|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 November 2006
doi: 10.1242/dev.02671
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biology, University of Washington, Seattle, Washington 98195,
USA.
2 Department of Genome Sciences and University of Washington, Seattle,
Washington 98195, USA.
3 Center for Developmental Biology, University of Washington, Seattle,
Washington 98195, USA.
* Author for correspondence (e-mail: wakimoto{at}u.washington.edu)
Accepted 3 October 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Fertilization, Male fertility, Acrosome, Paternal effect mutations, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
To identify novel sperm molecules required for fertilization, we have
pursued a genetic approach using Drosophila melanogaster. Previous
studies of male sterile mutants indicated that those affecting fertilization
might be relatively rare. Therefore, we isolated and categorized a large
number of male-sterile mutations to find a subset that disrupt sperm-egg
interactions or induce paternal effect defects
(Fitch et al., 1998
;
Wakimoto et al., 2004
). We
previously described mutations in a gene called sneaky
(snky), which met our genetic criteria of specifically affecting
fertilization (Fitch and Wakimoto,
1998
). Mutations of snky showed detectable effects only
on male fertility. Sperm produced by mutant males were competent to enter the
egg but arrested before sperm nuclear decondensation and aster formation. We
proposed that this sperm activation defect was due to a failure in breakdown
of the sperm plasma membrane, a step that normally occurs immediately after
sperm entry into the egg in Drosophila.
In this study, we provide phenotypic evidence of a role for Snky in affecting the integrity of the sperm plasma membrane during fertilization. We molecularly identify the snky gene and characterize its transcript and predicted protein to investigate how the protein might function. The results indicate that Snky is an acrosomal membrane protein that is contributed to the early embryo. In addition to suggesting a possible molecular role for Snky, these studies have implications for the function and the fate of the acrosome during Drosophila fertilization.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Molecular characterization of the snky gene, mutations and transcript
Molecular studies were carried out essentially as described by Sambrook and
Russell (Sambrook and Russell,
2001
). Genomic fragments flanking P-element insertions in the
P{PZ} Syx1301470 and Df(3L)
Syx1301470R5 chromosomes were isolated and sequenced to
identify the P-element insertion site and locate the deficiency breakpoints
(Preston et al., 1996
). These
fragments were used as probes to select hybridizing genomic clones from a
phage library (Tamkun et al.,
1992
). Overlapping clones that spanned the deleted region were
used to probe genomic Southern blots containing DNA from
snky1 and its parental mwh red e line to identify
restriction site polymorphisms. The snkyZ0566 and
snkyZ4482 mutations were identified using PCR to amplify
and sequence selected regions from mutant and parental bw; st
chromosomes.
For northern blots (Fig. 2),
the lanes contained
0.25 µg polyA+ RNA from testes (350 pairs of
testes) or
7.4 µg polyA+ RNA isolated from 40 males after removal of
the testes. The probes were a 32P-labeled 3.3 kb AvaI
genomic fragment isolated from the clone BAC05N10 (UK-HGMP Resource Center)
and a clone containing the ribosomal protein gene rp49.
We sequenced snky cDNA clones, which we generated from polyA+ RNA isolated from testes of bw; st males. Standard protocols were used for reverse transcription (Gibco Superscript II RNAse H-Transcriptase Kit), 5' RACE (Ambion Choice RLM-RACE Kit), and cDNA cloning into the TOPO-TA vector (Invitrogen). Primers (Gibco) for cDNA amplification were: S1(CCTTCCTACTGGGACTCGTG), S2(GTTGTTGAAGGCCGAAAAGA), S3(CGAACTCCACGTCATTGAGA), S4(GTTGAGATCCTCGGCACAAT), S5(TTGTAAACTGCTTGGCCATCAAAT), S6(GGCAAAGGCCACTGCACGTA).
Construction of transgenic lines and assays for male fertility
The rat CD2 coding region was isolated as 1.1 kb
ClaI/XhoI fragment from a plasmid kindly provided by N. H.
Brown (Dunin-Borkowski and Brown,
1995
) and cloned downstream of the testis-specific ß2-tubulin
promoter in P-element transformation vector of Hoyle et al.
(Hoyle et al., 1995
). The
construct also contained the white+mc gene and was
introduced into y w1118 flies using standard germline
transformation techniques. A line carrying a transposon on chromosome 2 was
used to construct the y w1118; P[w+mc B2t::CD2] 2a;
snky1 e/TM3, y+ Ser e strain.
