spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 8 November 2006
doi: 10.1242/dev.02671


Development 133, 4871-4879 (2006)
Published by The Company of Biologists 2006


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02671v1
133/24/4871    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilson, K. L.
Right arrow Articles by Wakimoto, B. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, K. L.
Right arrow Articles by Wakimoto, B. T.

Sperm plasma membrane breakdown during Drosophila fertilization requires Sneaky, an acrosomal membrane protein

Kathleen L. Wilson1, Karen R. Fitch2, Blaine T. Bafus1 and Barbara T. Wakimoto1,2,3,*

1 Department of Biology, University of Washington, Seattle, Washington 98195, USA.
2 Department of Genome Sciences and University of Washington, Seattle, Washington 98195, USA.
3 Center for Developmental Biology, University of Washington, Seattle, Washington 98195, USA.

* Author for correspondence (e-mail: wakimoto{at}u.washington.edu)

Accepted 3 October 2006


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fertilization typically involves membrane fusion between sperm and eggs. In Drosophila, however, sperm enter eggs with membranes intact. Consequently, sperm plasma membrane breakdown (PMBD) and subsequent events of sperm activation occur in the egg cytoplasm. We previously proposed that mutations in the sneaky (snky) gene result in male sterility due to failure in PMBD. Here we support this proposal by demonstrating persistence of a plasma membrane protein around the head of snky sperm after entry into the egg. We further show that snky is expressed in testes and encodes a predicted integral membrane protein with multiple transmembrane domains, a DC-STAMP-like domain, and a variant RING finger. Using a transgene that expresses an active Snky-Green fluorescent protein fusion (Snky-GFP), we show that the protein is localized to the acrosome, a membrane-bound vesicle located at the apical tip of sperm. Snky-GFP also allowed us to follow the fate of the protein and the acrosome during fertilization. In many animals, the acrosome is a secretory vesicle with exocytosis essential for sperm penetration through the egg coats. Surprisingly, we find that the Drosophila acrosome is a paternally inherited structure. We provide evidence that the acrosome induces changes in sperm plasma membrane, exclusive of exocytosis and through the action of the acrosomal membrane protein Snky. Existence of testis-expressed Snky-like genes in many animals, including humans, suggests conserved protein function. We relate the characteristics of Drosophila Snky, acrosome function and sperm PMBD to membrane fusion events that occur in other systems.

Key words: Fertilization, Male fertility, Acrosome, Paternal effect mutations, Drosophila


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Studies of fertilization have revealed the universal importance of membrane events to prepare and coordinate the gametes and ensure their successful union. These events have been most extensively studied in sperm of selected marine invertebrate and mammalian species and include dynamic changes in membrane proteins and lipids during sperm capacitation, acrosome exocytosis, binding, adhesion and membrane fusion with the egg (reviewed by Flesch and Gadella, 2000Go; Evans, 2002Go). The majority of molecules with confirmed roles in these processes are cell adhesion molecules, ion channels or signal transduction components with molecular mechanisms of action that have been studied in multiple cell types (reviewed by Talbot et al., 2003Go; Neill and Vacquier, 2004Go; Rubinstein et al., 2006Go). There is considerable interest in discovering proteins that act specifically during fertilization. The characterization of these molecules will contribute to a better understanding of the specialized properties of gametes and to the practical goal of identifying new targets for contraceptives.

To identify novel sperm molecules required for fertilization, we have pursued a genetic approach using Drosophila melanogaster. Previous studies of male sterile mutants indicated that those affecting fertilization might be relatively rare. Therefore, we isolated and categorized a large number of male-sterile mutations to find a subset that disrupt sperm-egg interactions or induce paternal effect defects (Fitch et al., 1998Go; Wakimoto et al., 2004Go). We previously described mutations in a gene called sneaky (snky), which met our genetic criteria of specifically affecting fertilization (Fitch and Wakimoto, 1998Go). Mutations of snky showed detectable effects only on male fertility. Sperm produced by mutant males were competent to enter the egg but arrested before sperm nuclear decondensation and aster formation. We proposed that this sperm activation defect was due to a failure in breakdown of the sperm plasma membrane, a step that normally occurs immediately after sperm entry into the egg in Drosophila.

In this study, we provide phenotypic evidence of a role for Snky in affecting the integrity of the sperm plasma membrane during fertilization. We molecularly identify the snky gene and characterize its transcript and predicted protein to investigate how the protein might function. The results indicate that Snky is an acrosomal membrane protein that is contributed to the early embryo. In addition to suggesting a possible molecular role for Snky, these studies have implications for the function and the fate of the acrosome during Drosophila fertilization.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Drosophila
strains Mutations are described in Fitch and Wakimoto (Fitch and Wakimoto, 1998Go) or FlyBase (http://flybase.bio.indiana.edu), except as noted below. The snkyZ0566 and snkyZ4482 alleles were recovered as ethylmethane sulfonate (EMS)-induced male sterile mutations from the Zuker collection (Koundakjian et al., 2004Go; Wakimoto et al., 2004Go). The strain P{PZ} Syx1301470 ry506/TM3 (Bloomington Drosophila Stock Center) was used to generate deletions near the P-element by transposase-induced male recombination (Preston et al., 1996Go) and one snky- chromosome, denoted Df(3L) Syx1301470R5, was recovered. This chromosome is homozygous viable but poorly so due to deletion of genes other than snky+ (Fitch and Wakimoto, 1998Go). A transgenic line that expressed the secreted Green fluorescent protein (GFPsecr) of Pfeiffer et al. (Pfeiffer et al., 2000Go; Pfeiffer et al., 2002Go) under the control of the ß2t testis-specific promoter from the tv3 vector (Wong et al., 2005Go) was generously provided by J. Brill.

Molecular characterization of the snky gene, mutations and transcript
Molecular studies were carried out essentially as described by Sambrook and Russell (Sambrook and Russell, 2001Go). Genomic fragments flanking P-element insertions in the P{PZ} Syx1301470 and Df(3L) Syx1301470R5 chromosomes were isolated and sequenced to identify the P-element insertion site and locate the deficiency breakpoints (Preston et al., 1996Go). These fragments were used as probes to select hybridizing genomic clones from a phage library (Tamkun et al., 1992Go). Overlapping clones that spanned the deleted region were used to probe genomic Southern blots containing DNA from snky1 and its parental mwh red e line to identify restriction site polymorphisms. The snkyZ0566 and snkyZ4482 mutations were identified using PCR to amplify and sequence selected regions from mutant and parental bw; st chromosomes.

For northern blots (Fig. 2), the lanes contained ~0.25 µg polyA+ RNA from testes (350 pairs of testes) or ~7.4 µg polyA+ RNA isolated from 40 males after removal of the testes. The probes were a 32P-labeled 3.3 kb AvaI genomic fragment isolated from the clone BAC05N10 (UK-HGMP Resource Center) and a clone containing the ribosomal protein gene rp49.

