fig. 2G-J,M,N). In
has mutants, apical Moe and panCrb in the brain and retinal
neuroepithelium were reduced and patchy compared with wild-type embryos
(Fig. 2K,L). Double labeling
and colocalization of Moe and panCrb is provided in Fig. S2 in the
supplementary material. Both Moe and panCrb localize to the apical
neuroepithelium and their localization is co-dependent, further supporting the
idea that the proteins might interact.
Loss of panCrb labeling at the apical surface in moe, nok and ome mutants could be due to loss of Crb proteins; or, alternatively, Crb proteins may be present but no longer localized apically and instead are diffuse. To distinguish between these two possibilities, we performed western blot analysis of 30 hpf wild-type, moe, nok and ome mutants. In wild-type embryos, a protein of about 150 kDa was recognized by anti-panCrb antibody. The predicted molecular weight of Crb2a is about 156 kDa, and it is by far the most abundantly expressed crumbs gene at 30 hpf; thus this protein is probably Crb2a. Levels of this protein were unaffected in moeb781 mutants (and moeb476 deficiency, not shown), barely detectable in crb2a morphants and nok mutants, was absent in ome mutants (Fig. 2O) and moderately reduced in has mutants (data not shown). Expression of crb2a and crb2b mRNA by in situ hybridization was unaffected in crb2a morphants, moe, nok and ome mutants (data not shown). These results suggest that Moe is required either for apical localization (or retention) or for trafficking of Crumbs proteins.
|
in the retina). At 7 dpf, Moe localized to the photoreceptor layer,
retinal progenitors in the periphery and cells in the anterior chamber
(Fig. 3A-F), while panCrb
localized to the photoreceptor layer apical to the outer limiting membrane
(OLM) and the apical surface of progenitor cells in the periphery
(Fig. 3A). Merging the Moe and
panCrb images shows that anti-Moe and anti-panCrb strongly colocalized in
newly differentiating photoreceptors (Fig.
3A, Moe+anti-panCrb, bracket) at the periphery of the
photoreceptor layer. Higher magnification of Moe and panCrb colocalization in
the photoreceptor layer was shown at 4 dpf, a time when most photoreceptors
are forming outer segments (Fig.
3B). Moe also colocalized with Nok and aPKC in the
photoreceptor layer and with aPKC in the outer plexiform layer
(Fig. 3C-F). Colocalization of
Moe with panCrb, Nok and aPKC places these proteins in a position to
potentially interact.
We also examined the localization of Moe and panCrb relative to markers for
photoreceptors and Müller glia, which send processes into the
photoreceptor layer. Moe and Crb proteins appeared to be in all photoreceptor
types examined, and Moe was in Müller processes that project into the
photoreceptor layer (Fig.
4A-G). We also examined Moe and panCrb localization in the
photoreceptor region relative to the OLM, a specialized adherens junction
between photoreceptor cells and Müller glia and between individual
Müller cells and individual photoreceptors
(Williams et al., 1990). In
mouse retina, Crb1 localizes just apical to OLM and deficiencies in Crb1
result in OLM defects (Mehalow et al.,
2003; van de Pavert et al.,
2004). The highest level of Moe labeling was basal to the OLM, as
marked by anti-ZO-1, but anti-Moe labeling was also observed apical to the
OLM, where panCrb labeling localizes (Fig.
4H,I).
|
)110 kD),
anti-panCrb (150 kDa) and anti-Nok (80 kDa) from adult eyes
(Fig. 5A). We also found that a
fusion protein of Moe that includes the FERM domain (Moe_FERM) pulled down a
150 kDa protein from larval lysates that was recognized by anti-panCrb
antibody (Fig. 5B), further
supporting the idea that Moe and Crumbs proteins form a complex. We also
showed that Moe_FERM can pull down a 80 kDa protein recognized by
anti-Nok from 3 dpf wild-type larvae and adult eyes but not from nok
morphants (Fig. 5C,E). Further,
we showed by western blot that this 80 kDa protein was absent in
nokm520 (Fig.
5D), indicating that this protein is encoded by the nok
locus.
