|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 November 2006
doi: 10.1242/dev.02688
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Developmental Biology, Cincinnati Children's Hospital Research
Foundation, Cincinnati, OH 45229, USA.
2 Department of Genetics, School of Medicine, Case Western Reserve University,
Cleveland, OH 44106, USA.
3 Department of Environmental Health, College of Medicine, University of
Cincinnati, Cincinnati, OH 45229, USA.
* Author for correspondence (e-mail: christopher.wylie{at}cchmc.org)
Accepted 10 October 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Germ cells, Steel factor (Kitl), Apoptosis, Migration, Mouse
| INTRODUCTION |
|---|
|
|
|---|
The signals that initiate midline germ cell death, and the details of its
mechanism, are unknown. Previous reports have identified roles for individual
signaling ligands in PGC survival. Both Steel factor [also known as kit ligand
(Kitl) - Mouse Genome Informatics] and Leukaemia inhibitory factor increase
survival in PGC cultures (Dolci et al.,
1991
; Matsui et al.,
1991
; Pesce et al.,
1993
). However, their roles in midline germ cell death in vivo are
not known. In addition, individual signaling ligands may control more than one
aspect of PGC behavior: a necessary homing signal for germ cells in both
zebrafish and mice, Sdf1
(Doitsidou et al., 2002
;
Molyneaux et al., 2003
) has
also been suggested to be a survival factor
(Molyneaux et al., 2003
),
whereas a known survival factor for germ cells, Steel factor
(Dolci et al., 1991
) has also
been suggested to be a guidance factor
(McCoshen and McCallion,
1975
).
There are a number of possible mechanisms for midline germ cell death
(Fig. 1). First, activation of
death signals by midline somatic cells, or receptors for these in midline germ
cells, at E10.5, may activate the extrinsic cell death pathway. Second,
switching off an essential survival factor at E10.5 by midline somatic cells,
or its receptor in germ cells, may activate the intrinsic death pathway. There
may also be combinations of these. To analyze this process, we first assayed
the numbers of germ cells undergoing apoptosis in the midline and bilateral
trunk regions of the mouse embryo at E10.5, and found that apoptosis occurs in
both populations during late migration, but is greatly enhanced in midline
germ cells. Second, we screened for expression of components of both the
extrinsic and intrinsic cell death pathways, in purified germ cells from both
migratory and post-migratory germ cells. These data indicate that the
extrinsic pathway is inactive in migratory germ cells, but that components of
the intrinsic pathway are up-regulated during migration, suggesting that the
latter is responsible for PGC death in the midline. These data are supported
by previous data from our lab, wherein embryos lacking Bcl2-associated X
protein (Bax), a pro-apoptotic member of the intrinsic pathway, have large
numbers of ectopic germ cells in midline structures at E13.5
(Stallock et al., 2003
).
|
In this investigation we have quantified apoptosis and proliferation of germ cells in normal embryos and embryos mutant for Steel factor and/or Bax, at different stages. We show first that the massive loss of PGCs with null alleles of Steel is caused by apoptosis of germ cells beginning on or before E9.0, prior to emigration from the hindgut. Second, we show that Steel factor expression changes significantly between E9.5 and E10.5, becoming restricted to the lateral domains of germ cell migration, and lost in the midline, during this period. Third, we use both gain- and loss-of-function assays of Steel function to show that the loss of Steel factor in the midline at E10.5 causes midline germ cell death. Fourth, we show that Bax is required for germ cell apoptosis downstream of Steel factor in vivo, by rescuing the apoptosis phenotype in null mutants of Steel at E9.0 by removing Bax. Rescue of germ cell apoptosis in the absence of Steel factor revealed the fact that Steel factor has other functions in germ cells. Germ cells in Bax/Steel double null embryos failed to emigrate from the gut and failed to proliferate. This establishes novel roles for Steel factor in germ cell migration and proliferation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PE:GFP transgene (Anderson et
al., 2000
PE:GFP+ mice were bred
with Bax heterozgotes as described previously
(Stallock et al., 2003
PE:GFP+/+,
Steel+/-, and Bax+/- or
Bax-/-. These were interbred to yield
Oct4
PE:GFP+/+,
Steel-/-, Bax-/- embryos. Genomic DNA
was isolated from tails (adults) and heads (embryos), and genotypes were
determined by PCR. Primers used were: Oct4
PE:GFP
(Yeom et al., 2001) F-5'GGAGAGGTGAAACCGTCCCTAGG-3',
R-5'GCATCGCCCTCGCCCTCGC-3'; Bax
(Deckwerth et al., 1996
PE:GFP transgene expression was determined by the
presence of a 250 bp fragment. For genotyping of Bax, wild-type and
mutant alleles were determined by the presence of 304 and 507 bp fragments,
respectively. For KitlSl, wild-type and deleted alleles
were determined by 294 and 646 bp fragments, respectively.