We sequenced snky cDNA clones, which we generated from polyA+ RNA isolated from testes of bw; st males. Standard protocols were used for reverse transcription (Gibco Superscript II RNAse H-Transcriptase Kit), 5' RACE (Ambion Choice RLM-RACE Kit), and cDNA cloning into the TOPO-TA vector (Invitrogen). Primers (Gibco) for cDNA amplification were: S1(CCTTCCTACTGGGACTCGTG), S2(GTTGTTGAAGGCCGAAAAGA), S3(CGAACTCCACGTCATTGAGA), S4(GTTGAGATCCTCGGCACAAT), S5(TTGTAAACTGCTTGGCCATCAAAT), S6(GGCAAAGGCCACTGCACGTA).

Construction of transgenic lines and assays for male fertility
The rat CD2 coding region was isolated as 1.1 kb ClaI/XhoI fragment from a plasmid kindly provided by N. H. Brown (Dunin-Borkowski and Brown, 1995Go) and cloned downstream of the testis-specific ß2-tubulin promoter in P-element transformation vector of Hoyle et al. (Hoyle et al., 1995Go). The construct also contained the white+mc gene and was introduced into y w1118 flies using standard germline transformation techniques. A line carrying a transposon on chromosome 2 was used to construct the y w1118; P[w+mc B2t::CD2] 2a; snky1 e/TM3, y+ Ser e strain.

The genomic region containing the CG11281gene was isolated as a 7.3 kb SalI fragment from BACN05H10 and cloned into pCasPeR4, which carries the w+mc gene (Thummel and Pirrotta, 1992Go). Three independent insertions, denoted P[w+mc snky+t7.3]A, B and C were obtained. Two were on chromosome 3 and were introduced into a snky- background by recombination onto Df(3L) Syx1301470R5.

A transgene expressing Snky-GFP fusion protein, denoted P[w+mc snky-GFP] was created by inserting the Enhanced green fluorescent protein (EGFP) coding region from pEGFP-N3 (Clonetec) into the pCasPeR4-7.3 S construct described above. The fusion protein retained the snky+ gene promoter and flanking regions. It extended the snky+ open reading frame (ORF) just before the stop codon to include: a 30 bp linker from pEGPF-N3, the EGFP coding sequences (amino acid 1 to 237) and, as a consequence of the cloning scheme, an in-frame duplication of the last seven codons of the snky ORF. The transgene was used to generate the y w; P[w+mc snky-GFP]; snky1 e/TM3, y+ Ser e lines.

Fertility assays were performed for males carrying P[w+mc snky+t7.3] or P[w+mc snky-GFP] in a snky- background to test for activity of the transgenes. Fertility was monitored in crosses of single males mated to three wild-type (Canton-S) females. Percentage of fertile crosses and progeny yield per male were compared to those of control crosses, which used snky- brothers that lacked the transgene or snky1/snky+ heterozygotes. Because snky- males produce one to five progeny on occasion (Fitch and Wakimoto, 1998Go), fertile crosses were defined as those yielding more than five offspring.

Assays for Snky-GFP and CD2 expression
To monitor Snky-GFP in testes, y w; snky-GFP; snky1 e males were dissected in 2% paraformaldehyde in PBS (130 mmol/l NaCl, 7 mmol/l Na2HPO4, 3 mmol/l NaH2PO4). Testis squashes were prepared on poly-L-lysine coated slides, frozen in liquid nitrogen, submerged in 95% cold ethanol, rinsed in PBS, then stained with 0.1 µg/ml DAPI (4',6-diamidine-2-phenylindole) to label nuclei. To label the mitochondrial derivative, larval testes were incubated with 400 mmol/l Mitotracker Dye (MT-CMXRos, Molecular Probes), then processed as described for adult testes. To assay Snky-GFP in sperm in the reproductive tracts of females and in eggs, wild-type females were mated to y w; snky-GFP; snky1 e males. Sperm storage organs were dissected then prepared as described above. Eggs were collected within 15 minutes of deposition, dechorionated in 50% bleach, then fixed in 4% paraformaldehyde in PBS overlaid with heptane. After vitelline envelopes were removed by hand, eggs were processed without squashing as described above. All preparations were mounted in Vectashield (Vector Laboratories). Images were acquired at 600x magnification using a Bio-Rad Radiance 2000 confocal microscope equipped with a 488 nm Kr/Ar laser. Optical sections were typically 0.45 µm. Z-series stacks were assembled using NIH Image J (http://rsb.info.nih.gov/ij/) and images were edited using Adobe Photoshop.

Testes were isolated from adult males carrying the rCD2 transgene and fixed in 4% paraformaldehyde. For immunostaining, we used a 1:100 dilution of the primary OX-34 mouse anti-rat CD2 monoclonal antibody (Harlan Sera-Labs) and Alexa-488 goat anti-mouse antibody (Molecular Probes) as secondary antibody. Nuclei were counterstained with l µg/ml propidium iodide. The tissue was mounted in Vectashield for confocal microscopy. To track CD2 in embryos, wild-type females were mated to snky1 males carrying the rCD2 transgene. Eggs were collected within 20 minutes of deposition, aged for 30 minutes, then dechorionated in 50% bleach and transferred to poly-L-lysine coated slides. Eggs were squashed under a coverslip, and the slide was frozen in liquid nitrogen then submerged in 95% ethanol for 10 minutes. Tissue was fixed and incubated with the OX-34 antibody as described for testes. Secondary and tertiary fluorescent labeling of OX-34 was performed with Alexa 488 Signal-Amplification Kit (Molecular Probes) using the manufacturer's protocol. Nuclei were counterstained with DAPI. Images were obtained using a Nikon fluorescent microscope equipped with a CCD camera and edited with Adobe Photoshop.


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sperm produced by snky males retain a plasma membrane marker after entry into the egg
Males mutant for the snky gene are sterile despite normal spermatogenesis, successful transfer of normal quantities of sperm to females and efficient sperm entry into eggs (Fitch and Wakimoto, 1998Go). We previously reported that the snky defect is apparent shortly after the sperm enters the egg. The sperm nucleus remains tightly condensed and located at the egg cortex and no sperm aster is produced. We also reported that the sperm nucleus stains readily with DAPI, a membrane permeable with chromatin dye but variably so, or not at all, with membrane impermeable dyes. We therefore proposed that the defect is due to persistence of a plasma membrane around the head of snky mutant sperm, preventing access to activating factors in the egg cytoplasm. To obtain more direct evidence for this proposal, we expressed an integral membrane protein, the rat CD2 protein, during spermatogenesis to provide a sperm plasma membrane marker. Previous studies showed that rCD2, a single pass plasma membrane protein, can be expressed in Drosophila cells and detected with a specific monoclonal antibody (Dunin-Borkowski and Brown, 1995Go). Our transgenic line expressed the rCD2 gene under the control of a testis-specific promoter in snky1 homozygotes. Immunostaining showed that rCD2 was a membrane marker in primary spermatocytes and all subsequent stages of spermatogenesis. Localization was observed along the entire length of elongating spermatids and mature sperm, including the head (Fig. 1A,B). The rCD2 epitope was retained along the sperm after entry into the egg and for at least 30 minutes after egg deposition (Fig. 1C,D,E; n=9 eggs), providing evidence that snky mutant sperm fail in plasma membrane breakdown (PMBD).