Given that Moe and aPKC colocalized in tissue, we also tested
whether aPKC (Has) forms a complex with Moe. Moe_FERM pulls down a
protein of about 72 kDa that was recognized by antibody to the highly related
protein aPKC (Fig. 5F).
The 72 kDa protein recognized by anti-aPKC was absent in
hasm576 (Fig.
5G), suggesting that this protein is encoded by the has
locus. A protein of about 52 kDa was also pulled down, but it is unclear
whether this represents an isoform of aPKC, an aPKC
degradation product (Coghlan et al.,
2000), or another protein that crossreacts with the aPKC
antibody that was pulled down by Moe_FERM.
Moe interacts directly with Crumbs proteins and Nok (Pals1)
To test whether Moe directly binds to Crumbs proteins, we performed in
vitro GST pull-down and far western experiments using purified recombinant
proteins. Immobilized His-Moe_FERM interacted with GST-Crb2aintra,
GST-Crb2bintra and, to a lesser extent, GST-Crb1intra
(Fig. 6A). Furthermore, we
showed by far western analysis that GST-Crb1intra,
GST-Crb2aintra and GST-Crb2bintra bind to His-Moe_FERM
immobilized on nitrocellulose (Fig.
6B). Taken together, our biochemical data suggest that Moe
interacts directly with Crumbs proteins.
Both Nok and Pals1 have predicted Band 4.1-binding domains consisting of
several lysine residues (Kamberov et al.,
2000; Wei and Malicki,
2002) and Stardust has a similar stretch of residues following the
SH3 domain. We sought to determine whether Moe, a Band 4.1 protein, interacts
directly with Nok (Pals1). We showed that immobilized GST-Nok-Int, containing
the predicted Band 4.1-binding motif, pulled down MBP-Moe_FERM but not MBP-Moe
C-terminus (Fig. 6C). We also
showed in far western experiments that MBP-Moe_FERM bound to
nitrocellulose-bound full-length Nok (His-Nok-FL), but not His-Nok-N, which
does not contain the predicted Band 4.1-binding domain
(Fig. 6D). We also showed that
His-Nok-N (including the PDZ domain) directly interacted with both
GST-Crb2aintra, GST-Crb2bintra proteins by far western
(see Fig. S3 in the supplementary material). Our biochemical analyses show
that Moe interacts directly with Crumbs proteins and Nok (Pals1).
|
), examination of their morphology is uninformative. To
overcome this limitation, we used genetic mosaic analysis and a transgenic
line that expresses GFP in rods (Fadool,
2003). When moe mutant cells are transplanted into
wild-type hosts at the blastula stage, moe mutant cells are almost
invariably found in their normal laminar position in the retina
(Fig. 7) (Jensen et al., 2004),
and so we used this strategy to examine the morphology of GFP+ rods
that lack moe function. Wild-type rods have a stereotypical
morphology: a basal synaptic terminal, a round cell body, a thin apical inner
segment (IS) and a thick apical outer segment (OS) filled with rhodopsin
(Fig. 7A,B,G,H). At 6 dpf, the morphology of moe- rods seemed largely normal, but the cells were almost 50% larger than wild-type rods (Fig. 7C-F,O). We measured the accumulated area of the OS versus the IS and cell body and found that the size increase in moe- rods was due largely to an increase in the size of the OS (Fig. 7O). By 10 dpf the morphology of moe- rods was markedly abnormal and the cells were about 50% larger than wild-type rods (Fig. 7I-N,P). Most often moe- rods displayed a coiled apical structure that seemed to encompass both the IS and OS and seemed larger than the combined area of the IS and OS area of wild-type rods (Fig. 7I,K,L-N). We could not accurately measure the OS versus the IS and cell body at 10 dpf because the morphology was so distorted. We grouped transplanted moe- rods into two groups by examining the genotype of neighboring cells; one group included moe- rods that had few moe- neighbors (Fig. 7I-K) and the other group moe- rods had large numbers of moe- neighbors (Figure L-N). Generally, moe- rods with large numbers of moe- neighbors were more abnormal (Fig. 7L-N) than those with mostly wild-type neighbors (Fig. 7I-K). Rhodopsin remained localized to the most distal portion of the cell (Fig. 7I-N), suggesting that apical-basal polarity is preserved. Three-dimensional movies of moe- rods are provided (see movies 1-5 in the supplementary material).