The genomic region containing the CG11281gene was isolated as a 7.3 kb
SalI fragment from BACN05H10 and cloned into pCasPeR4, which carries
the w+mc gene (Thummel
and Pirrotta, 1992
). Three independent insertions, denoted
P[w+mc snky+t7.3]A,
B and C were obtained. Two were on chromosome 3 and were
introduced into a snky- background by recombination onto
Df(3L) Syx1301470R5.
A transgene expressing Snky-GFP fusion protein, denoted P[w+mc snky-GFP] was created by inserting the Enhanced green fluorescent protein (EGFP) coding region from pEGFP-N3 (Clonetec) into the pCasPeR4-7.3 S construct described above. The fusion protein retained the snky+ gene promoter and flanking regions. It extended the snky+ open reading frame (ORF) just before the stop codon to include: a 30 bp linker from pEGPF-N3, the EGFP coding sequences (amino acid 1 to 237) and, as a consequence of the cloning scheme, an in-frame duplication of the last seven codons of the snky ORF. The transgene was used to generate the y w; P[w+mc snky-GFP]; snky1 e/TM3, y+ Ser e lines.
Fertility assays were performed for males carrying P[w+mc
snky+t7.3] or
P[w+mc snky-GFP] in a snky- background
to test for activity of the transgenes. Fertility was monitored in crosses of
single males mated to three wild-type (Canton-S) females. Percentage
of fertile crosses and progeny yield per male were compared to those of
control crosses, which used snky- brothers that lacked the
transgene or snky1/snky+ heterozygotes. Because
snky- males produce one to five progeny on occasion
(Fitch and Wakimoto, 1998
),
fertile crosses were defined as those yielding more than five offspring.
Assays for Snky-GFP and CD2 expression
To monitor Snky-GFP in testes, y w; snky-GFP; snky1 e
males were dissected in 2% paraformaldehyde in PBS (130 mmol/l NaCl, 7 mmol/l
Na2HPO4, 3 mmol/l NaH2PO4). Testis
squashes were prepared on poly-L-lysine coated slides, frozen in liquid
nitrogen, submerged in 95% cold ethanol, rinsed in PBS, then stained with 0.1
µg/ml DAPI (4',6-diamidine-2-phenylindole) to label nuclei. To label
the mitochondrial derivative, larval testes were incubated with 400 mmol/l
Mitotracker Dye (MT-CMXRos, Molecular Probes), then processed as described for
adult testes. To assay Snky-GFP in sperm in the reproductive tracts of females
and in eggs, wild-type females were mated to y w; snky-GFP;
snky1 e males. Sperm storage organs were dissected then
prepared as described above. Eggs were collected within 15 minutes of
deposition, dechorionated in 50% bleach, then fixed in 4% paraformaldehyde in
PBS overlaid with heptane. After vitelline envelopes were removed by hand,
eggs were processed without squashing as described above. All preparations
were mounted in Vectashield (Vector Laboratories). Images were acquired at
600x magnification using a Bio-Rad Radiance 2000 confocal microscope
equipped with a 488 nm Kr/Ar laser. Optical sections were typically 0.45
µm. Z-series stacks were assembled using NIH Image J
(http://rsb.info.nih.gov/ij/)
and images were edited using Adobe Photoshop.
Testes were isolated from adult males carrying the rCD2 transgene and fixed in 4% paraformaldehyde. For immunostaining, we used a 1:100 dilution of the primary OX-34 mouse anti-rat CD2 monoclonal antibody (Harlan Sera-Labs) and Alexa-488 goat anti-mouse antibody (Molecular Probes) as secondary antibody. Nuclei were counterstained with l µg/ml propidium iodide. The tissue was mounted in Vectashield for confocal microscopy. To track CD2 in embryos, wild-type females were mated to snky1 males carrying the rCD2 transgene. Eggs were collected within 20 minutes of deposition, aged for 30 minutes, then dechorionated in 50% bleach and transferred to poly-L-lysine coated slides. Eggs were squashed under a coverslip, and the slide was frozen in liquid nitrogen then submerged in 95% ethanol for 10 minutes. Tissue was fixed and incubated with the OX-34 antibody as described for testes. Secondary and tertiary fluorescent labeling of OX-34 was performed with Alexa 488 Signal-Amplification Kit (Molecular Probes) using the manufacturer's protocol. Nuclei were counterstained with DAPI. Images were obtained using a Nikon fluorescent microscope equipped with a CCD camera and edited with Adobe Photoshop.
| RESULTS |
|---|
|
|
|---|
The snky gene corresponds to predicted gene CG11281 and encodes a testis transcript
We previously mapped snky to the 69F-70A cytogenetic interval
(Fitch and Wakimoto, 1998
). To
refine localization, we generated deficiencies in the region using
P-element-mediated male recombination starting with the P{PZ}
Syx1301470 insertion. The strategy yielded a small deficiency,
denoted Df(3L) Syx1301470R5, that was homozygous viable
and conferred the snky- phenotype to surviving males.