Flow cytometry, RT-PCR and chip analysis
Genital ridge regions (E10.5-11.5) or gonads from males or females
(E12.5-16.5) were dissected from embryos obtained from Oct4
PE:GFP
x CD1 matings. GFP+ germ cells were FACS-purified and RNA was
extracted as previously described
(Molyneaux et al., 2004
). cDNA
were generated from 10 (n=1) or 25 (n=2) ng RNA using
Superscript II or III First-Strand Synthesis Systems (Invitrogen). Real-time
RT-PCR was performed on an Opticon Cycler (MJ Research, Waltham, MA, USA)
using QuantiTect SYBR Green mix (Qiagen). Primers were designed using Primer3
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi).
Predicted fragment lengths and primer sequences are as follows: Bad
(174 bp, F: AGGATCGCTGTGTCCCTTTA R: GGCAGTCCAGAACAGGAGAG); Bak (147
bp, F: AATCCTGTGTCCTTCCTGACCC R: ATAGTGGCTGAGTCTGAGGCTCTG); Bax (166
bp, F: ATGCGTCCACCAAGAAGCTGAG R: CCCCAGTTGAAGTTGCCATCAG); Bcl2 (183
bp, F: CTGGCATCTTCTCCTTCCAG R: GACGGTAGCGACGAGAGAAG); Bcl-w
(Bcl2l2 - MGI; 240 bp, F: TAGCAGACCTTCAGCCAGGT R:
GCCATACTCAGCCTTCTTGG); Bcl-xL (Bcl2l1 - MGI; 249
bp, F: ACTGACCGTCCACTCACCTC R: AGGAGCTGGTTTAGGGGAAA); Bid (159 bp, F:
AAGGCATCCACAAACCTGTC R: AGTGTGCATGTGGGAGTCAG); Bim (Bcl2l11
- MGI; 200 bp, F: CGACAGTCTCAGGAGGAACC R: CAATGCCTTCTCCATACCAGA);
Casp3 (169 bp, F: GTGTCCATGCTCACGAAAGA R: TGCTAGGCAGTGGTAGCGTA);
Casp6 (235 bp, F: CCAGACAGACAAGCTGGACA R: GCGCTGAGAGACCTTTCTGT);
Casp7 (246 bp, F: GAGGAGGACCACAGCAACTC R: GGGATTAGCGTCAATGTCGT);
Casp8 (186 bp, F: GGAATGGCTACGGTGAAGAA R: CATCTGCTTTCCCTTGTTCC);
Fas (163 bp, F: CAACCCCAGACACTGGAAAT R: TGCTGGCAAAGAGAACACAC);
p53 (213 bp, F: CCAGTCTACTTCCCGCCATA R: GGCCAGGAACCACTACTCAG);
Actb (138 bp, F: AGAGGGAAATCGTGCGTGAC R: CAATAGTGATGACCTGGCCGT);
Gapdh (452 bp, F: ACCACAGTCCATGCCATCAC R: TCCACCACCCTGTTGCTGTA);
Odc1 (179 bp, F: TTGCCACTGATGATTCCAAAGC R: ATCCGACACTGCCTGAACGAAG);
Tbp (199 bp, F: CTTCGTGCAAGAAATGCTGA R: AGAACTTAGCTGGGAAGCCC);
Ubc (118 bp, F: AGCCCAGTGTTACCACCAAG R: CTAAGACACCTCCCCCATCA);
18S rRNA (217 bp, F: ATGGCCGTTCTTAGTTGGTG R: CGCTGAGCCAGTCAGTGTAG).
Gel electrophoresis confirmed predicted sizes for each PCR product.
Expression levels of apoptotic genes were analyzed separately to estimate
the effects of embryonic day and gender. Apoptotic expression levels were
normalized by each of the six best housekeeping genes in mouse embryos
[beta-actin (Actb), glyceraldehyde-3-phosphate dehydrogenase
(Gapdh), ornithine decarboxylase (Odc1), TATA box binding
protein (Tbp), ubiquitin C (Ubc) and 18S rRNA
(Willems et al., 2006
)]
similar to previous reports (Vandesompele
et al., 2002
; Pfaffl et al.,
2004
), and normalized data were combined and analyzed together in
an analysis of variance (ANOVA) model. Prior to analysis, normalized apoptotic
gene expression levels were standardized by setting the levels on E10.5 as 1
(except when the data on E10.5 were not available, when the levels on E11.5
were set as 1), and dividing the data on all other days by E10.5 (or E11.5).
An array was constructed from the data for each apoptotic gene by
cross-classifying days and genders. Standardized data were analyzed after a
logarithmic transformation (loge) was applied to approximate
homogeneity of experimental variance, which was estimated by averaging the
variances of data within the array. The ANOVA model for testing differences
between mean values of days and genders was expanded a priori to test
differences between all combinations of day and gender. Inferences were based
on an overall 1% alpha level. Paired comparisons between individual levels of
daygender groups were evaluated at the 0.1% alpha level to adjust for multiple
comparisons, as an increase in the number of tests will inflate the type 1
error rate even if differences are due to chance alone.