We examined the localization of Crumbs proteins in wild type and moe- rods in our transplant experiments. At 6 and 10 dpf, anti-panCrb labeling in the inner segment in moe- rods did not seem different from wild-type rods (Fig. 7Q-X). Localization of ZO-1 appeared normal around moe- rods in genetic mosaics (see Fig. S4 in the supplementary material). The observations that the apical region was expanded in moe- rods suggest that Moe may normally act to inhibit apical size in photoreceptors. Interestingly, proper localization of Crumbs proteins to the photoreceptor IS does not appear to require Moe function, contrary to that observed in embryos (see Fig. 2).
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
) is
highly conserved in Moe. It seems that ion exchangers play a crucial role in
brain ventricle formation, as mutations in a Na+K+ATPase cause
failure of brain ventricle formation that is very similar to the moe
and nok mutations (Yuan and
Joseph, 2004; Lowery and Sive,
2005). Localization of such proteins in the retinal epithelium
would be disruptive, because formation of a lumen would separate the retinal
epithelium from the retinal pigmented epithelium. We still do not fully
understand why moe loss of function has such a dramatic effect on
retinal epithelial integrity while the integrity of the brain epithelium seems
relatively normal even though moe and crb2a are expressed in
both tissues. Protein function redundancy seems unlikely to account for the
differences in retina brain defects, as we detected no expression of the
paralog of moe, ehm2, in the brain (A.M.J. and Y.-C.H., unpublished),
and panCrb labeling, which we showed recognizes all zebrafish Crumbs proteins,
is completely lost in the brain of ome (crb2a) mutants.
The most remarkable observation made is that the apical membrane in rods is
expanded by moe loss of function, and moe- rods
are almost 50% larger than wild-type rods. The morphology of
moe- photoreceptors was largely normal at 6 dpf, which is
3 days after the onset of rod IS and OS formation
(Schmitt and Dowling, 1999),
but by 10 dpf, most rods exhibited an abnormal morphology that included a
distinctive coiled shape. By morphology we were unable to always distinguish
the IS from the OS at 10 dpf, but Rhodopsin remained localized distally,
suggesting that apical/basal polarity is preserved. The conspicuous coiled
morphology of the rods could be intrinsic, caused by adhesion defects or due
to space constraints imposed by neighboring cells.
The vertebrate photoreceptor OS is a highly modified cilium
(Röhlich, 1975).
Vertebrate Crumbs proteins have been shown to be important for ciliogenesis;
siRNA knockdown of crb3 leads to a dramatic reduction in the number
of ciliated MDCK cells (Fan et al.,
2004), and in zebrafish inhibition of crb3a shortens
auditory kinocilia, and morpholino knockdown of crb2b shortens
nephric cilia and also shortens photoreceptor ISs, which lie below the OS
(Omori and Malicki, 2006).
Mice with a Crb1 mutation have shortened ISs and OSs
(Mehalow et al., 2003). The
Drosophila photoreceptor stalk region, which may be a homologous
structure to the IS in vertebrate photoreceptors, is shortened by crb
loss of function and is expanded by overexpression of full-length crb
(Izaddoost et al., 2002;
Pellikka et al., 2002).
Overexpression of crumbs also expands the apical domain of ectodermal
epithelia in the Drosophila embryo
(Wodarz et al., 1995). Our
observations that OSs are expanded in moe- rods, taken
with those above, suggest that Moe may be a negative regulator of Crumbs
protein function in photoreceptors. We did not observe a significant increase
in IS size at 6 dpf, and at 10 dpf we were unable to confidently identify the
different compartments (cell body, IS and OS) in moe-
rods, so it remains to be determined whether the IS is affected by loss of
moe function. Drosophila Yurt (Moe ortholog) also appears to
act as negative regulator of apical membrane size and is shown to interact
directly with Crumbs (Laprise et al.,
2006). Collectively, our observations and those of others lead us
to propose that Crb proteins are good candidates to be part of the molecular
mechanism that regulates daily apical renewal in photoreceptors and that Moe
may be an important negative regulator of this mechanism.