The snky gene corresponds to predicted gene CG11281 and encodes a testis transcript
We previously mapped snky to the 69F-70A cytogenetic interval (Fitch and Wakimoto, 1998Go). To refine localization, we generated deficiencies in the region using P-element-mediated male recombination starting with the P{PZ} Syx1301470 insertion. The strategy yielded a small deficiency, denoted Df(3L) Syx1301470R5, that was homozygous viable and conferred the snky- phenotype to surviving males. Molecular mapping of the deficiency breakpoints defined a 185 kb genomic interval within which we identified a restriction site polymorphism between snky1 and its parent chromosome. The region overlapped with CG11281, a gene predicted by the Drosophila Genome Project but for which no expressed sequence tag or cDNAs had been reported.


Figure 1
View larger version (78K):
[in this window]
[in a new window]

 
Fig. 1. The rCD2 protein marks the sperm plasma membrane. The panels show sperm produced by males homozygous for snky1 and a transgene expressing rat CD2 gene. The rCD2 protein (green) was detected by immunolocalization and nuclei (red) by PI or DAPI staining. In a cyst of elongating spermatids (A) and mature sperm (B), rCD2 is located on the plasma membrane. After entry into the egg, sperm retain a condensed nucleus (C) and rCD2 (D). The merged image (E) shows overlapping rCD2 and nuclear staining consistent with retention of the plasma membrane surrounding the head. Scale bar: 10 µm.

 
Two additional observations showed that CG11281 corresponded to the snky gene. Northern analysis revealed a CG11281 transcript with an expression profile consistent with the specific effect of snky mutations on male fertility. As shown in Fig. 2A, a genomic fragment containing CG11281 hybridized to a rare 2.7 kb polyadenylated RNA that was found in testes, but not in carcasses (bodies lacking testes) of wild-type adult males. A corresponding transcript that was reduced in size and abundance was detected in testes of snky1 males (Fig. 2B). A hybridizing transcript was absent in females (data not shown). Definitive evidence to assign CG11281 as the snky gene was achieved by transgenic rescue of the snky- male sterility by a 7.3 kb genomic SalI fragment that included CG11281 but no other predicted genes. Three independent insertions of the transgene were obtained and each one conferred high levels of male fertility in a single dose (Table 1), indicating that the SalI fragment contains most, if not all, of the necessary sequences for the snky+ gene.


View this table:
[in this window]
[in a new window]

 
Table 1. Rescue of the snky phenotype by transgenes

 
We determined the snky transcript structure using RT-PCR and 5' RACE. This analysis revised the CG11281 predicted structure and revealed a gene with a single intron and an ORF of 715 amino acids. Sequence analysis of two EMS-induced alleles and their parent bw; st line identified a single lesion in the ORF in both cases. In snkyZ0566, a change from T to A results in a missense mutation that replaces a Cys with a Ser at residue 258. In snkyZ4482, a transition mutation of C to T results in a stop codon at residue 379.


Figure 2
View larger version (43K):
[in this window]
[in a new window]

 
Fig. 2 . Expression and structure of the snky transcript. (A,B) Northern blots probed with a genomic fragment that contained CG11281 detected a 2.7 kb transcript that was present in testis, absent in male carcasses (A) and reduced in size and abundance in snky1 testes compared to its parental strain (B). Bottom panel shows levels of rp49 mRNA in each lane as a loading control. (C) Transcript structure was determined by RT-PCR. Primers used for cDNA amplification are indicated by arrows. The transcript is contained within the AvaI genomic fragment, which was used as a probe for northern analysis. Fragment endpoints are labeled according to Drosophila Genome Project Release 4.0 coordinates. Transcription initiation site (+1) determined by 5' RACE is nucleotide 3L 13,131,973. Positions of the start and stop codons of the 2145 bp ORF (black box), the 72 bp intron and the predicted polyadenylation site are also indicated.

 
Snky is a predicted transmembrane protein with a RING finger domain
The Snky protein is predicted to be a protein with multiple transmembrane domains. The following predictive algorithms were used to examine potential topologies: TMHMM 2.0 (Krogh et al., 2001Go), HMMTOP 2.0 (Tusnady and Simon, 2001Go), PHOBIUS (Kall et al., 2004Go), SOSUI (Hirokawa et al., 1998Go) and ConPred II (Arai et al., 2004Go). These programs gave conflicting results probably due to the relatively high content of positively charged residues in Snky. However, all programs predict a minimum of four transmembrane domains and one, ConPred II, predicts eight transmembrane domains. The topology shown in Fig. 3A is based on the SOSUI prediction, which identifies a signal sequence within the first 18 residues and predicts the 6 hydrophobic membranespanning domain most commonly predicted by the suite of programs we used.

Snky has two regions with noteworthy Cysteine residue patterns (Fig. 3A,B). One region is located in the largest predicted extramembrane loop and contains six Cys that are separated by eight to 12 amino acids. The functional significance of this region, which we refer to as the patterned 6 Cys motif, is indicated by the snkyZ0566 mutation, which changes the second of these Cys to a Ser. The second region is located near the carboxyl end and consists of four pairs of C-X2-Cs (where X is any amino acid) that are linked by four to ten residues. This second pattern corresponds to a variant of the Pfam C3HC4 RING finger (zf-PF00097) (Finn et al., 2006Go). In Snky, a Cys is substituted for the His resulting in a C4-C4 variant. Additionally, a coiled-coil domain is predicted in Snky from residue 597 to 624.

