spacer gif spacer gif spacer gif spacer gif ARCHIVE ANNOUNCEMENT! spacer gif
QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

Corrigendum for Stafford et al., Development 133 (5) 949-956.
First published online November 21, 2006
doi: 10.1242/10.1242/dev.02730

Development 133, 5001 (2006)
Published by The Company of Biologists 2006
This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Search for Related Content

Corrigendum

Retinoids signal directly to zebrafish endoderm to specify insulin-expressing ß-cells

David Stafford, Richard J. White, Mary D. Kinkel, Angela Linville, Thomas F. Schilling and Victoria E. Prince

There was an error published in Development 133, 949-956.

There was a mistake in the sequence of the raldh2 morpholino, which was missing three nucleotides. The correct sequence is as follows: 5' GCAGTTCAACTTCACTGGAGGTCAT

The authors apologise to readers for this mistake.





This Article
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Search for Related Content