|
), and
both processes are regulated by cyclic light
(Besharse et al., 1977;
Hollyfield and Rayborn, 1979;
Stowe, 1980); experiments in
the locust suggest these processes are controlled locally
(Williams, 1982). To our
knowledge, no molecules or molecular mechanisms have been identified that
regulate the process of apical membrane renewal in photoreceptors, although
many genes, including that encoding Rhodopsin, are required for the formation
of the OS (Lem et al., 1999).
A prediction of this idea is that Crb1/Crb2 complex should be regulated by
light. This prediction is supported already by the observation that exposure
to bright light accelerates photoreceptor death in the mouse crb1
knockout (van de Pavert et al.,
2004) and Drosophila crb mutant retina
(Johnson et al., 2002). The
potential role of Crb1/Crb2 and its regulation by Moe has important
implications in the etiology of photoreceptor degeneration diseases, which
often are marked first by a shortening of the IS and OS.
Levels of Crumbs proteins may be especially critical for photoreceptors.
Mouse and zebrafish photoreceptors express two crumbs genes
(Fig. 1)
(den Hollander et al., 2002;
van den Hurk et al., 2005),
and in Drosophila the stalk is slightly shorter in
crb-/+ photoreceptors
(Pellikka et al., 2002).
Perhaps the differences between Crb1 loss of function in humans and
mice reflect differences in the compensatory function of Crb2.
Although crb1 is not expressed in the zebrafish retina (data not
shown) (Omori and Malicki,
2006), photoreceptors still express two crumbs genes,
crb2a and crb2b; perhaps one of these crb2 genes
may have adopted the function of crb1 in mammals.
We showed that Moe and panCrb localization at the brain and retina
ventricular surface depend on reciprocal Moe/Crb protein function and Nok
function. The intracellular punctate panCrb labeling in the cell bodies of the
wild-type brain and retinal neuroepithelium is reduced or absent in
moe mutants (Fig.
2D,F), but overall protein levels are unaffected, suggesting that
Moe may be required for the intracellular trafficking of Crb protein through
organelles. Interestingly, disruption of Crb trafficking through the endosomal
pathway leads to an upregulation of cell-surface Crb protein
(Lu and Bilder, 2005), and
recently two other FERM proteins, Merlin and Expanded, have been implicated in
regulating cell-surface receptor localization, abundance and turnover
(Maitra et al., 2006). The
loss of apical panCrb labeling in moe- embryos contrasts
with the normal Crumbs protein localization observed in
moe- rods, suggesting that additional proteins or cellular
or molecular mechanisms operate to localize Crumbs proteins in photoreceptors.
Crumbs-expressing wild-type Müller glia, which send processes into the IS
region, may help to localize Crumbs protein in moe-
rods.
|
) and that Moe can interact directly with Nok. The interaction
between Moe and Nok may serve to regulate the interaction between Nok and
Crumbs proteins or to bring Nok into the Crumbs complex. The former hypothesis
is supported by studies of the Glycophorin C (GPC) ternary complex, which
includes the Maguk protein, p55, and the FERM protein, Band 4.1, showing that
the inclusion of Band 4.1 in the complex increases the affinity of p55 for GPC
by an order of magnitude (Nunomura et al.,
2000). The interaction of Moe with aPKC may be mediated by
the Par3/6 complex (Wodarz et al.,
2000; Hurd et al.,
2003; Lemmers et al.,
2004; Nam and Choi,
2003); perhaps aPKC regulates the interaction between Moe
and Crumbs proteins, as DaPKC phosphorylates Drosophila Crumbs in the
FERM-binding domain and phosphorylation of Crb is required for apical
localization of Crb in Drosophila embryos
(Sotillos et al., 2004). In
addition, Moe itself may be a target for aPKC regulation, as there are
several potential serine and threonine phosphorylation sites (A.M.J.,
unpublished).