Snky is a member of a protein family
BLAST searches (blastp) (Altschul et al., 1997Go) of non-redundant sequences in NCBI identified a series of Snky-related proteins present in invertebrates and vertebrates. Of these, a set of proteins, which we refer to as the Snky family, not only have the highest level of amino acid identity across their entire length, but also share additional features. All are predicted to have multiple transmembrane domains. Each also has the patterned 6 Cys motif in a predicted extramembrane loop that follows the pattern: C-(10X)-C-(10X)-C-(12-13X)-C-(8X)-C-(9-12X)-C. These proteins also contain a RING finger with the consensus pattern: C-(2X)-C-(10-11X)-C-(2-4X)-C-(4X)-C-(2X)-C-(7X)-C-(2X)-C. The Snky proteins include: a mosquito protein (Aedes aegypti, EAT46485, conceptual translation) with 30% amino acid identity; a zebrafish protein (XP683798, conceptual translation) with 22.2% identity; a human protein (BAB71440) with 22% identity; and a mouse protein (XP994048) with 21.8% identity. The human and mouse protein sequences are supported by full-length testis cDNAs. Although expressed sequence tags have also been isolated from other tissues, comparison of available sequence indicates the possibility of testis-specific isoforms in humans. CLUSTAL W alignment (Thompson et al., 1994Go) revealed three regions, which are the most highly conserved among Snky family members. These regions are denoted a, b and c in Figs 3 and 4. Regions b and c overlap with the ends of the region that defines the DC-STAMP sequence family (Pfam PF07782). In Snky, the DC-STAMP-like region extends 192 amino acids, from amino acid 406-597.

Snky is more distantly related to other proteins that had been previously recognized as containing DC-STAMP-like regions. They include the human and mouse DC-STAMP-Domain Containing-2 Proteins, the Caenorhabditis elegans sperm protein SPE-42 (Kroft et al., 2005Go) and a Drosophila protein encoded by the CG6845 gene. These proteins contain a RING finger and a Cysteine-containing region spaced similar to the patterned 6 Cys motif in Snky. However, compared with proteins described above, they show a reduced level of identity with Snky at the amino acid level (10-17% identity), particularly in regions a, b and c. Included in this group is a predicted sea urchin protein (XP795449) with 15.1% identity to Snky. Even more distantly related are the human and mouse DC-STAMP, which contain the DC-STAMP domain but lack a RING finger and a patterned 6 Cys motif.

Localization of a Snky-Green fluorescent protein fusion during spermatogenesis
We generated transgenic flies that contained a snky-Green fluorescent protein fusion gene expressed from the snky promoter. The fusion protein contained the entire Snky protein and Enhanced GFP at the carboxyl terminus. Four independent transgenic lines were recovered and in each line, the transgene significantly rescued the snky- male sterile phenotype in a single dose. The transgene used in all subsequent studies rescued fertility to a level comparable to that conferred by the snky+ transgene (Table 1). Hence, the Snky-GFP fusion protein was highly active and could be used as a tool to deduce the localization of the normal Snky protein.

To examine tissue expression of Snky-GFP, we examined larvae and adults that were homozygous for a snky-GFP transgene and the snky1 mutation. We detected expression only in the testis. To determine when Snky-GFP is expressed, we distinguished the different stages of spermatogenesis by the characteristic morphology of nuclei and mitochondrial derivatives (A. D. Tates, PhD thesis, University of Leiden, 1971) (Fuller, 1993Go). Nuclei were monitored by DAPI staining and mitochondrial derivatives were visualized by MitoTracker Red-CMXRos staining. Snky-GFP was first detected in primary spermatocytes as a diffuse cytoplasmic signal (Fig. 5A), consistent with localization to the endoplasmic reticulum and as expected for an integral membrane protein. Following meiosis, at the onion stage, which is characterized by round spermatid nuclei and comparably sized mitochondrial derivatives, a prominent cluster of Snky-GFP spots was seen just adjacent each nucleus (Fig. 5B). The structures at this stage corresponded in size and location to the aggregated Golgi complexes that Tates (A. D. Tates, PhD thesis, University of Leiden, 1971) referred to as the acroblast. With continued differentiation, as nuclear condensation began and mitochondrial derivatives and sperm tails elongated, Snky-GFP was present as multiple irregular spots throughout the cytoplasm. However, one spherical Snky-GFP signal, generally larger than the others, was located adjacent to each nucleus (Fig. 5C). This site of Snky-GFP was the only visible signal retained as spermatids became fully elongated (Fig. 5D,E). In individualized mature sperm, the Snky-GFP signal exhibited a thin oval shape located at the tip of the sperm, with its distal end slightly overlapping with apical end of the needle-shaped nucleus (Fig. 5F). This pattern of localization and the predicted structure of Snky suggest that it is an integral membrane protein targeted to the acrosome during spermatogenesis.

The fate of Snky-GFP and the acrosome during fertilization
Snky-GFP allowed us to examine the fate of Snky and the acrosome during normal fertilization. In Drosophila, females store sperm after mating. We examined seminal receptacles (sperm storage organs) from wild-type females mated to snky1 males that carried two copes of the Snky-GFP transgene. The Snky-GFP signal we observed in stored sperm appeared identical to that seen in mature sperm from the testis (data not shown).


Figure 3
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 3. Predicted topology and deduced amino acid sequence of Snky. (A) Predicted features of Snky are shown with six transmembrane (TM) domains (blue cylinders) as predicted by the SOSUI program (Hirokawa et al., 1998Go), three highly conserved regions a-c (red bars), a predicted coiled-coil domain (orange) and conserved Cys residues (yellow circles). A C4-C4 RING finger is located near the carboxyl terminus. Asterisks (*) indicate location of residues altered in snkyZ mutants. (B) Deduced amino acid sequence showing features diagrammed above. TM domains (boxed blue), highly conserved regions a-c (red), coiled-coil domain (underlined) and conserved Cys residues (C, boxed yellow).

 
Fertilization occurs within the reproductive tract of females. Sperm are released from the seminal receptacle and enter the egg as it passes down the uterus. The events from sperm entry into the egg to the completion of the first embryonic cell cycle occur rapidly (estimated <17 minutes) and are often completed before the egg is laid. To capture the earliest stages, eggs fertilized by sperm from Snky-GFP males were collected and fixed within 15 minutes of egg deposition, counterstained with DAPI and examined by confocal microscopy. Even with this rapid processing, the majority of embryos examined had progressed beyond cycle 2. Of the 17 fertilized eggs and embryos captured before metaphase of cycle 1, we observed a Snky-GFP signal in 16. The signal was located in close proximity to the sperm nucleus before visible evidence of nuclear decondensation (Fig. 6A, n=1), and more distantly as decondensation progressed (Fig. 6B, n=3). During pronuclear migration and pronuclear apposition, Snky-GFP was seen peripheral to what was judged to be the male pronucleus based on the state of chromatin condensation or position in the egg (Fig. 6C, n=11, with one without a GFP signal). During prometaphase of cycle 1, the Snky-GFP signal was observed near the condensing chromosomes (Fig. 6D, n=2). Although the position of the Snky-GFP signal relative to the sperm chromatin changed during these stages of fertilization, neither the shape nor the intensity of the signal appeared to change. Five embryos were found at stages between metaphase of cycle 1 and 2 and only one, which was at anaphase of cycle 1, exhibited a GFP signal (data not shown). We did not detect GFP signals in control eggs (fertilized by sperm of males lacking Snky-GFP), which were captured before prometaphase of cycle 1 (n=7, data not shown).