Molecular mapping of the deficiency breakpoints defined a 185 kb genomic
interval within which we identified a restriction site polymorphism between
snky1 and its parent chromosome. The region overlapped
with CG11281, a gene predicted by the Drosophila Genome Project but
for which no expressed sequence tag or cDNAs had been reported.
|
|
|
Snky has two regions with noteworthy Cysteine residue patterns
(Fig. 3A,B). One region is
located in the largest predicted extramembrane loop and contains six Cys that
are separated by eight to 12 amino acids. The functional significance of this
region, which we refer to as the patterned 6 Cys motif, is indicated by the
snkyZ0566 mutation, which changes the second of these Cys
to a Ser. The second region is located near the carboxyl end and consists of
four pairs of C-X2-Cs (where X is any amino acid) that are linked by four to
ten residues. This second pattern corresponds to a variant of the Pfam C3HC4
RING finger (zf-PF00097) (Finn et
al., 2006
). In Snky, a Cys is substituted for the His resulting in
a C4-C4 variant. Additionally, a coiled-coil domain is predicted in Snky from
residue 597 to 624.
Snky is a member of a protein family
BLAST searches (blastp)
(Altschul et al., 1997
) of
non-redundant sequences in NCBI identified a series of Snky-related proteins
present in invertebrates and vertebrates. Of these, a set of proteins, which
we refer to as the Snky family, not only have the highest level of amino acid
identity across their entire length, but also share additional features. All
are predicted to have multiple transmembrane domains. Each also has the
patterned 6 Cys motif in a predicted extramembrane loop that follows the
pattern: C-(10X)-C-(10X)-C-(12-13X)-C-(8X)-C-(9-12X)-C. These proteins also
contain a RING finger with the consensus pattern:
C-(2X)-C-(10-11X)-C-(2-4X)-C-(4X)-C-(2X)-C-(7X)-C-(2X)-C. The Snky proteins
include: a mosquito protein (Aedes aegypti, EAT46485, conceptual
translation) with 30% amino acid identity; a zebrafish protein (XP683798,
conceptual translation) with 22.2% identity; a human protein (BAB71440) with
22% identity; and a mouse protein (XP994048) with 21.8% identity. The human
and mouse protein sequences are supported by full-length testis cDNAs.
Although expressed sequence tags have also been isolated from other tissues,
comparison of available sequence indicates the possibility of testis-specific
isoforms in humans. CLUSTAL W alignment
(Thompson et al., 1994
)
revealed three regions, which are the most highly conserved among Snky family
members. These regions are denoted a, b and c in Figs
3 and
4. Regions b and c overlap with
the ends of the region that defines the DC-STAMP sequence family (Pfam
PF07782). In Snky, the DC-STAMP-like region extends 192 amino acids, from
amino acid 406-597.
Snky is more distantly related to other proteins that had been previously
recognized as containing DC-STAMP-like regions. They include the human and
mouse DC-STAMP-Domain Containing-2 Proteins, the Caenorhabditis
elegans sperm protein SPE-42 (Kroft
et al., 2005
) and a Drosophila protein encoded by the
CG6845 gene. These proteins contain a RING finger and a Cysteine-containing
region spaced similar to the patterned 6 Cys motif in Snky. However, compared
with proteins described above, they show a reduced level of identity with Snky
at the amino acid level (10-17% identity), particularly in regions a, b and c.
Included in this group is a predicted sea urchin protein (XP795449) with 15.1%
identity to Snky. Even more distantly related are the human and mouse
DC-STAMP, which contain the DC-STAMP domain but lack a RING finger and a
patterned 6 Cys motif.
Localization of a Snky-Green fluorescent protein fusion during spermatogenesis
We generated transgenic flies that contained a snky-Green fluorescent
protein fusion gene expressed from the snky promoter. The fusion
protein contained the entire Snky protein and Enhanced GFP at the carboxyl
terminus. Four independent transgenic lines were recovered and in each line,
the transgene significantly rescued the snky- male sterile
phenotype in a single dose. The transgene used in all subsequent studies
rescued fertility to a level comparable to that conferred by the
snky+ transgene (Table
1). Hence, the Snky-GFP fusion protein was highly active and could
be used as a tool to deduce the localization of the normal Snky protein.