Immunofluorescence analysis on whole-mount embryos or frozen sections
Embryos were fixed in 4% PFA. Whole-mount embryos were washed in 0.5%
NP-40, blocked in PBSST (PBS/0.3% Triton X-100 with 5% goat or donkey sera)
and incubated overnight at 4°C with primary antibody. The following day,
the embryos were washed in PBST (PBS/0.3% Triton X-100). FITC- or
Cy5-conjugated secondary antibodies (Jackson Immuno Research) were used for
detection, and embryos were cleared in glycerol for imaging. Embryos to be
sectioned were dehydrated in sucrose (except c-Kit-stained samples) and
mounted in OCT compound (Tissue-Tek) for cryosectioning. Bax/Steel embryos
were sectioned serially onto eight glass slides. At least three of eight
slides from each embryo were analyzed, and from these the total PGC numbers
were calculated. Sectioned embryos were rehydrated with PBST, blocked with
PBSST, and incubated with primary antibody overnight at 4°C or room
temperature. The next day, slides were washed with PBST, bound with secondary
antibody, and mounted with DABCO (Sigma) for imaging.
Primary antibodies were used at the following dilutions: Steel factor (sc-1303), 1:200; c-Kit (sc-1494), 1:100; and SSEA-1 (sc-21702), 1:200 (all from Santa Cruz Biotechnology). Anti-cleaved-PARP (#9544 Cell Signaling),1:200. Anti-phospho-histone H3 (#05-806 Upstate), 1:2000. Secondary antibodies (Jackson Immuno Research) were used at the following dilutions: Cy5 donkey anti-mouse, 1:200; Cy5 goat anti-rabbit, 1:200; Cy5 donkey anti-goat, 1:300; FITC donkey anti-mouse IgM, 1:200. Imaging was performed on an Axiovert 100M microscope equipped with a Zeiss LSM 510 confocal scanhead. Unpaired, two-tailed Student's t-tests with equal variances were used to compare counts from embryos of Bax/Steel crosses.
Embryo slice culture
Embryo slices were prepared as previously described
(Takeuchi et al., 2005
). To
examine the role of Steel/c-Kit signaling in migratory PGCs, soluble
recombinant Steel factor (#455-MC, R&D Systems) or c-Kit blocking
antibody, Ack2 (a kind gift from Dr Fred Finkelman, CCHMC) were added to the
slice cultures. The slices were immediately imaged on the confocal microscope,
then returned for overnight incubation into a humidified 37°C incubator.
The following day, the slices were again imaged and scored for PGC number and
location. Germ cells located in the midline (ventral to the entire diameter of
the dorsal aorta) were scored as ectopic. Experiments were repeated twice,
with four to six slices per dose group. For statistical comparisons, the data
were analyzed using unpaired, two-tailed Student's t-tests with equal
variances.
Steelkitl deletion mapping
Using genomic DNA from KitlSl+/+ adults and
KitlSl-/- embryos, we performed PCR on increasingly
narrowed regions toward the 5' breakpoint. Primers were designed to bind
to sequences 50, 150, 250, 350 and 450 kb upstream of Kitl. DNA from
KitlSl+/+ mice generated products with all primer sets,
however, the KitlSl-/- DNA yielded a product only with the
-450 kb primer set, mapping the 5' breakpoint between 350 and 450 kb
upstream of steel. Three new primer sets were then designed at regular
intervals between -350 and -450 and another round of PCR was performed to
further narrow the 5' breakpoint. After five total rounds of PCR the
5' breakpoint was mapped to a 350 bp region. The 3' breakpoint was
similarly mapped to a 380 bp region. We then performed PCR on
KitlSl-/- DNA using primers designed to span the deletion,
and then sequenced the products to define the precise boundaries of the
deletion.
|
| RESULTS |
|---|
|
|
|---|
PE:GFP embryos
at E10.5, and immunostained for the cleaved form of the caspase substrate,
PARP (Fig. 2). Germ cells
(GFP+) in the `midline' region (between the coelomic angles) and `bilateral'
regions (between the coelomic angles and the genital ridges on each side) were
counted and scored as apoptotic when they also showed red fluorescence
(cleaved-PARP). We found a 3.7-fold increase in the percentage of germ cells
undergoing apoptosis in the midline, compared with those in the lateral
regions (Fig. 2C,
1.55±0.55% in midline versus 0.42±0.18% in lateral region). This
is a conservative estimate of the difference, because the hindgut was removed
in order to image the dorsal body wall from the ventral aspect
(Fig. 2A), and germ cells that
fail to exit the hindgut also fragment and die
(Molyneaux et al., 2001
Expression of components of the intrinsic and extrinsic cell death pathway members in purified germ cells
To determine apoptotic pathway utilization by germ cells in the midline at
E10.5, we examined expression levels of members of the different apoptotic
pathways in germ cells at different stages. Germ cells were purified from
Oct4
PE:GFP embryos by flow cytometry each day between
E10.5 and E16.5. Germ cells from males and females were isolated separately
from E12.5 onwards. After E15.5, expression of the EGFP transgene is lost in
females, consistent with previous reports of female-specific Oct4
downregulation (Menke et al.,
2003
), so the analysis was not performed in E16.5 females.