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/24/4849/DC1
|
ACKNOWLEDGMENTS |
|---|
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Bachmann, A., Schneider, M., Theilenberg, E., Grawe, F. and
Knust, E. (2001). Drosophila Stardust is a partner of Crumbs
in the control of epithelial cell polarity. Nature
414,638
-643.[CrossRef][Medline]
Besharse, J. C., Hollyfield, J. G. and Rayborn, M. E.
(1977). Photoreceptor outer segments: accelerated membrane
renewal in rods after exposure to light. Science
196,536
-538.
Coghlan, M. P., Chou, M. M. and Carpenter, C. L.
(2000). Atypical protein kinases Clambda and -zeta associate with
the GTP-binding protein Cdc42 and mediate stress fiber loss. Mol. Cell.
Biol. 20,2880
-2889.
den Hollander, A. I., ten Brink, J. B., de Kok, Y. J., van
Soest, S., van den Born, L. I., van Driel, M. A., van de Pol, D. J., Payne, A.
M., Bhattacharya, S. S., Kellner, U. et al. (1999). Mutations
in a human homologue of Drosophila crumbs cause retinitis pigmentosa (RP12).
Nat. Genet. 23,217
-221.[CrossRef][Medline]
den Hollander, A. I., Johnson, K., de Kok, Y. J., Klebes, A.,
Brunner, H. G., Knust, E. and Cremers, F. P. (2000). CRB1 has
a cytoplasmic domain that is functionally conserved between human and
Drosophila. Hum. Mol. Genet.
10,2767
-2773.
den Hollander, A. I., Heckenlively, J. R., van den Born, L. I.,
de Kok, Y. J., van der Velde-Visser, S. D., Kellner, U., Jurklies, B., van
Schooneveld, M. J., Blankenagel, A., Rohrschneider, K. et al.
(2001). Leber congenital amaurosis and retinitis pigmentosa with
Coats-like exudative vasculopathy are associated with mutations in the crumbs
homologue 1 (CRB1) gene. Am. J. Hum. Genet.
69,198
-203.[CrossRef][Medline]
den Hollander, A. I., Ghiani, M., de Kok, Y. J., Wijnholds, J.,
Ballabio, A., Cremers, F. P. and Broccoli, V. (2002).
Isolation of Crb1, a mouse homologue of Drosophila crumbs, and analysis of its
expression pattern in eye and brain. Mech. Dev.
110,203
-207.[CrossRef][Medline]
Fadool, J. M. (2003). Development of a rod
photoreceptor mosaic revealed in transgenic zebrafish. Dev.
Biol. 258,277
-290.[CrossRef][Medline]
Fan, S., Hurd, T. W., Liu, C. J., Straight, S. W., Weimbs, T.,
Hurd, E. A., Domino, S. E. and Margolis, B. (2004). Polarity
proteins control ciliogenesis via kinesin motor interactions. Curr.
Biol. 14,1451
-1461.[CrossRef][Medline]
Gerber, S., Perrault, I., Hanein, S., Shalev, S., Zlotogora, J.,
Barbet, F., Ducroq, D., Dufier, J., Munnich, A., Rozet, J. et al.
(2002). A novel mutation disrupting the cytoplasmic domain of
CRB1 in a large consanguineous family of Palestinian origin affected with
Leber congenital amaurosis. Ophthalmic Genet.
23,225
-235.[CrossRef][Medline]
Hollyfield, J. G. and Rayborn, M. E. (1979).
Photoreceptor outer segment development: light and dark regulate the rate of
membrane addition and loss. Invest. Ophthalmol. Vis.
Sci. 18,117
-132.
Hong, Y., Stronach, B., Perrimon, N., Jan, L. Y. and Jan, Y.
N. (2001). Drosophila Stardust interacts with Crumbs to
control polarity of epithelia but not neuroblasts.
Nature 414,634
-638.[CrossRef][Medline]
Horne-Badovinac, S., Lin, D., Waldron, S., Schwarz, M., Mbamalu,
G., Pawson, T., Jan, Y., Stainier, D. Y. and Abdelilah-Seyfried, S.