To examine tissue expression of Snky-GFP, we examined larvae and adults
that were homozygous for a snky-GFP transgene and the
snky1 mutation. We detected expression only in the testis.
To determine when Snky-GFP is expressed, we distinguished the different stages
of spermatogenesis by the characteristic morphology of nuclei and
mitochondrial derivatives (A. D. Tates, PhD thesis, University of Leiden,
1971) (Fuller, 1993
). Nuclei
were monitored by DAPI staining and mitochondrial derivatives were visualized
by MitoTracker Red-CMXRos staining. Snky-GFP was first detected in primary
spermatocytes as a diffuse cytoplasmic signal
(Fig. 5A), consistent with
localization to the endoplasmic reticulum and as expected for an integral
membrane protein. Following meiosis, at the onion stage, which is
characterized by round spermatid nuclei and comparably sized mitochondrial
derivatives, a prominent cluster of Snky-GFP spots was seen just adjacent each
nucleus (Fig. 5B). The
structures at this stage corresponded in size and location to the aggregated
Golgi complexes that Tates (A. D. Tates, PhD thesis, University of Leiden,
1971) referred to as the acroblast. With continued differentiation, as nuclear
condensation began and mitochondrial derivatives and sperm tails elongated,
Snky-GFP was present as multiple irregular spots throughout the cytoplasm.
However, one spherical Snky-GFP signal, generally larger than the others, was
located adjacent to each nucleus (Fig.
5C). This site of Snky-GFP was the only visible signal retained as
spermatids became fully elongated (Fig.
5D,E). In individualized mature sperm, the Snky-GFP signal
exhibited a thin oval shape located at the tip of the sperm, with its distal
end slightly overlapping with apical end of the needle-shaped nucleus
(Fig. 5F). This pattern of
localization and the predicted structure of Snky suggest that it is an
integral membrane protein targeted to the acrosome during spermatogenesis.
The fate of Snky-GFP and the acrosome during fertilization
Snky-GFP allowed us to examine the fate of Snky and the acrosome during
normal fertilization. In Drosophila, females store sperm after
mating. We examined seminal receptacles (sperm storage organs) from wild-type
females mated to snky1 males that carried two copes of the
Snky-GFP transgene. The Snky-GFP signal we observed in stored sperm appeared
identical to that seen in mature sperm from the testis (data not shown).
|
These studies revealed two surprising discoveries. The first of these was
that sperm contributed Snky-GFP to the egg. The second remarkable finding was
that the GFP signals observed in the egg and early cycle 1 embryos
consistently appeared similar to those observed in mature sperm. We considered
two possibilities to account for the retention of bright GFP signals in the
egg cytoplasm. The paternally inherited structure could be an acrosomal
vesicle, with the Snky-GFP signal marking the boundaries of an intact
acrosome. Alternatively, the GFP signal could reflect retention of a large
membrane remnant from a spent acrosome. To distinguish between the two
possibilities, we obtained a transgenic line that expressed a soluble form of
GFP in the acrosome. This line (gift of J. Brill) expresses the
GFPsecr protein under the control of a testis-specific promoter.
GFPsecr was designed and characterized by Pfeiffer et al.
(Pfeiffer et al., 2000
;
Pfeiffer et al., 2002
), and it
contains the signal peptide from the Wingless protein fused to GFP. When
expressed in embryonic or imaginal disc epithelial cells, GFPsecr
is targeted to the secretory pathway, packaged in secretory vesicles and
released into the extracellular space upon secretion
(Pfeiffer et al., 2002
). These
properties predict that if GFPsecr is present in the acrosome, the
GFP signal will dissipate upon acrosome exocytosis.
We examined eggs fertilized by sperm expressing GFPsecr. Of the 22 eggs captured between earliest stages of sperm nuclear decondensation (Fig. 6E) to prometaphase of cycle 1 (Fig. 6H), 21 showed a GFPsecr signal. In each case, the appearance was similar to that observed with Snky-GFP (compare higher magnification insets of Fig. 6A-H). These data are consistent with the retention of an intact acrosomal vesicle by the sperm during fertilization, the release of the vesicle into the egg cytoplasm after PMBD, and the persistence of the acrosome at least as late as prometaphase of the first embryonic cycle.
|
|
| DISCUSSION |
|---|
|
|
|---|
|
The predicted structure of Snky, with its multiple transmembrane domains,
and our Snky-GFP localization studies provide evidence that Snky is an
acrosomal membrane protein. This localization presents the intriguing question
of how an acrosomal membrane protein is able to influence the integrity of the
sperm plasma membrane. The findings also have broader implications for
acrosome function. The acrosome is a Golgi-derived membrane-bound organelle
found at the apical end of sperm, and its function has been extensively
studied in marine invertebrates and mammals. In these organisms, the acrosome
is best known as a specialized secretory vesicle that undergoes exocytosis.