Real-time RT-PCR was used to analyze cDNA transcripts of a selection of pro-
and anti-apoptotic pathway components. In each case, predicted mRNA levels
were normalized to five or six different housekeeping genes, to avoid the
effects of changing expression patterns of any individual housekeeping gene.
This method of normalization was developed by members of the Statistics Dept
at the University of Cincinnati (see Materials and Methods). Expression
patterns are shown in Fig. 3,
and are separated into those without (Fig.
3A) and with (Fig.
3B) gender-specific differences in expression.
The mRNAs for pro-apoptotic Bcl2 proteins found in the intrinsic pathway
(Bax, Bak, Bad and Bim), and Casp3 (caspase 3), were all upregulated at E10.5,
and downregulated in PGCs after colonization of the gonad. This implicates the
intrinsic pathway in midline germ cell death at E10.5. By contrast, mRNAs
encoding the extrinsic pathway receptor Fas, and Casp8 (not shown), were not
expressed at E10.5, ruling out the possible involvement of the extrinsic
apoptotic pathway. mRNA encoding the anti-apoptotic Bcl2 family member, Bcl-x,
was upregulated specifically in male PGCs at E15.5 and E16.5
(Fig. 3B) consistent with
previous reports (Rucker et al.,
2000
). Other genes with gender-specific regulation
(Fig. 3B) were Fas,
which was present only in males at the latest stages examined, consistent with
previous reports (Wang et al.,
1998
), and Casp6, which was briefly but consistently
upregulated in female PGCs at E13.5 and E14.5, suggesting a possible role in
the removal of defective germ cells during meiosis. The following genes were
also examined, but did not have significant differential regulation: Bcl2,
Bcl-w, Bid and Casp7. These data were independently confirmed by
microarray analysis of purified PGCs (M. Ramalho-Santos, personal
communication). In summary, we observed that migratory germ cells have
increased expression of intrinsic pro-apoptotic genes compared with later
stages, and that they also lack expression of key extrinsic apoptotic
factors.
|
PE:GFP+ E10.5 embryos with anti-c-Kit
antibody. Plasma membranes of both midline and lateral PGCs were labelled by
the antibody, and were enhanced in the former
(Fig. 4A), ruling out the
possibility that midline germ cell death is mediated by switching off
c-Kit. A faint signal was detected in somatic cells of
anti-c-Kit-stained samples (Fig.
4A, top). Although this wasn't detected in isotype-matched
controls (Fig. 4C), it is
probably due to non-specific binding of the goat polyclonal antibody, as every
cell in the embryo had the same level of background staining. To assay the
expression of Steel factor, we first measured the expression levels of
Steel mRNA. Dorsal body walls, including the genital ridges, from
E10.5 embryos were dissected into midline and lateral regions (dotted lines in
Fig. 4B), and Steel
mRNA levels, relative to the housekeeping gene, Odc1, were assayed by
real-time RT-PCR. Fig. 4B shows
that Steel mRNA levels are 36.5±3.8% lower in the midline
relative to expression in lateral regions at this stage. To test for Steel
factor protein expression, we stained E9.5 and E10.75 embryo slices with
anti-Steel factor antibody. Steel-null embryos did not stain positively for
the protein (Fig. 4D). At E9.5,
Steel protein was expressed in the mesentery of the hindgut and the midline
dorsal body wall, the ventral aspect of the aorta and at the coelomic angles
and genital ridges (Fig. 4E).
At E10.75, Steel staining was reduced or absent in the midline dorsal body
wall and gut mesentery, and enriched in the coelomic epithelium and genital
ridges (Fig. 4F). This shows
that expression patterns of Steel factor change between E9.5 and E10.5,
supporting the hypothesis that a change in the expression pattern of Steel
factor concentration causes midline germ cell death at E10.5. Two experiments were carried out to test this hypothesis further. First, we cultured E10.5 embryo slices in the presence of Steel factor. If the hypothesis is correct, then addition of Steel factor to the medium should allow midline germ cells to survive. Second, we cultured embryo slices in the presence of a blocking antibody against c-Kit, Ack2. If the hypothesis is correct, then all germ cells, whether located in the midline or laterally, should die. Fig. 5 shows that both of these predictions were true. Compared with untreated controls, PGCs in the midline of Steel factor-treated slices did not fragment and disappear (Fig. 5A,C), whereas blockade of Steel factor/c-Kit signaling using the Ack2 antibody caused germ cells to fragment and disappear everywhere in the slice (Fig. 5B,D). These data show that the pattern of Steel factor expression controls survival laterally, and death of midline migrating primordial germ cells.