(2001). Positional cloning of heart and soul reveals multiple
roles for PKC lambda in zebrafish organogenesis. Curr.
Biol. 11,1492
-1502.[CrossRef][Medline]
Hurd, T. W., Gao, L., Roh, M. H., Macara, I. G. and Margolis,
B. (2003). Direct interaction of two polarity complexes
implicated in epithelial tight junction assembly. Nat. Cell
Biol. 5,137
-142.[CrossRef][Medline]
Izaddoost, S., Nam, S. C., Bhat, M. A., Bellen, H. J. and Choi,
K. W. (2002). Crumbs is a positional cue in photoreceptor
adherens junctions and rhabdomeres. Nature
416,178
-183.[CrossRef][Medline]
Jacobson, S. G., Cideciyan, A. V., Aleman, T. S., Pianta, M. J.,
Sumaroka, A., Schwartz, S. B., Smilko, E. E., Milam, A. H., Sheffield, V. C.
and Stone, E. M. (2003). Crumbs homolog 1 (CRB1) mutations
result in a thick human retina with abnormal lamination. Hum. Mol.
Genet. 12,1073
-1078.
Jensen, A. M. and Westerfield, M. (2004).
Zebrafish mosaic eyes is a novel FERM protein required for retinal
lamination and retinal pigmented epithelial tight junction formation.
Curr. Biol. 14,711
-717.[CrossRef][Medline]
Jensen, A. M., Walker, C. and Westerfield, M.
(2001). mosaic eyes: a zebrafish gene required in
pigmented epithelium for apical localization of retinal cell divisions and
lamination. Development
128,95
-105.[Abstract]
Johnson, K., Grawe, F., Grzeschik, N. and Knust, E.
(2002). Drosophila crumbs is required to inhibit
light-induced photoreceptor degeneration. Curr. Biol.
12,1675
-1680.[CrossRef][Medline]
Jons, T. and Drenckhahn, D. (1992).
Identification of the binding interface involved in linkage of cytoskeletal
protein 4.1 to the erythrocyte anion exchanger. EMBO
J. 11,2863
-2867.[Medline]
Kamberov, E., Makarova, O., Roh, M., Liu, A., Karnak, D.,
Straight, S. and Margolis, B. (2000). Molecular cloning and
characterization of Pals, proteins associated with mLin-7. J. Biol.
Chem. 275,11425
-11431.
Kantardzhieva, A., Gosens, I., Alexeeva, S., Punte, I. M.,
Versteeg, I., Krieger, E., Neefjes-Mol, C. A., den Hollander, A. I.,
Letteboer, S. J., Klooster, J. et al. (2005). MPP5 recruits
MPP4 to the CRB1 complex in photoreceptors. Invest. Ophthalmol.
Vis. Sci. 46,2192
-2201.
Laprise, P., Beronja, S., Silva-Gagliardi, N., Pellikka, M.,
Jensen, A. M., McGlade, J. and Tepass, U. (2006). The FERM
protein Yurt is a negative regulatory component of the Crumbs complex that
controls epithelial polarity and apical membrane size. Dev.
Cell 11,363
-374.[CrossRef][Medline]
Lem, J., Krasnoperova, N. V., Calvert, P. D., Kosaras, B.,
Cameron, D. A., Nicolo, M., Makino, C. L. and Sidman, R. L.
(1999). Morphological, physiological, and biochemical changes in
rhodopsin knockout mice. Proc. Natl. Acad. Sci. USA
96,736
-741.
Lemmers, C., Michel, D., Lane-Guermonprez, L., Delgrossi, M. H.,
Medina, E., Arsanto, J. P. and Le Bivic, A. (2004). CRB3
binds directly to Par6 and regulates the morphogenesis of the tight junctions
in mammalian epithelial cells. Mol. Biol. Cell
15,1324
-1333.
Lotery, A. J., Jacobson, S. G., Fishman, G. A., Weleber, R. G.,
Fulton, A. B., Namperumalsamy, P., Heon, E., Levin, A. V., Grover, S.,
Rosenow, J. R. et al. (2001). Mutations in the CRB1 gene
cause Leber congenital amaurosis. Arch. Ophthalmol.