Like many secretory events, a rise in intracellular Ca2+ is
required for acrosome exocytosis. This increase in Ca2+ requires
influx into the sperm as well as efflux from internal stores. The acrosome has
been identified as an internal source of Ca2+ and is believed to
release Ca2+ to contribute to its own exocytosis
(Walensky and Snyder, 1995
;
Herrick et al., 2005
).
Ultrastructural studies show that exocytosis involves vesiculation of the
outer acrosomal membrane and overlying plasma membrane. This results in the
release of contents of the acrosome, which include hydrolytic enzymes and
other components that facilitate binding and penetration through the egg
coats. Exocytosis also exposes the inner acrosomal membrane, resulting in a
new membrane patch and associated acrosomal molecules on the surface of the
sperm. In marine invertebrates, this newly exposed region is the site of
binding and membrane fusion with the egg
(Colwin and Colwin, 1967
;
Lopo et al., 1982
), providing
a direct physical link between the requirement for acrosome exocytosis and
membrane fusion. In mammals, acrosome exocytosis is also a prerequisite for
sperm to bind to and fuse with the egg. However, the plasma membrane that lies
over the equatorial segment of the acrosome, and not the acrosome membrane
itself, is believed to be the point of membrane fusion with the egg
(Yanagimachi, 1994
).
Experimental studies of hamster sperm by Takano et al.
(Takano et al., 1998
) suggest
that fusion competency of this specialized region of mammalian sperm requires
changes that occur immediately before or during acrosome exocytosis, as well
as the contents of the acrosome.
Considering these known acrosome functions, it is interesting that
acrosomes are not universal features of animal sperm. Acrosomes are not
present in the amoeboid sperm of nematodes, and they are occasionally absent
or reduced in species that otherwise possess the flagellated sperm typical of
animals (Baccetti, 1979
). For
instance, the absence or reduction of an acrosome in mature sperm of teleosts
(Coward et al., 1996
) and
certain insect species (Baccetti,
1972
; Dallai et al.,
2003
) is well documented and is generally considered a derived
condition (Baccetti, 1979
).
Hence the requirement for the acrosome during fertilization has been
eliminated or bypassed in some lineages during the course of evolution.
Ultrastructural studies show that an acrosome is typical of insect sperm
(Baccetti, 1972
). However, few
studies have examined the role of the insect acrosome during fertilization.
Studies of fertilization in the house fly Musca domestica suggested
`loosening or loss' of the sperm plasma membrane before entry into the
micropyle of the egg, followed by exocytosis of acrosomal contents during
passage of the sperm through the micropyle
(Degrugillier and Leopold,
1976
).
Our studies revealed a different fate for the Drosophila acrosome.
The observation that Snky-GFP was a paternally contributed molecule to the
early egg was a surprising finding. The persistence of a single prominent
Snky-GFP structure, with an intensity and shape in eggs that appeared similar
to those seen in mature sperm, suggests the possibility that the inherited
structure was an intact acrosome. This possibility was further supported by
studies tracking GFPsecr, a soluble protein that is secreted into
the extracellular space when expressed in other Drosophila cells
(Pfeiffer et al., 2002
). Its
robust and identical appearance to Snky-GFP argues against exocytosis, at
least until after prometaphase of the first embryonic cell cycle.
These cytological observations of the fate of the acrosome during normal
fertilization, combined with the defect in PMBD observed in
snky- mutant sperm, suggest that the acrosome may be
acting primarily as a signaling vesicle to elicit changes in the overlying
sperm plasma membrane. This activity requires the Snky acrosomal membrane
protein, but occurs without acrosome exocytosis. Snky may be serving as a
receptor that permits communication between the acrosome and plasma membrane.