Rescue of germ cell apoptosis by a null mutation in Steel by removal of Bax
In animals with severe alleles of Steel and c-Kit,
reduced numbers of germ cells are first seen at E9.0
(Bennett, 1956
;
Buehr et al., 1993
), when germ
cells are in the hindgut. This effect was originally ascribed to a loss of
proliferation (Bennett, 1956
;
Matsui et al., 1991
;
Buehr et al., 1993
). More
recent observations suggest that Steel signaling may be necessary to prevent
apoptosis. For example, cultured PGCs exposed to Steel factor decreased
expression of Bax protein (Felici et al.,
1999
), and Bax-null germ cells survived longer in culture when
treated with a c-Kit blocking antibody
(Stallock et al., 2003
). Also,
germ cells with abnormal morphology were recently identified in Steel mutant
embryos (Mahakali Zama et al.,
2005
). To test more stringently whether cell survival is the
primary target of Steel factor signaling, and whether Bax is downstream of
this in vivo, we systematically scored cleaved-PARP+ germ cells, germ cells
stained with the proliferation marker phospho-histone H3, and germ cell
position, in embryos lacking both Steel factor and Bax at E9.0 and E10.5.
|
|
|
|
|
The loss of Bax blocks germ cell apoptosis caused by loss of Steel factor at E9.0; this allowed us to test for other potential roles of Steel factor. If survival is its primary function, then other aspects of germ cell behaviour should proceed normally in Steel-/-, Bax-/- embryos.
To test this, we serially sectioned E10.5 embryos from Bax/Steel crosses, and scored them for germ cell numbers, position of germ cells in the embryo, apoptosis and mitosis (Fig. 8). Representative images from serially sectioned embryos are shown in Fig. 8A-I. At least three out of eight of the slides in a serial series were analyzed, and from these the total PGCs were calculated in each embryo. As expected, germ cells in E10.5 Bax+/-, Steel-/- embryos (not shown) were nearly absent, with only 17±14 per embryo compared with 1,145±252 for Bax+/-, Steel+/+ embryos, P<0.001, see Fig. 8L. Steel+/- embryos also had fewer germ cells than Steel+/+ embryos (730±288 vs 1145±252 for Bax+/-, P=0.067; 860±303 vs 1226±218 for Bax-/-, P=0.112, Fig. 8L); although not quite significant, this suggests a gene dosage effect of Steel factor on PGC number at E10.5.
|
The rescue of germ cell apoptosis by the loss of Bax also revealed a requirement for Steel factor in germ cell emigration from the gut. Fig. 8G-I shows that most of the germ cells in E10.5 Bax-/-, Steel-/- embryos failed to migrate out of the hindgut, and occupied the same positions as at E9.0. To quantify this, the positions of individual germ cells were scored in E10.5 serial sections. Germ cells ventral to the dorsal body wall (including the hindgut, the ventral half of the hindgut mesentery and structures ventral to the gut) were scored as `ectopic'. Nearly 78% of germ cells in Bax-/-, Steel-/- E10.5 embryos were ectopic compared with 5.8% in Steel+/+, Bax-/- embryos (P=3.6x10-5; Fig. 8M). Loss of one allele of Steel on a Bax null background (Bax-/-, Steel+/-) also increased the number of ectopic germ cells compared with Steel+/+ embryos (12.1%, P=0.019; Fig. 8M), revealing a gene dosage effect of Steel factor in germ cell migration that may only be seen when apoptosis of ectopic PGCs is prevented by the loss of Bax. These data show that Steel factor is essential for many aspects of germ cell behaviour during migration, a fact that is usually masked by its requirement for germ cell survival.
| DISCUSSION |
|---|
|
|
|---|
First, we show that regulation of apoptosis during migration (E10.5) causes
removal of midline germ cells. Apoptosis plays an important role in
elimination of germ cells throughout development, and seems to be tightly
regulated, as there are gender- and stagespecific variations in apoptotic
frequency (Coucouvanis et al.,
1993
; Koji, 2001
)
and gene expression (Rucker et al.,
2000
). We show that pro-apoptotic genes of the intrinsic pathway
are upregulated in migratory germ cells. Further, we show that most PGC
apoptosis at E10.5 occurs within the midline. These data support a model
(Fig. 1) in which migratory
germ cells are eliminated by reduction of a survival signal in the
midline.
Second, we show that the expression of Steel factor changes significantly between E9.5 and E10.5. When germ cells are in the midline at E9.5, Steel factor is expressed in midline cells around the hindgut. By E10.5, midline expression of Steel factor has become downregulated, but remains high bilaterally, as shown by both mRNA levels and protein distribution. Conversely, the receptor for Steel, c-Kit, is maintained in midline PGCs. Manipulation of the system, by addition of Steel factor everywhere, or abrogation of signal reception everywhere, confirms that the change in expression of Steel factor is the cause of the pattern of germ cell survival at E10.5 to E11.5. These data show that a combination of targeted migration and controlled cell death are required for the eventual localization of germ cells in the genital ridges. This is likely to be a general mechanism for cell migrations that occur during the period of rapid growth and organogenesis.
Steel factor has been known for many years to be a necessary survival
signal for germ cells (Dolci et al.,
1991
; Godin et al.,
1991
; Matsui et al.,
1991
). In null mutants for Steel or its receptor,
c-Kit, germ cell numbers are normal at E8.0, but are drastically
reduced compared with control embryos from E9.0 onward, purportedly due to a
defect in PGC proliferation, although the presence of morphologically dying
cells were also reported (Mintz,
1957
; Mintz and Russell,
1957
; Buehr et al.,
1993
; Mahakali Zama et al.,
2005
). We provide the first molecular evidence (cleaved-PARP) that
the loss of Steel factor leads to germ cell apoptosis in vivo. We show that
PGC apoptosis is already well underway by E9.0, and continues until most germ
cells are eliminated by E10.5. Because most germ cells in Steel
mutants die prior to or early in the normal period of PGC migration, and
because no germ cells survive to E11.5, the PGCs observed at E9.5 and E10.5
are presumably dying. This must be considered when interpreting observed
abnormalities in proliferation and/or migration, particularly in null
mutations.