119,415
-420.
Lowery, L. A. and Sive, H. (2005). Initial
formation of zebrafish brain ventricles occurs independently of circulation
and requires the nagie oko and snakehead/atp1a1a.1 gene
products. Development
132,2057
-2067.
Lu, H. and Bilder, D. (2005). Endocytic control
of epithelial polarity and proliferation in Drosophila. Nat. Cell
Biol. 7,1132
-1139.[CrossRef]
Maitra, S., Kulikauskas, R. M., Gavilan, H. and Fehon, R. G.
(2006). The tumor suppressors merlin and expanded function
cooperatively to modulate receptor endocytosis and signaling. Curr.
Biol. 16,702
-709.[CrossRef][Medline]
Makarova, O., Roh, M. H., Liu, C. J., Laurinec, S. and Margolis,
B. (2003). Mammalian Crumbs3 is a small transmembrane protein
linked to protein associated with Lin-7 (Pals1). Gene
302, 21-29.[CrossRef][Medline]
Malicki, J. and Driever, W. (1999). oko meduzy
mutations affect neuronal patterning in the zebrafish retina and reveal
cell-cell interactions of the retinal neuroepithelial sheet.
Development 126,1235
-1246.[Abstract]
Medina, E., Williams, J., Klipfell, E., Zarnescu, D., Thomas, G.
and Le Bivic, A. (2002). Crumbs interacts with moesin and
beta(Heavy)-spectrin in the apical membrane skeleton of Drosophila.
J. Cell Biol. 158,941
-951.
Mehalow, A. K., Kameya, S., Smith, R. S., Hawes, N. L., Denegre,
J. M., Young, J. A., Bechtold, L., Haider, N. B., Tepass, U., Heckenlively, J.
R. et al. (2003). CRB1 is essential for external limiting
membrane integrity and photoreceptor morphogenesis in the mammalian retina.
Hum. Mol. Genet. 12,2179
-2189.
Nam, S. C. and Choi, K. W. (2003). Interaction
of Par-6 and Crumbs complexes is essential for photoreceptor morphogenesis in
Drosophila. Development
130,4363
-4372.
Nunomura, W., Takakuwa, Y., Parra, M., Conboy, J. and Mohandas,
N. (2000). Regulation of protein 4.1R, p55, and glycophorin C
ternary complex in human erythrocyte membrane. J. Biol.
Chem. 275,24540
-24546.
Omori, Y. and Malicki, J. (2006). oko
meduzy and related crumbs genes are determinants of apical cell
features in the vertebrate embryo. Curr. Biol.
16,945
-957.[CrossRef][Medline]
Pellikka, M., Tanentzapf, G., Pinto, M., Smith, C., McGlade, C.
J., Ready, D. F. and Tepass, U. (2002). Crumbs, the
Drosophila homologue of human CRB1/RP12, is essential for photoreceptor
morphogenesis. Nature
416,143
-149.[CrossRef][Medline]
Roh, M. H., Makarova, O., Liu, C. J., Shin, K., Lee, S.,
Laurinec, S., Goyal, M., Wiggins, R. and Margolis, B. (2002).
The Maguk protein, Pals1, functions as an adapter, linking mammalian
homologues of Crumbs and Discs Lost. J. Cell Biol.
157,161
-172.
Roh, M. H., Fan, S., Liu, C. J. and Margolis, B.
(2003). The Crumbs3-PALS1 complex participates in the
establishment of polarity in mammalian epithelial cells. J. Cell
Sci. 116,2895
-2906.
Röhlich, P. (1975). The sensory cilium of
retinal rods is analogous to the transition zone of motile cilia.
Cell Tissue Res. 161,421
-430.[Medline]
Schmitt, E. A. and Dowling, J. E. (1999). Early
retinal development in the zebrafish, Danio rerio: light and electron
microscopic analyses. J. Comp. Neurol.