Alternatively, Snky or its associated proteins may serve to initiate or
maintain contact between the membranes, or modify membrane lipids or proteins
in preparation for PMBD. In this sense, Snky, DC-STAMP and SPE-42 may share a
common mechanism in promoting membrane interactions
(Yagi et al., 2005
;
Kroft et al., 2005
). However,
in the case of Snky, the pathway would lead to breakdown of the overlying
plasma membrane, rather than fusion between two membranes.
In Drosophila, Snky is required specifically for male fertility. It will be interesting to determine whether Snky family members are required for sperm function in zebrafish, which have sperm that lack acrosomes, and for acrosome function in marine invertebrate and mammalian sperm. If human Snky-like proteins are specifically required for sperm function, then they may be potential targets for male contraceptives. More immediately, our studies of Snky provide tools for further investigating how the membrane events that occur during Drosophila fertilization compare to conventional views of membrane dynamics during sperm activation and fertilization in animals. Research on the acrosome has focused primarily on its function as a specialized secretory or Ca2+ storage vesicle. Our studies suggest a primary role as signaling vesicle in Drosophila, with a newly identified acrosomal membrane protein communicating directly or indirectly with the plasma membrane to affect changes in membrane integrity. Comparisons among species should continue to shed light on the intriguing ways in which sperm structures and fertilization molecules, such as Snky, may be selected for conservation or diversification during the course of evolution.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L. M., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. J. and Lipman, D. J. (1997). Gapped
BLAST and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Arai, M., Mitsuke, H., Ikeda, M., Xia, J.-X., Kikuchi, T.,
Satake, M. and Shimuze, T. (2004). ConPred II: a consensus
prediction method for obtaining transmembrane topology models with high
reliability. Nucleic Acids Res.
32,W390
-W393.
Arioli, T., Peng, L., Betzner, A. S., Burn, J., Wittke, W.,
Herth, W., Camilleri, C., Hofte, H., Plazinski, J., Birch, R. et al.
(1998). Molecular analysis of cellulose biosynthesis in
Arabidopsis. Science
279,717
-720.
Baccetti, B. (1972). Insect sperm cells.
Adv. Insect Physiol. 9,315
-397.
Baccetti, B. (1979). The evolution of the
acrosomal complex. In The Spermatozoon: Maturation, Motility,
Surface Properties, and Comparative Aspects (ed. D. W. Fawcett
and J. M. Bedford), pp. 305-329. Baltimore-Munich:
Urban and Schwarzenberg.
Borden, K. L. B. (2000). RING domains: master
builders of molecular scaffolds? J. Mol.
Biol. 295,1103
-1112.
Colwin, L. H. and Colwin, A. L. (1967).
Membrane fusion in relation to sperm-egg association. In
Fertilization: Comparative Morphology, Biochemistry, and
Immunology (ed. C. B. Metz and A. Monroy), pp.295
-367. New York: Academic Press.
Coward, K., Bromage, N. R., Hibbitt, O. and Parrington, J.
(1996). Gamete physiology, fertilization and egg activation in
teleost fish. Rev. Fish Biol. Fish.
12, 33-58.
Dallai, R., Beani, L., Kathirithamby, J., Lupetti, P. and
Afzelius, B. A. (2003). New findings on sperm ultrastructure
of Xenos vesparum (Rossi) (Strepsiptera, Insect). Tissue
Cell 35,19
-27.[CrossRef][Medline]
Degrugillier, M. E. and Leopold, R. A. (1976).
Ultrastructure of sperm penetration of house fly eggs. J.
Ultrastruct. Res. 56,312
-325.[CrossRef][Medline]
Dunin-Borkowski, O. M. and Brown, N. H. (1995).
Mammalian CD2 is an effective heterologous marker of the cell surface in
Drosophila. Dev. Biol.
168,689
-693.[CrossRef][Medline]
Evans, J. P. (2002). The molecular basis of
sperm-oocyte membrane interactions during mammalian fertilization.
Hum. Reprod. Update 8,297
-311.
Finn, R. D., Mistry, J., Schuster-Bockler, B., Griffiths-Jones,
S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R.
et al. (2006). Pfam: clans, web tools and services.
Nucleic Acids Res. 34,D247
-251.
Fitch, K. R. and Wakimoto, B. T. (1998). The
paternal effect gene ms(3)sneaky is required for sperm activation and
the initiation of embryogenesis in Drosophila melanogaster. Dev.
Biol. 197,270
-282.[CrossRef][Medline]
Fitch, K. R., Yasuda, G. Y., Owens, K. N. and Wakimoto, B.
T. (1998). Paternal effects in Drosophila:
Implications for the mechanisms of early development. Curr. Top.