Previous work has implicated the pro-apoptotic protein Bax in midline germ
cell death. In Bax-/- embryos, midline germ cells fail to
die in the E10.5 to E11.5 period. Instead, they colonize midline structures
(Stallock et al., 2003
). To
confirm that Bax is a necessary downstream component of the Steel/c-Kit
signaling pathway in activating midline germ cell death, we examined double
mutants. The results of this throw light upon several aspects of Steel
signaling. First, the absence of Bax in vivo did rescue germ cell apoptosis
caused by the loss of Steel factor. Germ cells continued to survive throughout
the migratory stages. However, they did not behave normally, indicating that
Steel factor plays other roles. First, germ cell proliferation stopped at
approximately E9.0. Thus, loss of Bax restored germ cell numbers in
Steel-/- embryos to approximately wild-type levels at
E9.0, but these numbers did not change over the next few days, and germ cells
in double knockout embryos did not stain with antibodies against
phospho-histone H3, a marker of mitotic cells. Furthermore, germ cells failed
to migrate from the hindgut, and clumps of germ cells were also found in
structures ventral to the gut. These data show that Steel factor is required
for both proliferation and migration of germ cells, in addition to its
essential role in their survival. Observations on embryos with severe alleles
of c-Kit, in which the few germ cells left at E9.0 were found only in
the ventral regions of the gut (Buehr et
al., 1993
), and more recently, observations on embryos with
hypomorphic alleles of Steel that had some germ cell survival past
E9.0 (Mahakali Zama et al.,
2005
), have also suggested that this ligand-receptor interaction
does more than just control germ cell survival. It will be interesting to
establish whether the downregulation of Steel factor in the midline is also
responsible for loss of directional germ cell migration in the midline at
E10.5, or whether germ cells are out of range of a different homing signal.
For example, midline PGCs may be unable to respond to the chemoattractant,
SDF1, either by lack of proximity to the source of the ligand, or possibly by
downregulation of its receptor, Cxcr4.
The incidence and distribution of human germ cell tumors illustrates the
importance of regulated cell death on the midline. Germ cell tumors are one of
the most common human neonatal and infantile neoplasms. More than 50% of these
are found outside the gonads, and the vast majority of these are in midline
structures. These midline germ cell tumors are thought to arise from germ
cells that fail to undergo midline cell death
(Ueno et al., 2004
). It will
be interesting to find out whether blockade of midline germ cell death will,
by itself, cause them to become tumorigenic, as does their transplantation
under the kidney capsule for example, or whether other genetic factors are
also required.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Anderson, R., Copeland, T. K., Scholer, H., Heasman, J. and
Wylie, C. (2000). The onset of germ cell migration in the
mouse embryo. Mech. Dev.
91, 61-68.[CrossRef][Medline]
Bedell, M. A., Cleveland, L. S., O'Sullivan, T. N., Copeland, N.
G. and Jenkins, N. A. (1996). Deletion and interallelic
complementation analysis of Steel mutant mice.
Genetics 142,935
-944.[Abstract]
Bendel-Stenzel, M., Anderson, R., Heasman, J. and Wylie, C.
(1998). The origin and migration of primordial germ cells in the
mouse. Semin. Cell. Dev. Biol.
9, 393-400.[CrossRef][Medline]
Bennett, D. (1956). Developmental analysis of a
mutation with pleiotropic effects in the mouse. J.
Morphol. 98,199
-233.[CrossRef]
Buehr, M., McLaren, A., Bartley, A. and Darling, S.
(1993). Proliferation and migration of primordial germ cells in
We/We mouse embryos. Dev. Dyn.
198,182
-189.[Medline]
Coucouvanis, E. C., Sherwood, S. W., Carswell-Crumpton, C.,
Spack, E. G. and Jones, P. P. (1993). Evidence that the
mechanism of prenatal germ cell death in the mouse is apoptosis.
Exp. Cell Res. 209,238
-247.[CrossRef][Medline]
Deckwerth, T. L., Elliot, J. L., Knudson C. M., Johnson, E. M.,
Jr, Snider, W. D. and Korsmeyer, S. J. (1996). BAX is
required for neuronal death after trophic factor deprivation and during
development. Neuron 17,401
-411.[CrossRef][Medline]
Dehner, L. P. (1986). Gonadal and extragonadal
germ cell neoplasms: Teratomas in childhood. In Pathology of
Neoplasia in Children and Adolescents (ed. M. Finegold and J. L.
Benington), pp. 282-312. Philadelphia: W. B. Saunders
Co.
