|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 January 2006
doi: 10.1242/dev.02215
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Biology, Emory University, Rollins Research Center, 1510 Clifton
Road, Atlanta GA 30322, USA.
2 Department of Developmental Biology, Stanford University School of Medicine,
Stanford CA 94305, USA.
3 Department of Biological Structure, University of Washington, Box 357420,
Seattle WA 98195, USA.
* Author for correspondence (e-mail: ishephe{at}emory.edu)
Accepted 21 November 2005
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Neural crest, Zebrafish, Craniofacial, ENS development, lessen (lsn), trap100 (thrap4), Proliferation
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
).
As the ENS precursors migrate, they proliferate and differentiate to form a
wide variety of neuronal subtypes (Furness, 1987; Gershon, 1994). Molecules in
the environment as well as lineage restrictions within the ENS precursors
determine the number and specific cell fates acquired by these precursors.
Failure of ENS precursors to colonize the complete gut results in the absence
of enteric ganglia along varying lengths of the colon (colonic aganglionosis)
(Newgreen and Young, 2002a;
Newgreen and Young, 2002b).
This is the most common cause of congenital intestinal obstruction in humans
and is clinically referred to as Hirschsprung's disease (HSCR)
(Kapur, 1999b;
Newgreen and Young,
2002a).
The molecular mechanisms that control the specification differentiation and
proliferation of the neural crest have been studied extensively. Several
secreted signalling molecules and their associated receptors have been
identified that control directly and indirectly the morphogenesis of the ENS.
These include GDNF (Cacalano et al.,
1998; Enomoto et al.,
1998; Moore et al.,
1996; Pichel et al.,
1996; Schuchardt et al.,
1994), neurturin (Heuckeroth
et al., 1999; Heuckeroth et
al., 1998; Rossi et al.,
1999), endothelin 3 (Baynash et
al., 1994; Hosoda et al.,
1994; Yanagisawa et al.,
1998), BMP2/4 (Chalazonitis et
al., 2004; Wu and Howard,
2002), Ihh (Indian hedgehog)
(Ramalho-Santos et al., 2000),
Shh (sonic hedgehog) (Fu et al.,
2004; Ramalho-Santos et al.,
2000; Sukegawa et al.,
2000), NT3 (Chalazonitis et
al., 2001; Chalazonitis et
al., 1994) and CNTF
(Chalazonitis et al.,
1998).
In addition to these signalling molecules, a number of transcription
factors have been implicated as having a role in the specification of the ENS
including Mash1 (Guillemot et al.,
1993), Phox2b (Pattyn et al.,
1999), SOX10 (Herbarth et al.,
1998; Kapur,
1999a; Pattyn et al.,
1999; Southard Smith et al.,
1998), Hox11l1 (Hatano et al.,
1997; Shirasawa et al.,
1997), Hoxb5 (Kuratani and
Wall, 1992; Pitera et al.,
1999), Hand2 (Cserjesi et al.,
1995; Howard et al.,
1999; Srivastava et al.,
1995; Wu and Howard,
2002) and AP2
(Barrallo-Gimeno et al., 2004;
Knight et al., 2003;
O'Brien et al., 2004).
Perturbation of the function of these signalling molecules and transcription
factors leads to defects in ENS. Furthermore, mutations in some of these genes
have been identified in patients affected with HSCR
(Amiel and Lyonnet, 2001;
Puri et al., 1998); however,
mutations in these known genes can only account for 
60% of familial HSCR
(Amiel and Lyonnet, 2001;
Puri et al., 1998).
Classical genetic studies of development have proven their utility in creating a molecular underpinning of the metazoan body plan, but the model organisms exploited to create that framework lack many of the organs found in vertebrates. To date, the genes identified as involved in ENS development have been identified indirectly. We therefore conducted a forward genetic screen in zebrafish to identify genes that when mutated would cause perturbations in the development of the ENS. One of the mutants we identified in this screen is lessen (lsn). Fish with a mutation in lsn have a significant reduction in the number of enteric neurons but also have defects in other neural crest and non-neural crest derived tissues, including the CNS and the intestine. We show that the lsn mutation disrupts a zebrafish trap100 (thrap4 - Zebrafish Information Network) that is required for the proliferation of enteric precursors within the embryonic intestine. Furthermore, we also show that trap100 is specifically required for the normal development of other cranial neural crest-derived structures, revealing that this gene has previously unappreciated tissue specific functions during embryogenesis. Transplantation of wild-type endoderm into lsn/trap100 mutants induces posterior pharyngeal arch cartilage development, which indicates that trap100 acts autonomously in the endoderm. Consequently this suggests that neural crest defects are secondary to endoderm defects in lsn/trap100 mutants. This is consistent with our finding that the ENS fails to develop in zebrafish that lack intestinal endoderm.