These studies revealed two surprising discoveries. The first of these was that sperm contributed Snky-GFP to the egg. The second remarkable finding was that the GFP signals observed in the egg and early cycle 1 embryos consistently appeared similar to those observed in mature sperm. We considered two possibilities to account for the retention of bright GFP signals in the egg cytoplasm. The paternally inherited structure could be an acrosomal vesicle, with the Snky-GFP signal marking the boundaries of an intact acrosome. Alternatively, the GFP signal could reflect retention of a large membrane remnant from a spent acrosome. To distinguish between the two possibilities, we obtained a transgenic line that expressed a soluble form of GFP in the acrosome. This line (gift of J. Brill) expresses the GFPsecr protein under the control of a testis-specific promoter. GFPsecr was designed and characterized by Pfeiffer et al. (Pfeiffer et al., 2000Go; Pfeiffer et al., 2002Go), and it contains the signal peptide from the Wingless protein fused to GFP. When expressed in embryonic or imaginal disc epithelial cells, GFPsecr is targeted to the secretory pathway, packaged in secretory vesicles and released into the extracellular space upon secretion (Pfeiffer et al., 2002Go). These properties predict that if GFPsecr is present in the acrosome, the GFP signal will dissipate upon acrosome exocytosis.

We examined eggs fertilized by sperm expressing GFPsecr. Of the 22 eggs captured between earliest stages of sperm nuclear decondensation (Fig. 6E) to prometaphase of cycle 1 (Fig. 6H), 21 showed a GFPsecr signal. In each case, the appearance was similar to that observed with Snky-GFP (compare higher magnification insets of Fig. 6A-H). These data are consistent with the retention of an intact acrosomal vesicle by the sperm during fertilization, the release of the vesicle into the egg cytoplasm after PMBD, and the persistence of the acrosome at least as late as prometaphase of the first embryonic cycle.


Figure 4
View larger version (40K):
[in this window]
[in a new window]

 
Fig. 4. Multiple sequence alignment of Snky and related proteins. Three regions, denoted a, b and c, are the most highly conserved among Snky family members and are aligned here. Their locations in Snky are shown in Fig. 3. The sequence of Snky (D. melanogaster), the mouse (M. musculus) and human proteins are based on full-length cDNAs. The mosquito (A. aegypti) and zebrafish (D. rerio) sequences are based on conceptual translations of predicted genes.

 


Figure 5
View larger version (112K):
[in this window]
[in a new window]

 
Fig. 5. Localization of Snky-GFP during spermatogenesis. The diagram depicts stages of spermatogenesis in which Snky-GFP expression was observed. Letters correspond to confocal images below (A-E). Primary spermatocytes (A) undergo two meiotic divisions to yield round spermatids (B). Differentiation follows (C-E), as spermatids undergo gradual condensation of nuclei (red), elongation of mitochondrial derivatives (blue) and sperm tails (black lines). Individualized, mature sperm are released from the base of the testis into the seminal vesicle (F). Confocal images show stages of spermatogenesis in males that were homozygous for snky1 and carried two copies of a transgene expressing Snky-GFP (green). Nuclei were visualized by DAPI-staining (red). In A-C, mitochondrial structures were detected with the dye MT-CMXRos (blue). (A) In primary spermatocytes, Snky-GFP and the mitochondrial dye give diffuse cytoplasmic signals. (B) In post-meiotic spermatids at the onion stage, clusters of Snky-GFP-containing spheres are adjacent to nuclei and mitochondrial derivatives. (C) Snky-GFP is visible in clusters of spheres along the length of elongating spermatids, but a prominent spot (arrow) is associated with each nucleus. (D) A single slightly oval Snky-GFP signal is associated with each spermatid nucleus as nuclear condensation begins. (E) In cysts of late spermatids, Snky-GFP appears as a thin oval signal distal to the needle-shaped sperm nucleus. (F) Individualized sperm present in the seminal vesicle contain Snky-GFP signal located at the apical tip and consistent with localization to the acrosome. Scale bars: 10 µm.

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fertilization in Drosophila melanogaster is unorthodox in that it does not involve a membrane fusion event between the sperm and egg. The mechanism used by the sperm to penetrate through the egg plasma membrane remains an interesting mystery. In her ultrastructural studies of fertilization in D. melanogaster and D. montana, Perotti (Perotti, 1975Go) observed that the entire sperm enters the egg, including the excessively long tail surrounded by its plasma membrane. She noted that there was no evidence for `extra' membranes that would support uptake into the egg by endocytosis. While her studies did not capture the sperm before nuclear decondensation, Perotti described one case in which a decondensing sperm nucleus was surrounded by what appeared to be remnants of the sperm plasma membrane. Her studies support the idea that the Drosophila sperm head must undergo PMBD in the egg cytoplasm. This step is required for the sperm nucleus to gain access to activating cytoplasmic factors that promote nuclear decondensation and replication, and for the centrosome to elaborate the sperm aster (Fitch et al., 1998Go). Our studies support this sequence of events and implicate Snky function in an event upstream of PMBD. Our original proposal that snky mutant sperm fail in sperm activation because they arrest before PMBD was based on their poor accessibility to membrane impermeant chromatin dyes (Fitch and Wakimoto, 1998Go). Further support was obtained by Ohsako et al. (Ohsako et al., 2003Go), who used an antibody to a proposed cell surface proteoglycan to demonstrate retention on the sperm head before and after insemination. In our current study, we ectopically expressed the rat CD2 protein on the sperm plasma membrane and showed that immunoreactivity to this specific integral membrane protein was retained on the head of snky1 sperm for at least 30 minutes after entry into the egg. These observations provide strong support for the proposal that snky sperm do not shed the plasma membrane surrounding the head. They also suggest that understanding the function of the Snky protein should provide clues about how PMBD is initiated or accomplished at the molecular level.


Figure 6
View larger version (50K):
[in this window]
[in a new window]

 
Fig. 6. Localization of Snky-GFP and GFPsecr during fertilization. (A-D) GFP (green) was monitored in eggs fertilized by sperm from snky1 males that carried two copies of a snky-GFP transgene. Nuclei (red) were stained with DAPI. Insets to the right of each picture show higher magnification view of the GFP signal. (A) A single GFP signal is observed just apical to the condensed sperm nucleus and (B) more distantly as the sperm nucleus decondenses. (C) GFP is seen near the apposing male and female pronuclei and (D) by the chromosomes during prometaphase of the first embryonic cycle. (E-H) In eggs fertilized by sperm from males expressing GFPsecr, the GFP signals appear similar to those described for Snky-GFP. Scale bars: 3 µm in A,B,E,F; 6 µm in C,D,G,H; 2 µm in the higher magnification insets.