Doitsidou, M., Reichman-Fried, M., Stebler, J., Koprunner, M.,
Dorries, J., Meyer, D., Esguerra, C. V., Leung, T. and Raz, E.
(2002). Guidance of primordial germ cell migration by the
chemokine SDF-1. Cell
111,647
-659.[CrossRef][Medline]
Dolci, S., Williams, D. E., Ernst, M. K., Resnick, J. L.,
Brannan, C. I., Lock, L. F., Lyman, S. D., Boswell, H. S. and Donovan, P.
J. (1991). Requirement for mast cell growth factor for
primordial germ cell survival in culture. Nature
352,809
-811.[CrossRef][Medline]
Felici, M. D., Carlo, A. D., Pesce, M., Iona, S., Farrace, M. G.
and Piacentini, M. (1999). Bcl-2 and Bax regulation of
apoptosis in germ cells during prenatal oogenesis in the mouse embryo.
Cell. Death Differ. 6,908
-915.[CrossRef][Medline]
Godin, I., Deed, R., Cooke, J., Zsebo, K., Dexter, M. and Wylie,
C. C. (1991). Effects of the steel gene product on mouse
primordial germ cells in culture. Nature
352,807
-809.[CrossRef][Medline]
Jiang, X., Gurel, O., Mendiaz, E. A., Stearns, G. W., Clogston,
C. L., Lu, H. S., Osslund, T. D., Syed, R. S., Langley, K. E. and Hendrickson,
W. A. (2000). Structure of the active core of human stem cell
factor and analysis of binding to its receptor kit. EMBO
J. 19,3192
-3203.[CrossRef][Medline]
Keshet, E., Lyman, S. D., Williams, D. E., Anderson, D. M.,
Jenkins, N. A., Copeland, N. G. and Parada, L. F. (1991).
Embryonic RNA expression patterns of the c-kit receptor and its cognate ligand
suggest multiple functional roles in mouse development. EMBO
J.10,2425
-2435.[Medline]
Knudson, C. M., Tung, K. S., Tourtellotte, W. G., Brown, G. A.
and Korsmeyer, S. J. (1995). Bax-deficient mice with lymphoid
hyperplasia and male germ cell death. Science
270, 96-99.
Koji, T. (2001). Male germ cell death in mouse
testes: possible involvement of Fas and Fas ligand. Med. Electron
Microsc. 34,213
-222.[CrossRef][Medline]
Loveland, K. L. and Schlatt, S. (1997). Stem
cell factor and c-kit in the mammalian testis: lessons originating from Mother
Nature's gene knockouts. J. Endocrinol.
153,337
-344.
Mahakali Zama, A., Hudson, F. P., 3rd and Bedell, M. A.
(2005). Analysis of hypomorphic KitlSl mutants suggests different
requirements for KITL in proliferation and migration of mouse primordial germ
cells. Biol. Reprod. 73,639
-647.
Matsui, Y., Toksoz, D., Nishikawa, S., Williams, D., Zsebo, K.
and Hogan, B. L. (1991). Effect of Steel factor and leukaemia
inhibitory factor on murine primordial germ cells in culture.
Nature 353,750
-752.[CrossRef][Medline]
McCoshen, J. A. and McCallion, D. J. (1975). A
study of the primordial germ cells during their migratory phase in Steel
mutant mice. Experientia
31,589
-590.[CrossRef][Medline]
Menke, D. B., Koubova, J. and Page, D. C.
(2003). Sexual differentiation of germ cells in XX mouse gonads
occurs in an anterior-to-posterior wave. Dev. Biol.
262,303
-312.[CrossRef][Medline]
Mintz, B. (1957). Embryological development of
primordial germ-cells in the mouse: Influence of a new mutation, Wj.
J. Embryol. Exp. Morphol.
5, 396-403.
Mintz, B. and Russell, E. S. (1957).
Gene-induced embryological modifications of primordial germ cells in the
mouse. J. Exp. Zool.
134,207
-237.[CrossRef][Medline]
Molyneaux, K. A., Stallock, J., Schaible, K. and Wylie, C.
(2001). Time-lapse analysis of living mouse germ cell migration.
Dev. Biol. 240,488
-498.[CrossRef][Medline]
Molyneaux, K. A., Zinszner, H., Kunwar, P. S., Schaible, K.,
Stebler, J., Sunshine, M. J., O'Brien, W., Raz, E., Littman, D., Wylie, C. et
al. (2003). The chemokine/CXCL12 and its receptor CXCR4
regulate mouse germ cell migration and survival.
Development 130,4279
-4286.
Molyneaux, K. A., Wang, Y., Schaible, K. and Wylie, C.
(2004). Transcriptional profiling identifies genes differentially
expressed during and after migration in murine primordial germ cells.
Gene Expr. Patterns 4,167
-181.[CrossRef][Medline]
Motro, B., van der Kooy, D., Rossant, J., Reith, A. and
Bernstein, A. (1991). Contiguous patterns of c-kit and steel
expression: analysis of mutations at the W and Sl loci.