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). Embryos were staged and fixed at specific hours or days
post fertilization (hpf or dpf), as described by Kimmel et al. (Kimmel et al.,
1995). To better visualize internal structures in some experiments, embryos
were incubated with 0.2 mM 1-phenyl-2-thiourea (Sigma) to inhibited pigment
formation (Westerfield,
1993).
Immunocytochemistry
Embryos were processed for immunocytochemistry as previously described
(Raible and Kruse, 2000).
Differentiated enteric neurons and cranial ganglia neurons were revealed with
the anti-Hu mAb 16A11 (Molecular Probes) that labels differentiated neurons
(Marusich et al., 1994).
Serotonergic neurons were identified with an anti-5HT rabbit polyclonal
antisera (Immunostar). ENS precursors were revealed with an anti-Phox-2b
rabbit polyclonal antisera (Pattyn et al.,
1997). Proliferating cells were identified using an anti
phosphohistone-H3 mAb clone (Ser10) (Upstate)
(Ajiro et al., 1996). All mAbs
were visualized using an Alexa Fluor 568 anti-mouse IgG antibody (Molecular
Probes) or an Alexa Fluor 488 anti-mouse IgG antibody in double-label
experiments (Molecular Probes). The rabbit polyclonal Ab was visualized using
an Alexa Fluor 568 anti-rabbit IgG antibody (Molecular Probes).
Mutagenesis and screening
Males of the AB line treated with ENU as described previously bred with
wild-type females for at least two generations, then in-crossed to derive
recessive mutations to homozygosity
(Haffter et al., 1996).
Clutches of in-crossed 96 hpf embryos were fixed and processed for
immunocytochemistry using anti Hu mAb 16A11. The number of enteric neurons was
determined in a 10-somite segment of the intestine extending anteriorly from
the end of the yolk extension as described previously
(Shepherd et al., 2004).
Apoptosis assay
Apoptotic cell death was detected in whole embryos by terminal transferase
dUTP nick-end labelling (TUNEL) (In situ Cell Death Detection Kit; POD; Roche)
as described (Knight et al.,
2003).
Cartilage staining and histological methods
Cartilages were stained with Alcian Blue as described
(Schilling et al., 1996).
Embryos that were sectioned for histology were fixed and embedded in JB-4 and
plastic sections were preformed as described previously
(Pack et al., 1996).
Whole-mount in situ hybridization
Embryos were collected and processed for whole-mount in situ hybridization
as previously described (Thisse et al.,
1993). Digoxigenin-labelled and fluorescein-labelled riboprobes
were synthesized from templates linearized with BamHI using T7 RNA
polymerase for trap100. Other digoxigenin-labelled riboprobes used in
this study were synthesized from templates linearized and transcribed as
follows: crestin (Rubinstein et
al., 2000), SacI and T7; phox2b
(Shepherd et al., 2004),
NotI and T7; dlx2a
(Akimenko et al., 1994) and
foxn1 (Schorpp et al.,
2002), BamHI and T7; rag1
(Willett et al., 1997),
HindII and T7; epha4
(Xu et al., 1995),
EcoRI and T3; hoxb4 (Prince
et al., 1998), KpnI and T3; ifbp
(Andre et al., 2000),
trypsin (Mayer and Fishman,
2003), pax9 (Nornes
et al., 1996) and gata6
(Pack et al., 1996),
SalI and T7; foxa2
(Strahle et al., 1993),
SacI and T3; ptc1
(Concordet et al., 1996),
BamHI and T3; shh (Ekker et
al., 1995), HindII and T7; ret
(Bisgrove et al., 1997),
NotI and T7; and gfra1a
(Shepherd et al., 2001) and
nos1 (previously nnos)
(Poon et al., 2003),
NotI and Sp6. Digoxigenin-labelled probes were visualized with
NBT/BCIP coloration reactions, while fluorescein-labelled riboprobe was
visualized with Fast Red (Roche). Cross-sections of whole-mount in situ
hybridized embryos were cut using a Reichardt Jung cryostat. Embryos were
equilibrated in 20% sucrose in PBS solution and frozen in OCT. Sections (30
µm) were collected on Fisher super frost slides rehydrated in PBS and
mounted in gel mount (Fisher).
Mapping and molecular analysis of lsn
The lsnw24 (AB background) mutation was mapped by
out-crossing into the polymorphic wild-type strain WIK, followed by
in-breeding of heterozygous progeny. We scanned the genome for linked SSLP
markers by bulked segregant analysis using standard methods
(Shimoda et al., 1999;
Stickney et al., 2002;
Talbot and Schier, 1999).