Dev. Biol. 38,1
-34.[Medline]
Flesch, F. M. and Gadella, B. M. (2000).
Dynamics of the mammalian sperm plasma membrane in the process of
fertilization. Biochim. Biophys. Acta
1469,197
-235.[Medline]
Fuller, M. T. (1993). Spermatogenesis. In
The Development of Drosophila melanogaster. Vol.I
(ed. M. Bate and A. Martinez-Arias), pp.71
-148. Cold Spring Harbor: Cold Spring Harbor
Laboratory Press.
Hanzawa, H., de Ruwe, M. J., Albert, T. K., van der Vlietl, P.
C., Timmers, H. T. M. and Boelens, R. (2001). The structure
of the C4C4 RING finger of human NOT4 reveals features distinct from those of
the C3HC4 RING fingers. J. Biol. Chem.
276,10185
-10190.
Hartgers, F. C., Vissers, J. L. M., Looman, M. W. G., van
Zoelen, C., Huffine, C., Figdor, C. G. and Adema, G. J.
(2000). DC-STAMP, a novel multimembrane-spanning molecule
preferentially expressed by dendritic cells. Eur. J.
Immunol. 30,3585
-3590.[CrossRef][Medline]
Herrick, S. B., Schweissinger, D. L., Kim, S. W., Bayan, K. R.,
Mann, S. and Cardullo, R. A. (2005). The acrosomal vesicle of
mouse sperm is a calcium store. J. Cell Phys.
202,663
-671.[CrossRef][Medline]
Hirokawa, T., Boon-Chieng, S. and Mitaku, S.
(1998). SOSUI: Classification and secondary structure prediction
system for membrane proteins. Bioinformatics
14,378
-379.
Hoyle, H. D., Hutchens, J. A., Turner, F. R. and Raff, E. C.
(1995). Regulation of beta-tubulin function and expression in
Drosophila spermatogenesis. Dev. Genet.
16,148
-170.[CrossRef][Medline]
Kall, L., Krogh, A. and Sonnhammer, E. L. L.
(2004). A combined transmembrane topology and signal peptide
prediction method. J. Mol. Biol.
338,1027
-1036.[CrossRef][Medline]
Kellenberger, E., Dominguez, C., Fribourg, S., Wasielewski, E.,
Moras, D., Poterszman, A., Boelens, R. and Kieffer, B.
(2005). Solution structure of the C-terminal domain of TFIIH P44
subunit reveals a novel type of C4C4 RING domain involved in protein-protein
interaction. J. Biol. Chem.
280,20785
-20792.
Koundakjian, E., Cowan, D. M., Hardy, R. W. and Becker, A.
H. (2004). The Zuker Collection: a resource for the analysis
of autosomal gene function in Drosophila melanogaster.Genetics 167,203
-206.
Kroft, T., Gleason, E. J. and L'Hernault, S. W.
(2005). The spe-42 gene in required for sperm-egg
interactions during C. elegans fertilization and encodes a
sperm-specific transmembrane protein. Dev. Biol.
286,169
-181.[CrossRef][Medline]
Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E. L.
(2001). Predicting transmembrane protein topology with a hidden
Markov model: application to complete genomes. J. Mol.
Biol. 305,567
-580.[CrossRef][Medline]
Kukita, T., Wada, N., Kukita, A., Kakimoto, T., Sandra, F., Toh,
K., Nagata, K., Iijima, T., Horiuchi, M., Matsusaki, M. et al.
(2004). RANKL-induced DC-STAMP is essential for
osteoclastogenesis. J. Exp. Med.
200,941
-946.
Lopo, A. C., Glabe, C. G., Lennarz, W. J. and Vacquier, V.
D. (1982). Sperm-egg binding events during sea urchin
fertilization. Ann. New York Acad. Sci.
383,405
-425.[Medline]
Neill, A. T. and Vacquier, V. D. (2004).
Ligands and receptors mediating signal tranduction in sea urchin.
Reproduction 127,141
-149.
Ohsako, T., Hirai, K. and Yamamoto, M.-T.
(2003). The Drosophila misfire gene has an essential
role in sperm activation during fertilization. Genes Genet.
Syst. 78,253
-266.[CrossRef][Medline]
Perotti, M.-E. (1975). Ultrastructural aspects
of fertilization in Drosophila. In The Functional Anatomy of the
Spermatozoan, Proceedings of the Second International Symposium
(ed. B. A. Afzelins), pp. 57-68. Oxford: Pergamon
Press.