 
Molecular studies reported here show that Snky is a member of a family of related membrane proteins that are present in animals but are apparently absent in other lineages. Conservation among Snky family members points to three domains of potential functional significance. The most striking motif is the C4-C4 RING finger, which has been noted in at least four other proteins (Hanzawa et al., 2001Go; Kellenberger et al., 2005Go; Pugh et al., 2006Go; Arioli et al., 1998Go). In one of these, hNOT4, the C4-C4 RING has been shown to fold and bind zinc in a cross-brace fashion similar to the more common C3HC4 RING finger (Hanzawa et al., 2001Go), suggesting structural and functional similarity between these variants. Although RING finger proteins have been implicated in a broad variety of cellular functions, recent studies suggest that their unifying role is in mediating protein-protein interactions in large multiprotein assemblages (Borden, 2000Go). Thus, Snky may play a role in organizing and holding together macromolecular complexes at the membrane via its C4-C4 RING. The second Cys-containing region is the patterned 6 Cys motif, the functional significance of which is indicated by conservation and by the recovery of a male sterile snky allele that mutates the second Cys to a Ser. Cysteines in this region may form disulfide bonds to create a binding pocket or otherwise allow interactions with additional proteins. The third region is the DC-STAMP-like region, named after Dendritic cell specific transmembrane protein, a plasma membrane protein that was first described for its expression in human dendritic cells (Hartgers et al., 2000Go). Thus far, the function of only a few DC-STAMP-domain-containing proteins have been examined through the analysis of mutations or other knockdown strategies. The general classification of these proteins has been as members of a new class of putative receptors. Mouse DC-STAMP is upregulated in differentiating osteoclasts, and required for osteoclast fusion to form multinucleate cells (Kukita et al., 2004Go; Yagi et al., 2005Go). The C. elegans SPE-42 is required in sperm and is proposed to act at a step in fertilization just before or during sperm-egg membrane fusion (Kroft et al., 2005Go). Snky is the third DC-STAMP domain-containing protein to have its function studied and, like Spe-42, it has a role in sperm function. Although the precise molecular function of the DC-STAMP domain remains unknown, these three examples support a role in mediating membrane-membrane interactions.

The predicted structure of Snky, with its multiple transmembrane domains, and our Snky-GFP localization studies provide evidence that Snky is an acrosomal membrane protein. This localization presents the intriguing question of how an acrosomal membrane protein is able to influence the integrity of the sperm plasma membrane. The findings also have broader implications for acrosome function. The acrosome is a Golgi-derived membrane-bound organelle found at the apical end of sperm, and its function has been extensively studied in marine invertebrates and mammals. In these organisms, the acrosome is best known as a specialized secretory vesicle that undergoes exocytosis. Like many secretory events, a rise in intracellular Ca2+ is required for acrosome exocytosis. This increase in Ca2+ requires influx into the sperm as well as efflux from internal stores. The acrosome has been identified as an internal source of Ca2+ and is believed to release Ca2+ to contribute to its own exocytosis (Walensky and Snyder, 1995Go; Herrick et al., 2005Go). Ultrastructural studies show that exocytosis involves vesiculation of the outer acrosomal membrane and overlying plasma membrane. This results in the release of contents of the acrosome, which include hydrolytic enzymes and other components that facilitate binding and penetration through the egg coats. Exocytosis also exposes the inner acrosomal membrane, resulting in a new membrane patch and associated acrosomal molecules on the surface of the sperm. In marine invertebrates, this newly exposed region is the site of binding and membrane fusion with the egg (Colwin and Colwin, 1967Go; Lopo et al., 1982Go), providing a direct physical link between the requirement for acrosome exocytosis and membrane fusion. In mammals, acrosome exocytosis is also a prerequisite for sperm to bind to and fuse with the egg. However, the plasma membrane that lies over the equatorial segment of the acrosome, and not the acrosome membrane itself, is believed to be the point of membrane fusion with the egg (Yanagimachi, 1994Go). Experimental studies of hamster sperm by Takano et al. (Takano et al., 1998Go) suggest that fusion competency of this specialized region of mammalian sperm requires changes that occur immediately before or during acrosome exocytosis, as well as the contents of the acrosome.

Considering these known acrosome functions, it is interesting that acrosomes are not universal features of animal sperm. Acrosomes are not present in the amoeboid sperm of nematodes, and they are occasionally absent or reduced in species that otherwise possess the flagellated sperm typical of animals (Baccetti, 1979Go). For instance, the absence or reduction of an acrosome in mature sperm of teleosts (Coward et al., 1996Go) and certain insect species (Baccetti, 1972Go; Dallai et al., 2003Go) is well documented and is generally considered a derived condition (Baccetti, 1979Go). Hence the requirement for the acrosome during fertilization has been eliminated or bypassed in some lineages during the course of evolution. Ultrastructural studies show that an acrosome is typical of insect sperm (Baccetti, 1972Go). However, few studies have examined the role of the insect acrosome during fertilization. Studies of fertilization in the house fly Musca domestica suggested `loosening or loss' of the sperm plasma membrane before entry into the micropyle of the egg, followed by exocytosis of acrosomal contents during passage of the sperm through the micropyle (Degrugillier and Leopold, 1976Go).

Our studies revealed a different fate for the Drosophila acrosome. The observation that Snky-GFP was a paternally contributed molecule to the early egg was a surprising finding. The persistence of a single prominent Snky-GFP structure, with an intensity and shape in eggs that appeared similar to those seen in mature sperm, suggests the possibility that the inherited structure was an intact acrosome. This possibility was further supported by studies tracking GFPsecr, a soluble protein that is secreted into the extracellular space when expressed in other Drosophila cells (Pfeiffer et al., 2002Go). Its robust and identical appearance to Snky-GFP argues against exocytosis, at least until after prometaphase of the first embryonic cell cycle.

These cytological observations of the fate of the acrosome during normal fertilization, combined with the defect in PMBD observed in snky- mutant sperm, suggest that the acrosome may be acting primarily as a signaling vesicle to elicit changes in the overlying sperm plasma membrane. This activity requires the Snky acrosomal membrane protein, but occurs without acrosome exocytosis. Snky may be serving as a receptor that permits communication between the acrosome and plasma membrane. Alternatively, Snky or its associated proteins may serve to initiate or maintain contact between the membranes, or modify membrane lipids or proteins in preparation for PMBD. In this sense, Snky, DC-STAMP and SPE-42 may share a common mechanism in promoting membrane interactions (Yagi et al., 2005Go; Kroft et al., 2005Go). However, in the case of Snky, the pathway would lead to breakdown of the overlying plasma membrane, rather than fusion between two membranes.