This analysis placed the lsn mutation on linkage group 12 between
z9891 and z4373, an interval of 10 cM. Fine mapping using other SSLP
markers and SNPs in 3'UTRs and intronic regions of ESTs that map to this
region were used to further narrow the genetic interval. Using this approach,
we identified one EST Fa05b04 for which we had 0 recombinants out of 1122
meiosis screened. This EST encodes a zebrafish trap100. We analyzed
this candidate gene by complete sequencing of its cDNA isolated by RT-PCR from
wild type and mutant embryos. The trap100 cDNA isolated from mutants
was found to have a base substitution at codon 189 of the 2970 codon open
reading frame. This result was substantiated by sequencing PCR products from
genomic DNA derived from 12 mutants, 12 phenotypically wild-type siblings as
well as 12 unrelated wild types. The GenBank Accession Number for zebrafish
trap100 is DQ300265.
Embryonic microinjections
trap100 mRNA was synthesized using the mMessage mMachine kit
(Ambion) and injected at a concentration of 50 ng/µl. The mRNAs were
co-injected with GFP mRNA, also at a concentration of 50 ng/µl, to
assess expression. Approximately 1 nl of diluted mRNA was injected into one-
to two-cell embryos using a gas-driven microinjection apparatus (Model#
MMPI-2; Applied Scientific Instrumentation) through a micropipette.
Morpholino antisense oligonucleotides (Gene Tools) were designed corresponding to the start site and the with splice junction at the end of exon 3 of the genomic trap100 sequence. The sequences were as follows: +1/+25, CCTGTTTCAGATTCACCACCTTCAT; +199/int 3, GTGTGTTTACCTGTGAACTGATGGC.
The oligos were resuspended in sterile filtered water and diluted to
working concentrations at 1-5 µg/µl. Approximately 1 nl of diluted
morpholino was injected into one- to two-cell embryos using a gas-driven
microinjection apparatus. Efficacy of the morpholino directed against the
splice junction of exon 3 was evaluated using RT-PCR with a forward primer
corresponding to the 131 bp of trap100 (AGCTCTTCTGGAGCAGGCTA) in
conjunction with a reverse primer designed to 471 bp of trap100
(GGCCCTCAGACTGCTTTCTA). casanova morpholino was designed to the
previously described morpholino translation blocking sequence
(Dickmeis et al., 2001).
Transplantation experiments
Donor and host embryos were generated from an in cross of lsn
heterozygotes. Donor embryos at the one- to two-cell stage were injected with
1.5 pg of Tar* mRNA combined with a mixture of 5% Biotin-dextran
(10 K lysine fixable; Molecular Probes) and 5% fluorescein-dextran (10 K
Lysine fixable; Molecular Probes) to convert most of the donor cells to an
endodermal cell fate (Peyrieras et al.,
1998). Tar* mRNA were synthesized using the
mMessage mMachine kit (Ambion) as described above. At the sphere stage, 20-40
donor cells were transplanted into unlabelled sibling host embryos. Embryos
were then cultured in embryo medium with 10 U/ml penicillin and 10 U/ml
streptomycin. Host embryo jaw cartilage development was determined on day 5 by
Alcian Blue straining as described above. Donor cells from the transplant were
detected in hosts using an avidin-biotinylated complex (ABC kit, Vectastain)
and a DAB substrate. Genotypes of the host and donor embryos were determined
by sequencing.
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Kelsh and Eisen, 2000;
Shepherd et al., 2001;
Shepherd et al., 2004). By 96
hpf, enteric neurons can be identified along the complete length of the
intestine. We screened ENU-mutagenized zebrafish for recessive mutations that
interfere with the neurogenesis in the ENS. Clutches of embryos were obtained
from pair-wise crosses of in-crossed F2 families. The clutches of embryos were
immunocytochemically stained with an anti-Hu antibody
(Marusich et al., 1994) to
reveal differentiated neurons and then screened under a fluorescent
microscope. We identified a mutant allele (lsnw24) in
which there was a significant reduction in the number of enteric neurons at 96
hpf (Fig. 1). lsn
embryos have a 66% reduction in the number of enteric neurons over a 10-somite
length segment stretching anteriorly from the cloaca
(Fig. 3D). This reduction in
enteric neurons in lsn mutants is more pronounced in the more distal
part of the intestine when compared with the anterior part. Further analysis
of subtypes of ENS neurons in lsn mutants, specifically serotonergic
neurons by immunocytochemistry and nNOS-positive neurons by in situ
hybridization, shows that there is a similar reduction in the number of these
specific subtypes when compared with wild type at 96 hpf (see Fig. S1 in the
supplementary material). These data suggest that different enteric neuron
subtypes are equally affected in lsn mutants. Neuronal
differentiation in other areas of the PNS appears normal in lsn
mutants. The dorsal root ganglia, sympathetic neurons and cranial ganglia are
present and are comparatively normal at 96 hpf, based on anti-Hu
immunocytochemistry (Fig. 3;
see Fig. S2 in the supplementary material). Further analysis of cranial
ganglia development by in situ hybridization using a phox2b probe
(Elworthy et al., 2005) also
shows that the ganglia are normally specified at 48 hpf (see Fig. S2 in the
supplementary material). The mutation is recessive lethal and 100% penetrant
in all backgrounds tested (AB and WIK). Mutant embryos die by 7 dpf. We called
the mutant lessen (lsn) as the mutants had less enteric
neurons than wild type.
lsn mutants also have other defects in structures that are derived
completely or receive cellular contributions from the neural crest. The most
severely affected structures appear to be predominantly those that are derived
from or receive contributions from the vagal/post-otic neural crest cells
(Lam et al., 2002;
Schilling and Kimmel, 1994).