Pfeiffer, S., Alexandre, C., Calleja, M. and Vincent, J.-P.
(2000). The progeny of wingless-expressing cells deliver
the signal at a distance in Drosophila embryos. Curr.
Biol. 10,321
-324.[CrossRef][Medline]
Pfeiffer, S., Ricardo, S., Manneville, J.-B., Alexandre, C. and
Vincent, J.-P. (2002). Producing cells retrain and recycle
wingless in Drosophila embryos. Curr.
Biol. 12,957
-962.[CrossRef][Medline]
Preston, C. R., Sved, J. A. and Engels, W. R.
(1996). Flanking duplications and deletions associated with
P-induced male recombination in Drosophila. Genetics
144,1623
-1638.[Abstract]
Pugh, D. J. R., Eiso, A. B., Faro, A., Lutya, P. T., Hoffman, E.
and Rees, D. J. G. (2006). DWNN, a novel ubiquitin-like
domain, implicates RBBP6 in mRNA processing and ubiquitin-like pathways.
BMC Struct. Biol. 6,1
.[CrossRef][Medline]
Rubinstein, E., Ziyyat, A., Wolf, J.-P., Le Naour, F. and
Boucheix, C. (2006). The molecular players of sperm-egg
fusion in mammals. Semin. Cell Dev. Biol.
17,254
-263.[CrossRef][Medline]
Sambrook, J. and Russell, D. W. (2001).
Molecular Cloning: a Laboratory Manual. Cold Spring
Harbor, CSHL Press.
Takano, H., Yanagimachi, R. and Urch, U. A.
(1998). Evidence that acrosin activity is important for the
development of fusibility of mammalian spermatozoa with the oolema: inhibitor
studies using the golden hamster. Zygote
1, 79-91.
Talbot, P., Shur, B. D. and Myles, D. G.
(2003). Cell adhesion and fertilization: steps in oocyte
transport, sperm-zona pellucida interactions, and sperm-egg fusion.
Biol. Reprod. 68,1
-9.
Tamkun, J. W., Deuring, R., Scott, M., Kissinger, M.,
Pattatucci, A. M., Kaufman, T. C. and Kennison, J. A. (1992).
brahma: a regulator of Drosophila homeotic genes structurally related
to the yeast transcriptional activator SNF2/SW12. Cell
68,561
-572.[CrossRef][Medline]
Thompson, J. D., Higgins, D. G. and Gibson, T. J.
(1994). CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap
penalities and weight matrix choice. Nucleic Acids
Res. 22,4673
-4680.
Thummel, C. and Pirrotta, V. (1992). New
pCasPeR P element vectors. Dros. Info. Serv.
71, 150.
Tusnady, G. E. and Simon, I. (2001). The HMMTOP
transmembrane topology prediction server.
Bioinformatics 17,849
-850.
Wakimoto, B. T., Lindsley, D. and Herrera, C.
(2004). Toward a comprehensive genetic analysis of male fertility
in Drosophila melanogaster. Genetics
167,207
-216.
Walensky, L. D. and Snyder, S. H. (1995).
Inositol 1,4,5-Trisphosphate receptors selectively localized to the acrosomes
of mammalian sperm. J. Cell Biol.
130,857
-869.
Wong, R., Hadjiyanni, I., Wei, H.-C., Polevoy, G., McBride, R.,
Sem, K.-P. and Brill, J. A. (2005). PIP2 hydrolysis and
calcium release are required for cytokinesis in Drosophila
spermatocytes. Curr. Biol.
15,1401
-1406.[CrossRef][Medline]
Yagi, M., Miyamoto, T., Sawatani, Y., Iwamoto, K., Hosogane, N.,
Fujita, N., Morita, K., Ninomiya, K., Suzuki, T., Miyamoto, K. et al.
(2005). DC-STAMP is essential for cell-cell fusion in osteoclasts
and foreign body giant cells. J. Exp. Med.
202,345
-351.
Yanagimachi, R. (1994). Mammalian
fertilization. In The Physiology of Reproduction (ed.
J. D. Neill and E. Knobil), pp. 189-317. New York:
Raven Press.
Related articles in Development:
This article has been cited by other articles:
![]() |
A. Deredec, A. Burt, and H. C. J. Godfray The Population Genetics of Using Homing Endonuclease Genes in Vector and Pest Management Genetics, August 1, 2008; 179(4): 2013 - 2026. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Karr Fruit flies and the sperm proteome Hum. Mol. Genet., October 15, 2007; 16(R2): R124 - R133. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||