In Drosophila, Snky is required specifically for male fertility. It will be interesting to determine whether Snky family members are required for sperm function in zebrafish, which have sperm that lack acrosomes, and for acrosome function in marine invertebrate and mammalian sperm. If human Snky-like proteins are specifically required for sperm function, then they may be potential targets for male contraceptives. More immediately, our studies of Snky provide tools for further investigating how the membrane events that occur during Drosophila fertilization compare to conventional views of membrane dynamics during sperm activation and fertilization in animals. Research on the acrosome has focused primarily on its function as a specialized secretory or Ca2+ storage vesicle. Our studies suggest a primary role as signaling vesicle in Drosophila, with a newly identified acrosomal membrane protein communicating directly or indirectly with the plasma membrane to affect changes in membrane integrity. Comparisons among species should continue to shed light on the intriguing ways in which sperm structures and fertilization molecules, such as Snky, may be selected for conservation or diversification during the course of evolution.


    ACKNOWLEDGMENTS
 
We are grateful to N. H. Brown for providing the rCD2 plasmid, J. Brill for providing the GFPsec line, and the Bloomington Stock Center and Berkeley Drosophila Genome Project for stocks. We thank Michelle Smith, Jiro Yasuhara and Lukas Kall for helpful discussions. This work was supported by National Science Foundation grant DCB0211733 and Washington Research Foundation Professorship to B.T.W.


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Altschul, S. F., Madden, T. L. M., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. J. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25,3389 -3402.[Abstract/Free Full Text]

Arai, M., Mitsuke, H., Ikeda, M., Xia, J.-X., Kikuchi, T., Satake, M. and Shimuze, T. (2004). ConPred II: a consensus prediction method for obtaining transmembrane topology models with high reliability. Nucleic Acids Res. 32,W390 -W393.[Abstract/Free Full Text]

Arioli, T., Peng, L., Betzner, A. S., Burn, J., Wittke, W., Herth, W., Camilleri, C., Hofte, H., Plazinski, J., Birch, R. et al. (1998). Molecular analysis of cellulose biosynthesis in Arabidopsis. Science 279,717 -720.[Abstract/Free Full Text]

Baccetti, B. (1972). Insect sperm cells. Adv. Insect Physiol. 9,315 -397.

Baccetti, B. (1979). The evolution of the acrosomal complex. In The Spermatozoon: Maturation, Motility, Surface Properties, and Comparative Aspects (ed. D. W. Fawcett and J. M. Bedford), pp. 305-329. Baltimore-Munich: Urban and Schwarzenberg.

Borden, K. L. B. (2000). RING domains: master builders of molecular scaffolds? J. Mol. Biol. 295,1103 -1112.

Colwin, L. H. and Colwin, A. L. (1967). Membrane fusion in relation to sperm-egg association. In Fertilization: Comparative Morphology, Biochemistry, and Immunology (ed. C. B. Metz and A. Monroy), pp.295 -367. New York: Academic Press.

Coward, K., Bromage, N. R., Hibbitt, O. and Parrington, J. (1996). Gamete physiology, fertilization and egg activation in teleost fish. Rev. Fish Biol. Fish. 12, 33-58.

Dallai, R., Beani, L., Kathirithamby, J., Lupetti, P. and Afzelius, B. A. (2003). New findings on sperm ultrastructure of Xenos vesparum (Rossi) (Strepsiptera, Insect). Tissue Cell 35,19 -27.[CrossRef][Medline]

Degrugillier, M. E. and Leopold, R. A. (1976). Ultrastructure of sperm penetration of house fly eggs. J. Ultrastruct. Res. 56,312 -325.[CrossRef][Medline]

Dunin-Borkowski, O. M. and Brown, N. H. (1995). Mammalian CD2 is an effective heterologous marker of the cell surface in Drosophila. Dev. Biol. 168,689 -693.[CrossRef][Medline]

Evans, J. P. (2002). The molecular basis of sperm-oocyte membrane interactions during mammalian fertilization. Hum. Reprod. Update 8,297 -311.[Abstract/Free Full Text]

Finn, R. D., Mistry, J., Schuster-Bockler, B., Griffiths-Jones, S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R. et al. (2006). Pfam: clans, web tools and services. Nucleic Acids Res. 34,D247 -251.[Abstract/Free Full Text]

Fitch, K. R. and Wakimoto, B. T. (1998). The paternal effect gene ms(3)sneaky is required for sperm activation and the initiation of embryogenesis in Drosophila melanogaster. Dev. Biol. 197,270 -282.[CrossRef][Medline]

Fitch, K. R., Yasuda, G. Y., Owens, K. N. and Wakimoto, B. T. (1998). Paternal effects in Drosophila: Implications for the mechanisms of early development. Curr. Top. Dev. Biol. 38,1 -34.[Medline]

Flesch, F. M. and Gadella, B. M. (2000). Dynamics of the mammalian sperm plasma membrane in the process of fertilization. Biochim. Biophys. Acta 1469,197 -235.[Medline]

Fuller, M. T. (1993). Spermatogenesis. In The Development of Drosophila melanogaster. Vol.I (ed. M. Bate and A. Martinez-Arias), pp.71 -148. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

Hanzawa, H., de Ruwe, M. J., Albert, T. K., van der Vlietl, P. C., Timmers, H. T. M. and Boelens, R. (2001). The structure of the C4C4 RING finger of human NOT4 reveals features distinct from those of the C3HC4 RING fingers. J. Biol. Chem. 276,10185 -10190.[Abstract/Free Full Text]

Hartgers, F. C., Vissers, J. L. M., Looman, M. W. G., van Zoelen, C., Huffine, C., Figdor, C. G. and Adema, G. J. (2000). DC-STAMP, a novel multimembrane-spanning molecule preferentially expressed by dendritic cells. Eur. J. Immunol. 30,3585 -3590.[CrossRef][Medline]

Herrick, S. B., Schweissinger, D. L., Kim, S. W., Bayan, K. R., Mann, S. and Cardullo, R. A. (2005). The acrosomal vesicle of mouse sperm is a calcium store. J. Cell Phys. 202,663 -671.[CrossRef][Medline]

Hirokawa, T., Boon-Chieng, S. and Mitaku, S. (1998). SOSUI: Classification and secondary structure prediction system for membrane proteins. Bioinformatics 14,378 -379.[Abstract/Free Full Text]

Hoyle, H. D., Hutchens, J. A., Turner, F. R. and Raff, E. C. (1995). Regulation of beta-tubulin function and expression in Drosophila spermatogenesis. Dev. Genet. 16,148 -170.[CrossRef][Medline]

Kall, L., Krogh, A. and Sonnhammer, E. L. L. (2004). A combined transmembrane topology and signal peptide prediction method. J. Mol. Biol. 338,1027 -1036.[CrossRef][Medline]