At 5 dpf lsn mutants fail to develop the most posterior
ceratobranchial cartilages (cb 4,5), while the more anterior ceratobranchial
cartilages and the other anterior cartilages of the jaw are lese severely
affected (Fig. 2A-D). In
addition, there is cardiac oedema apparent from 96 hpf and the thymus
primordium appears not to form normally, based on reduced Rag1 in situ
expression (Fig. 2E,F)
(Willett et al., 1997).
Whether the cardiac or thymus defects are due to neural crest defects has not
been determined.
Other neural crest derived tissues appear unaffected in lsn
mutants. We detected no difference in the normal pattern of melanophores or
iridophores by light microscopy at 96 hpf
(Fig. 1). In situ hybridization
studies using in situ probes for sox10
(Dutton et al., 2001) and
nacre (Lister et al.,
1999) at 24 hpf revealed no detectable difference in the pattern
of expression of these two markers, suggesting that neural crest derived
pigment cell development is unaffected in lsn (data not shown). We
also examined the pattern of sox10 at 48 hpf as a marker of glial
cells along the posterior lateral line
(Kelsh and Eisen, 2000) and
detected no difference in the pattern of staining in lsn when
compared with wild type (data not shown). Together this suggest that the
lsn mutation does not affect all neural crest-derived tissues but
instead affects specific axial subpopulations of neural crest cells.
The lsnw24 mutation disrupts a zebrafish trap100
We identified the affected gene disrupted in lsn by mapping and
molecular analysis of the lsnw24 mutation. Genetic mapping
localized lsn to linkage group 12 (LG.12) between markers z9891 and
z4373 (Fig. 3A). By scoring
1122 meioses, we established a fine map of the region using both
microsatellite markers and SNPs in the 3'UTR or intronic regions of
known genes or ESTs that had been mapped to this the crucial interval. Using
this approach, we identified a zebrafish EST (fa05b04) that had no
recombinants out of the 1122 meioses. Sequence analysis suggested that fa05b04
encoded a zebrafish homologue of Trap100, a component of the Trap/mediator
transcriptional regulation complex (Malik
and Roeder, 2000; Myers and
Kornberg, 2000; Rachez and
Freedman, 2001). We cloned and sequenced this gene and verified by
sequence comparison of the complete ORF that we had identified a zebrafish
trap100 orthologue of mouse and human Trap100/TRAP100
(Thrap4/THRAP4; Mouse Genome Informatics and Human Gene Nomenclature
Database) (Fig. 3B)
(Yuan et al., 1998;
Zhang and Fondell, 1999).
To determine if there was a mutation in this trap100 orthologue in lsn, we used RT-PCR to amplify the complete ORF of the zebrafish trap100 gene from genotypically homozygous wild-type and homozygous mutant 48 hpf embryos. Sequencing of these RT-PCR products revealed that the lsn mutant trap100 has a T to A base substitution that results in a premature stop codon at amino acid 63 in the N-terminal part of protein (Fig. 3C). This base is located in the third exon of the trap100 gene. Sequencing of this exon from genomic DNA isolated from morphologically identified 96 hpf lsn mutant embryos showed that all homozygous mutant embryos have this base substitution, while all homozygous wild-type siblings lack this base change. As the predicted Trap100 protein made in lsn mutants will be severely truncated (63 amino acids long as opposed to 989) and all the predicted functional domains will be missing in this truncated protein, we believe that lsn is a null allele of trap100.
|
|
To provide additional evidence that reduction in trap100 function causes the lsn phenotype, we injected one-to two-cell stage embryos with a morpholino antisense oligonucleotide directed against the putative translation start site of the gene or with a splice-blocking morpholino directed against the splice donor site at the end of exon 3. Injection of either morpholino resulted in jaw morphology, cardiac oedema and the enteric phenotypes similar to those displayed by lsn mutants (Fig. 4). The morphant phenotypes were the same for both morpholinos. In the case of the splice-blocking morpholino, the morphant phenotype correlated with a dramatic change in trap100 transcripts in which adjoining introns are not spliced correctly as detected by RT-PCR using primers that amplify over these splice sites (data not shown). Notably, morpholino injections did not increase the severity of phenotype when injected into homozygous lsnw24 mutants, supporting the notion that lsnw24 is a complete loss-of-function mutation.
trap100 expression
Zebrafish trap100 is maternally expressed as determined by RT-PCR
and in situ hybridization. Through the 10-somite stage, expression is
ubiquitous (Fig. 5A-C).