404,515
-536.[CrossRef][Medline]
Sotillos, S., Diaz-Meco, M. T., Caminero, E., Moscat, J. and
Campuzano, S. (2004). DaPKC-dependent phosphorylation of
Crumbs is required for epithelial cell polarity in Drosophila. J.
Cell Biol. 166,549
-557.
Stowe, S. (1980). Rapid synthesis of
photoreceptor membrane and assembly of new microvilli in a crab at dusk.
Cell Tissue Res. 211,419
-440.[Medline]
Tepass, U., Theres, C. and Knust, E. (1990).
crumbs encodes an EGF-like protein expressed on apical membranes of Drosophila
epithelial cells and required for organization of epithelia.
Cell 61,787
-799.[CrossRef][Medline]
van den Hurk, J. A., Rashbass, P., Roepman, R., Davis, J.,
Voesenek, K. E., Arends, M. L., Zonneveld, M. N., van Roeke, M. H., Cameron,
K., Rohrschneider, K. et al. (2005). Characterization of the
Crumbs homologue 2 (CRB2) gene and analysis of its role in retinitis
pigmentosa and Leber congenital amaurosis. Mol. Vis.
11,263
-273.[Medline]
van de Pavert, S. A., Kantardzhieva, A., Malysheva, A.,
Meuleman, J., Versteeg, I., Levelt, C., Klooster, J., Geiger, S., Seeliger, M.
W., Rashbass, P. et al. (2004). Crumbs homologue 1 is
required for maintenance of photoreceptor cell polarization and adhesion
during light exposure. J. Cell Sci.
117,4169
-4177.
Wei, X. and Malicki, J. (2002). nagie oko,
encoding a MAGUK-family protein, is essential for cellular patterning of the
retina. Nat. Genet. 31,150
-157.[CrossRef][Medline]
Williams, D. S. (1982). Photoreceptor membrane
shedding and assembly can be initiated locally within an insect retina.
Nature 218,898
-900.
Williams, D. S., Arikawa, K. and Paallysaho, T.
(1990). Cytoskeletal components of the adherens junctions between
the photoreceptors and the supportive Müller cells. J. Comp.
Neurol. 295,155
-164.[CrossRef][Medline]
Wodarz, A., Hinz, U., Engelbert, M. and Knust, E.
(1995). Expression of crumbs confers apical character on plasma
membrane domains of ectodermal epithelia of Drosophila.
Cell 82,67
-76.[CrossRef][Medline]
Wodarz, A., Ramrath, A., Grimm, A. and Knust, E.
(2000). Drosophila atypical protein kinase C associates with
Bazooka and controls polarity of epithelia and neuroblasts. J. Cell
Biol. 150,1361
-1374.
Yuan, S. and Joseph, E. M. (2004). The
small heart mutation reveals novel roles of Na+/K+-ATPase in
maintaining ventricular cardiomyocyte morphology and viability in zebrafish.
Circ. Res. 95,595
-603.
Young, R. W. (1967). The renewal of
photoreceptor cell outer segments. J. Cell Bio.
33, 61-72.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Zou, K. L. Lathrop, M. Sun, and X. Wei Intact Retinal Pigment Epithelium Maintained by Nok Is Essential for Retinal Epithelial Polarity and Cellular Patterning in Zebrafish J. Neurosci., December 10, 2008; 28(50): 13684 - 13695. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hirano, S. Hashimoto, S. Yonemura, H. Sabe, and S. Aizawa EPB41L5 functions to post-transcriptionally regulate cadherin and integrin during epithelial-mesenchymal transition J. Cell Biol., September 22, 2008; 182(6): 1217 - 1230. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. A. Bulgakova, O. Kempkens, and E. Knust Multiple domains of Stardust differentially mediate localisation of the Crumbs-Stardust complex during photoreceptor development in Drosophila J. Cell Sci., June 15, 2008; 121(12): 2018 - 2026. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. D. Lee, N. F. Silva-Gagliardi, U. Tepass, C. J. McGlade, and K. V. Anderson The FERM protein Epb4.1l5 is required for organization of the neural plate and for the epithelial-mesenchymal transition at the primitive streak of the mouse embryo Development, June 1, 2007; 134(11): 2007 - 2016. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