Kellenberger, E., Dominguez, C., Fribourg, S., Wasielewski, E., Moras, D., Poterszman, A., Boelens, R. and Kieffer, B. (2005). Solution structure of the C-terminal domain of TFIIH P44 subunit reveals a novel type of C4C4 RING domain involved in protein-protein interaction. J. Biol. Chem. 280,20785 -20792.[Abstract/Free Full Text]

Koundakjian, E., Cowan, D. M., Hardy, R. W. and Becker, A. H. (2004). The Zuker Collection: a resource for the analysis of autosomal gene function in Drosophila melanogaster.Genetics 167,203 -206.[Abstract/Free Full Text]

Kroft, T., Gleason, E. J. and L'Hernault, S. W. (2005). The spe-42 gene in required for sperm-egg interactions during C. elegans fertilization and encodes a sperm-specific transmembrane protein. Dev. Biol. 286,169 -181.[CrossRef][Medline]

Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305,567 -580.[CrossRef][Medline]

Kukita, T., Wada, N., Kukita, A., Kakimoto, T., Sandra, F., Toh, K., Nagata, K., Iijima, T., Horiuchi, M., Matsusaki, M. et al. (2004). RANKL-induced DC-STAMP is essential for osteoclastogenesis. J. Exp. Med. 200,941 -946.[Abstract/Free Full Text]

Lopo, A. C., Glabe, C. G., Lennarz, W. J. and Vacquier, V. D. (1982). Sperm-egg binding events during sea urchin fertilization. Ann. New York Acad. Sci. 383,405 -425.[Medline]

Neill, A. T. and Vacquier, V. D. (2004). Ligands and receptors mediating signal tranduction in sea urchin. Reproduction 127,141 -149.[Abstract/Free Full Text]

Ohsako, T., Hirai, K. and Yamamoto, M.-T. (2003). The Drosophila misfire gene has an essential role in sperm activation during fertilization. Genes Genet. Syst. 78,253 -266.[CrossRef][Medline]

Perotti, M.-E. (1975). Ultrastructural aspects of fertilization in Drosophila. In The Functional Anatomy of the Spermatozoan, Proceedings of the Second International Symposium (ed. B. A. Afzelins), pp. 57-68. Oxford: Pergamon Press.

Pfeiffer, S., Alexandre, C., Calleja, M. and Vincent, J.-P. (2000). The progeny of wingless-expressing cells deliver the signal at a distance in Drosophila embryos. Curr. Biol. 10,321 -324.[CrossRef][Medline]

Pfeiffer, S., Ricardo, S., Manneville, J.-B., Alexandre, C. and Vincent, J.-P. (2002). Producing cells retrain and recycle wingless in Drosophila embryos. Curr. Biol. 12,957 -962.[CrossRef][Medline]

Preston, C. R., Sved, J. A. and Engels, W. R. (1996). Flanking duplications and deletions associated with P-induced male recombination in Drosophila. Genetics 144,1623 -1638.[Abstract]

Pugh, D. J. R., Eiso, A. B., Faro, A., Lutya, P. T., Hoffman, E. and Rees, D. J. G. (2006). DWNN, a novel ubiquitin-like domain, implicates RBBP6 in mRNA processing and ubiquitin-like pathways. BMC Struct. Biol. 6,1 .[CrossRef][Medline]

Rubinstein, E., Ziyyat, A., Wolf, J.-P., Le Naour, F. and Boucheix, C. (2006). The molecular players of sperm-egg fusion in mammals. Semin. Cell Dev. Biol. 17,254 -263.[CrossRef][Medline]

Sambrook, J. and Russell, D. W. (2001). Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, CSHL Press.

Takano, H., Yanagimachi, R. and Urch, U. A. (1998). Evidence that acrosin activity is important for the development of fusibility of mammalian spermatozoa with the oolema: inhibitor studies using the golden hamster. Zygote 1, 79-91.

Talbot, P., Shur, B. D. and Myles, D. G. (2003). Cell adhesion and fertilization: steps in oocyte transport, sperm-zona pellucida interactions, and sperm-egg fusion. Biol. Reprod. 68,1 -9.[Abstract/Free Full Text]

Tamkun, J. W., Deuring, R., Scott, M., Kissinger, M., Pattatucci, A. M., Kaufman, T. C. and Kennison, J. A. (1992). brahma: a regulator of Drosophila homeotic genes structurally related to the yeast transcriptional activator SNF2/SW12. Cell 68,561 -572.[CrossRef][Medline]

Thompson, J. D., Higgins, D. G. and Gibson, T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalities and weight matrix choice. Nucleic Acids Res. 22,4673 -4680.[Abstract/Free Full Text]

Thummel, C. and Pirrotta, V. (1992). New pCasPeR P element vectors. Dros. Info. Serv. 71, 150.

Tusnady, G. E. and Simon, I. (2001). The HMMTOP transmembrane topology prediction server. Bioinformatics 17,849 -850.[Abstract/Free Full Text]

Wakimoto, B. T., Lindsley, D. and Herrera, C. (2004). Toward a comprehensive genetic analysis of male fertility in Drosophila melanogaster. Genetics 167,207 -216.[Abstract/Free Full Text]

Walensky, L. D. and Snyder, S. H. (1995). Inositol 1,4,5-Trisphosphate receptors selectively localized to the acrosomes of mammalian sperm. J. Cell Biol. 130,857 -869.[Abstract/Free Full Text]

Wong, R., Hadjiyanni, I., Wei, H.-C., Polevoy, G., McBride, R., Sem, K.-P. and Brill, J. A. (2005). PIP2 hydrolysis and calcium release are required for cytokinesis in Drosophila spermatocytes. Curr. Biol. 15,1401 -1406.[CrossRef][Medline]

Yagi, M., Miyamoto, T., Sawatani, Y., Iwamoto, K., Hosogane, N., Fujita, N., Morita, K., Ninomiya, K., Suzuki, T., Miyamoto, K. et al. (2005). DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells. J. Exp. Med. 202,345 -351.[Abstract/Free Full Text]

Yanagimachi, R. (1994). Mammalian fertilization. In The Physiology of Reproduction (ed. J. D. Neill and E. Knobil), pp. 189-317. New York: Raven Press.


Related articles in Development:

Sneaky egg entry for sperm

Development 2006 133: e2401. [Full Text]  



This article has been cited by other articles:


Home page
Hum Mol GenetHome page
T. L. Karr
Fruit flies and the sperm proteome
Hum. Mol. Genet., October 15, 2007; 16(R2): R124 - R133.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
dev.02671v1
133/24/4871    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in Development
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilson, K. L.
Right arrow Articles by Wakimoto, B. T.
Right arrow Search for Related Content
PubMed