Subsequently trap100 expression starts to become more restricted with
expression becoming reduced in the trunk and tail tissue while remaining high
in more anterior parts of the embryo. By 24 hpf trap100 is no longer
detected in the trunk and tail (Fig.
5D,E). Widespread expression is maintained in anterior parts of
the embryo in both neural and non-neural tissue extending the length of the
hindbrain including through out the pharyngeal arches. Expression is also
present in the anterior parts of the gut tube. The pattern of expression at 48
hpf is essentially the same as that seen at 24 hpf but expression now extends
along nearly the complete length of the gut
(Fig. 5F). Cross-sections taken
at the level of somite 4 show that the expression in the gut is throughout the
mesendoderm (Fig. 5G). Although
expression remains widespread throughout the neural and non-neural tissue in
anterior parts of the embryo, three areas of higher expression of
trap100 can be seen in the CNS: in the dorsal forebrain, in the
ventral midbrain and in a stripe of expressing cells in the dorsal posterior
part of the midbrain (Fig. 5F).
At 60 hpf, cross-sections through the anterior part of the gut show that
trap100 expression is restricted to intestinal epithelial cells
(Fig. 5H,I). Double-label in
situ hybridization studies using a trap100 probe in conjunction with
a phox2b probe show that trap100 is not expressed in the ENS
precursors (Fig. 5H,I). By 72
hpf expression of trap100 becomes much more restricted
(Fig. 5J,K). Expression in the
CNS is restricted to discrete groups of cells in the diencephalon, in the
ventral midbrain and in a stripe of cells in the dorsal posterior part of the
midbrain. Weak expression can also be detected in the retina predominantly
restricted to the margin. Outside of the CNS expression becomes restricted to
the pharyngeal endoderm. This expression extends into the most anterior part
of the gut endoderm but does not extend to more posterior parts of the gut.
Pharyngeal endoderm expression is maintained through 96 hpf, the latest age we
examined in the present study (data not shown).
trap100 is not required for endoderm-intestinal transition
To determine whether the enteric defect was also associated with other
defects in intestinal development we examined cross-sections of mutant embryos
(Fig. 6A,B). At 96 hpf, the gut
tubes of the mutant embryos appear smaller and less well organized when
compared with wild-type and heterozygous siblings. Similarly, the liver and
pancreas are present in the mutant embryos but they are reduced in size when
compared with their wild-type siblings. We examined the expression pattern of
several early markers of intestinal development by in situ hybridization,
including foxa2 (Odenthal and
Nusslein-Volhard, 1998;
Strahle et al., 1993),
gata6 (Pack et al.,
1996), shh (Ekker et
al., 1995; Roy et al.,
2001) and ptc1
(Concordet et al., 1996;
Lewis et al., 1999) in
genotyped wild-type and lsn homozygous mutant embryos. No difference
was detected in the expression pattern of these genes (data not shown). To
determine if the reduction in size of the gut tube and the pancreas seen at 96
hpf was associated with a failure of these organs to functionally
differentiate, we carried out an in situ analysis using probes to
trypsin and intestinal fatty acid binding protein
(ifbp) (Fig. 6C-F)
(Andre et al., 2000;
Mayer and Fishman, 2003). Both
genes were expressed in lsn/trap100 mutants in comparatively normal
expression patterns, suggesting that the gut tube and the pancreas have
undergone cytodifferentiation into more mature organs, unlike the recently
identified npo mutant (Mayer and
Fishman, 2003). Although differentiation has occurred normally,
the normal looping of the gut has failed to occur, leading to an apparent
straight gut tube (Fig. 6F).
Together, these results suggest that, although gut and intestinal organ
development is less advanced in the lsn mutants, there has been no
arrest in intestinal development and that lsn/trap100 is not
essential for the differentiation of intestinal endoderm derivatives.
|
;
Rubinstein et al., 2000) or by
using other neural crest markers Sox10 and Foxd3 (see Fig. S3 in the
supplementary material; data not shown). Furthermore, no difference is
detected in the patterning of the hindbrain from which the cranial crest
neural crest arises as detected by in situ hybridization using epha4
and hoxb4 (Prince et al.,
1998; Schilling and Kimmel,
1994; Xu et al.,
1995) (see Fig. S3 in the supplementary material).
|
|
) in situ
probe or in their initial differentiation as determined by the expression of
pax9 (Nornes et al.,
1996) (see Fig. S4 in the supplementary material). Furthermore, no
difference is observed in the initial patterning and specification of the
thymus at 48 hpf, as determined using an in situ probe for the early thymus
marker Foxn1 (Schorpp et al.,
2002) (see Fig. S4 in the supplementary material).