Development 113,1207
-1221.[Abstract]
Pesce, M., Farrace, M. G., Piacentini, M., Dolci, S. and De
Felici, M. (1993). Stem cell factor and leukemia inhibitory
factor promote primordial germ cell survival by suppressing programmed cell
death (apoptosis). Development
118,1089
-1094.[Abstract]
Pfaffl, M. W., Tichopad, A., Prgomet, C. and Neuvians, T. P.
(2004). Determination of stable housekeeping genes,
differentially regulated target genes and sample integrity:
BestKeeper-Excel-based tool using pair-wise correlations.
Biotechnol. Lett. 26,509
-515.[CrossRef][Medline]
Pole, R. J., Qi, B. Q. and Beasley, S. W.
(2002). Patterns of apoptosis during degeneration of the
pronephros and mesonephros. J. Urol.
167,269
-271.[CrossRef][Medline]
Rucker, E. B., 3rd, Dierisseau, P., Wagner, K. U., Garrett, L.,
Wynshaw-Boris, A., Flaws, J. A. and Hennighausen, L. (2000).
Bcl-x and Bax regulate mouse primordial germ cell survival and apoptosis
during embryogenesis. Mol. Endocrinol.
14,1038
-1052.
Sarvella, P. A. and Russell, L. B. (1956).
Steel, a new dominant gene in the house mouse. J.
Hered. 47,123
-128.
Silvers, W. K. (1979). Steel, Flexed-Tail,
Splotch, and Varitint-Waddler. In The Coat Colors of
Mice (ed. S. Verlag), Chapter 11. Bar Harbor, Maine: The Jackson
Laboratory.
Stallock, J., Molyneaux, K., Schaible, K., Knudson, C. M. and
Wylie, C. (2003). The pro-apoptotic gene Bax is required for
the death of ectopic primordial germ cells during their migration in the mouse
embryo. Development 130,6589
-6597.
Takeuchi, Y., Molyneaux, K., Runyan, C., Schaible, K. and Wylie,
C. (2005). The roles of FGF signaling in germ cell migration
in the mouse. Development
132,5399
-5409.
Ueno, T., Tanaka, Y. O., Nagata, M., Tsunoda, H., Anno, I.,
Ishikawa, S., Kawai, K. and Itai, Y. (2004). Spectrum of germ
cell tumors: from head to toe. Radiographics
24,387
-404.
Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy,
N., De Paepe, A. and Speleman, F. (2002). Accurate
normalization of real-time quantitative RT-PCR data by geometric averaging of
multiple internal control genes. Genome Biol.
3, RESEARCH0034.
Wang, R. A., Nakane, P. K. and Koji, T. (1998).
Autonomous cell death of mouse male germ cells during fetal and postnatal
period. Biol. Reprod.
58,1250
-1256.
Willems, E., Mateizel, I., Kemp, C., Cauffman, G., Sermon, K.
and Leyns, L. (2006). Selection of reference genes in mouse
embryos and in differentiating human and mouse ES cells. Int. J.
Dev. Biol. 50,627
-635.[CrossRef][Medline]
Yeom, Y. I., Fuhrmann, G., Ovitt, C. E., Brehm, A., Ohbo, K.,
Gross, M., Hubner, K. and Scholer, H. R. (1996). Germline
regulatory element of Oct-4 specific for the totipotent cycle of embryonal
cells. Development 122,881
-894.[Abstract]
Zhang, Z., Zhang, R., Joachimiak, A., Schlessinger, J. and Kong,
X. P. (2000). Crystal structure of human stem cell factor:
implication for stem cell factor receptor dimerization and activation.
Proc. Natl. Acad. Sci. USA
97,7732
-7737.
This article has been cited by other articles:
![]() |
S. Yamaguchi, K. Kurimoto, Y. Yabuta, H. Sasaki, N. Nakatsuji, M. Saitou, and T. Tada Conditional knockdown of Nanog induces apoptotic cell death in mouse migrating primordial germ cells Development, December 1, 2009; 136(23): 4011 - 4020. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mithraprabhu and K. L Loveland Control of KIT signalling in male germ cells: what can we learn from other systems? Reproduction, November 1, 2009; 138(5): 743 - 757. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.D. West, M.I. Roche-Rios, S. Abraham, R.R. Rao, M.S. Natrajan, M. Bacanamwo, and S.L. Stice KIT ligand and bone morphogenetic protein signaling enhances human embryonic stem cell to germ-like cell differentiation Hum. Reprod., October 19, 2009; (2009) dep338v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gu, C. Runyan, A. Shoemaker, A. Surani, and C. Wylie Steel factor controls primordial germ cell survival and motility from the time of their specification in the allantois, and provides a continuous niche throughout their migration Development, April 15, 2009; 136(8): 1295 - 1303. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Heaney, M.-Y. J. Lam, M. V. Michelson, and J. H. Nadeau Loss of the Transmembrane but not the Soluble Kit Ligand Isoform Increases Testicular Germ Cell Tumor Susceptibility in Mice Cancer Res., July 1, 2008; 68(13): 5193 - 5197. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Boldajipour and E. Raz What Is Left Behind--Quality Control in Germ Cell Migration Sci. Signal., April 24, 2007; 2007(383): pe16 - pe16. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||