|
; Rubinstein et al.,
2000) (Fig. 7A,B)
or using more specific enteric precursor markers gfra1a and
ret (data not shown) (Bisgrove et
al., 1997; Shepherd et al.,
2004). No difference in the expression of these markers is
detected prior to 48 hpf. However, at 48 hpf a difference in ENS development
can be detected. In wild-type embryos, ENS precursors can be seen along the
entire length of the intestine at 48 hpf
(Fig. 7C)
(Shepherd et al., 2004). By
contrast, in lsn homozygous mutants enteric precursors have only
migrated to the anterior part of the intestine by 48 hpf
(Fig. 7D). The lack of enteric
precursor cells in the more posterior parts of the intestine is maintained at
60 and 72 hpf, as determined both by in situ using probes for phox2b
(Elworthy et al., 2005;
Shepherd et al., 2004),
gfra1a (Shepherd et al.,
2001), ret (Bisgrove
et al., 1997) and nos1
(Poon et al., 2003), and by
immunocytochemistry using an anti-phox2b antibody
(Pattyn et al., 1997)
(Fig. 7E-H;
Fig. 8A,C). These results are
consistent with the Hu immunocytochemistry that was used to identify the
lsn mutants (Fig.
1D,F).
|
To determine why the ENS precursors subsequently fail to populate the
entire length of the intestine, we examined whether this phenotype resulted
from an absence or reduction in gdnf expression along the intestinal
mesendoderm. Previously, we have shown GDNF is crucially required for ENS
precursor migration along the intestine
(Shepherd et al., 2001).
gdnf expression is unchanged in lsn mutants when compared
with wild type (see Fig. S5 in the supplementary material). This result
combined with the observation that lsn ENS precursors have a normal
expression of GDNF receptor components suggests the lsn ENS phenotype
does not result from a perturbation of this signalling pathway.
|
). At both ages, we observed very few cells undergoing
apoptosis in the intestines of either wild-type or lsn mutant
embryos, consistent with the recent study by Ng et al.
(Ng et al., 2005) (see Fig. S5
in the supplementary material). We determined that there is no difference
between the number of cells undergoing apoptosis in the intestine of mutant
embryos and wild-type siblings at either age.
Given the absence of an increase in the number of cells undergoing
apoptosis in the intestine of lsn mutants, we examined whether the
phenotype resulted from a decrease or lack of in proliferation of ENS
precursors once they reached the intestine. As previously noted, lsn
mutants have a significant reduction in the number of ENS precursors in the
intestine at 48 hpf as detected by Phox2b immunocytochemistry
(Fig. 8) and by other ENS
precursors specific markers using in situ hybridization
(Fig. 7 and data not shown). By
undertaking double label immunocytochemistry with the Phox2b antibody and an
antibody for phosphohistone H3, a marker of proliferating cells
(Ajiro et al., 1996), we
determined that there is a 88% reduction in the number of proliferating ENS
precursors at 48 hpf (Fig. 8E).
This result suggests that the decrease in the number of ENS precursors seen at
96 hpf is caused at least in part the by the reduction in ENS precursor
proliferation.
lsn/trap100 is required non-cell autonomously for pharyngeal arch neural crest cells
As lsn/trap100 mutants exhibit defects in the neural crest derived
head skeleton and trap100 is widely expressed through out the
pharyngeal arch mesendoderm we tested whether lsn/trap100 is required
only in the mesendoderm. We attempted to rescue lsn/trap100 mutant
cartilages by placing wild-type cells into the pharyngeal mesendoderm.
Transplantation of unmanipulated wild-type cells usually results in small
mesendedormal clones. To achieve larger clones in endodermal pouches, we
injected wild-type donors prior to transplantation with
Tar*, an activated version of the type1 TGFß-related
receptor Taram A (Tar) to convert blastomeres to an endodermal fate
(David and Rosa, 2001;
David et al., 2002;
Peyrieras et al., 1998)
(Fig. 9A). As expected, donor
cells in the mosaic embryos contribute largely to the pharynx, endodermal
pouches of the pharyngeal arches and only very rarely to the entire length of
the digestive tract. In seven out of nine lsn larvae (78%) in which
transplanted wild-type cells contributed to the mesendoderm of the pharyngeal
arches partial rescue of the most posterior ceratobranchial cartilages (3, 4,
5) was observed (Fig. 9C).
Rescue corresponded only to regions where transplanted cells contributed to
the pharyngeal pouch endoderm. These results suggest that the cartilage
defects in lsn/trap100 result from defect signalling from the
endoderm.
Endoderm is required for the normal development of the ENS
To determine whether endoderm is necessary for the development of the ENS
we injected zebrafish embryos with a specific MO directed against
casanova (cas) mRNA
(Dickmeis et al., 2001). Cas
is a Sox-related factor that is required for endoderm formation
(Alexander et al., 1999;
Dickmeis et al., 2001;
Kikuchi et al., 2001). All
Cas-MO-injected embryos exhibited cardiabifida and completely lacked
intestinal endoderm as determined by foxa3 expression
(Fig. 9F,H). When compared with
uninjected controls, cas morphants completely lacked phox2b
expression in the ENS precursors, while expression in the hindbrain remained
though the pattern of expression was altered. To confirm that this was not
just a developmental delay, we stained 96 hpf Cas-MO embryos with anti-Hu
antibodies. No Hu immunoreactivity was seen in the ventral region of the
embryo where the ENS neurons normally are located (data not shown). These
experiments demonstrate that endoderm is required for the development of the
ENS.
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Zhang and Fondell,
1999). Trap100 is required for the normal development of specific
neural crest-derived structures in zebrafish. The lesion in lsn is a
point mutation in trap100 that introduces a stop codon in the third
exon of the gene and is predicted to severely truncate the mutant protein. We
predict that the lsn mutation results in a trap100-null
phenotype as the lsn Trap100 protein lacks all its predicted
functional domains. Consistent with this, injection of two different
morpholinos, a translation blocking morpholino or a splice-blocking
morpholino, into lsn mutants does not result in a more severe
phenotype, indicating that lsn is a complete loss-of-function mutant.
We show that Trap100 is required for the normal proliferation of ENS
precursors but not for the initial specification and migration of the ENS
precursors to the anterior end of the intestine. In mice, disruption of
trap100 results in an early embryonic lethal phenotype at E9-10,
primarily thought to be due to placental development defects that results in
anaemia and poor nutritional supply, but also due to defects in overall cell
growth through out the embryo (Ito et al.,
2002). Because of this early embryonic lethality in the
Trap100-/- mouse, a crucial role for Trap100 in ENS
development as well as the normal development of other vagal neural crest
derived structures was previously unrecognized.
trap100 has tissue specific functions during embryogenesis
Previous genetic studies of murine TRAP/mediator complex components TRAP220
(Ito et al., 2000;
Zhu et al., 2000), SRB7
(Tudor et al., 1999) and
Trap100 (Ito et al., 2002)
have shown that the complex is essential for embryogenesis but the genetic
null mutant mice have different degrees of phenotypic severity, with
Srb7-/- mice having the most severe phenotype with embryos
only reaching the blastocyst stage whereasTrap220-/- mice
are viable up to E11. This variation has led to the proposal that although the
TRAP/mediator complex is essential for normal cell viability, cells that
express TRAP/mediator complexes with different subunit compositions may have
more specific roles regulating tissue specific transcription for those cell
types with that subunit composition (Ito
et al., 2002).
Our finding that the lsn mutant is viable until larval stages of
zebrafish development (7 dpf) is surprising given the early Trap100-null mouse
lethality (Ito et al., 2002).
Furthermore, the zebrafish Trap100-null phenotype does not exhibit similar
defects in the spatiotemporal organization and proliferation in the neural
tube and cardiovascular system as reported in the Trap100-null mouse
(Ito et al., 2002). By
contrast, the lsn mutant phenotype clearly shows a tissue-specific
role for Trap100 in both ENS/intestinal development as well as in jaw
development. The jaw development phenotype is not unique for mutations that
affect TRAP/mediator components. Haploinsufficiency in the TRAP/mediator
subunit PAQ/ARC105 in DiGeorge syndrome indicates a potential specialized role
in development of organs derived from the first and second branchial arches
though the crucial role of Tbx1 also deleted in this deficiency is thought to
be the critical gene that causes the branchial arch phenotype in DiGeorge
(Berti et al., 2001;
Jerome and Papaioannou, 2001;
Lindsay et al., 2001;
Merscher et al., 2001). The
lsn mutant phenotype potentially has revealed a role for Trap100 in
the development of posterior branchial arch derived cartilages. The
differences between the mouse and zebrafish Trap100-null phenotypes probably
have arisen due to the crucial role of Trap100 in placental development in
amniotes (Ito et al., 2002).
Clarification as to whether this phenotypic difference is due to the placental
defect could be revealed using mouse chimera studies. It is also possible that
this difference occurs due to maternally deposited Trap100 protein rescuing
any early defects in lsn mutants.
trap100 function in endoderm is required for normal development of neural crest derived pharyngeal structures
In this study, we show that the lsn posterior jaw cartilage mutant
phenotype can be rescued by transplantation of wild-type endodermal cells.
This result suggests that signals from the pharyngeal mesendoderm required for
the normal development of the neural crest-derived cartilages are either
reduced or missing. Pharyngeal cartilage development is a complex process
requiring inductive signals from the surrounding endoderm and ectoderm
(Couly et al., 2002;
Crump et al., 2004a;
Crump et al., 2004b;
Hall, 1980). A large number of
genes are expressed in pharyngeal arches during embryogenesis, underscoring
the genetic complexity of their development. A number of these genes are
expressed in an evolutionarily conserved manner in zebrafish
(Yelick and Schilling, 2002)
and several of these genes have been shown to affect pharyngeal pouch
segmentation and jaw cartilage development including fgf3
(Crump et al., 2004a;
David et al., 2002),
fgf8 (Crump et al.,
2004a) and tbx1
(Piotrowski et al., 2003). The
migration of the neural crest into the branchial arches is unaffected in
lsn mutants, suggesting that pharyngeal pouch segmentation is normal
and that expression of these genes is unaffected in lsn. Consistent
with this supposition is our data showing that the development of the
epibranchial placodes is normal in lsn (see Fig. S2 in the
supplementary material). This is a process that has recently been shown to be
endoderm dependent (Holzschuh et al.,
2005; Nechiporuk et al.,
2005). Further investigation will be required to determine if
other signalling molecules, such as endothelin 1, that are known to play an
essential role in pharyngeal cartilage specification and differentiation are
affected in lsn (Kimmel et al.,
2003; Miller et al.,
2000; Piotrowski et al.,
2003).
trap100 is required for proliferation of vagal neural crest derived ENS precursors
In this study, we show that the lsn ENS phenotype is due to a
reduced level of proliferation of the ENS precursors. The findings that there
is a reduced number of ENS precursors from the onset of migration along the
gut and that fewer of these precursors are proliferating are consistent with
the later reduction in the total number of enteric neurons seen at 96 hpf.
Interestingly, we observe that in wild-type embryos, the majority of
phosphohistone H3-positive ENS precursors are the most caudal migrating ones.
This observation raises the possibility that the migration of ENS precursors
along the gut is a proliferative migration, i.e. it is a combination of cells
actively moving distally along the intestine combined with an increased number
of new ENS precursors being generated specifically at the leading edge of the
migration. This is not apparent in the mouse, where there appears to be no
significant increase in proliferation in precursors at the leading edge of the
wave of migration (Young et al.,
2004; Young and Newgreen,
2001). This difference may have arisen because of the very
different pattern of migration of ENS precursors along the zebrafish gut when
compared with mouse and avian precursors. In zebrafish ENS, precursors
initially migrate along the length of the gut tube as two symmetric streams
either side of the gut mesendoderm
(Elworthy et al., 2005;
Shepherd et al., 2004),
rather than as a rostrocaudal cork screw wave of migration within in the gut
mesoderm, as seen in mouse (Kapur et al.,
1992; Young et al.,
2004) and avian embryos (Burns
and Douarin, 1998; Epstein et
al., 1991; Newgreen et al.,
1996).
An important unresolved issue is what the cellular mechanisms are that
cause the ENS proliferation defect in lsn. One possibility is that
Trap100 is required for transcription of genes that are directly involved in
the cell cycle within the ENS precursors. Consistent with this idea, one of
the other components of the TRAP/mediator complex is Cyclin C
(Akoulitchev et al., 2000;
Gu et al., 1999;
Hengartner et al., 1998) and
thus a mutation in Trap100 that perturbed the normal association of Cyclin C
with the TRAP/mediator complex might potentially alter the effects of Cyclin C
on the cell cycle (Ren and Rollins,
2004). However, this proposed mechanism assumes that the mutation
acts cell autonomously within the ENS precursors. As Trap100 is not expressed
in ENS precursors in the intestine (Fig.
7H,I), this cell autonomous function appears unlikely. Instead the
expression of trap100 within the intestinal endoderm suggests that
the ENS defect is a secondary affect of the mutation and that the lsn
mutation acts cell autonomously in the intestinal endoderm. Potentially the
lsn ENS phenotype could result from reduced levels of endoderm
derived mitogenic factors required by the ENS precursors. Consistent with this
hypothesis is our data that shows that a lack of endoderm results in a
complete loss of the ENS. Further indirect support is provided by the
transplantation studies that show that the lsn mutation acts cell
autonomously with respect to the endoderm in the pharyngeal arches. We have
not been able to test this hypothesis directly as we have been unable to
generate chimaeric mutant embryos that have intestinal endoderm derived
principally from wild-type cells. While transplanted blastomeres from
tar*-injected donor embryos do contribute to pharyngeal
pouch endoderm these transplanted cells rarely contribute to the intestinal
endoderm as has been previously reported
(Piotrowski et al., 2003).
A further question that also remains unanswered relates to whether the
lsn mutant phenotype results from perturbation of nuclear hormone
signalling. Previous in vitro studies have shown that Trap100 is involved in
enhancing transactivation of thyroid hormone receptor (TR) and vitamin D
receptor (VDR) signalling in a ligand-dependent manner
(Zhang and Fondell, 1999),
and that in Trap100-deficient cells TR, VDR, PPAR
and androgen
receptors have attenuated transactivation function
(Ito et al., 2002).
Pharmacological block of TR signalling in zebrafish embryos between 3 dpf and
5 dpf results in a phenotype that is very similar to that seen in lsn
mutant embryos with regard to the jaw, eye and intestinal epithelium phenotype
(Liu and Chan, 2002). This
study also showed by RT-PCR that both TR and TRß are expressed in
a developmentally regulated fashion during this period; however, the
tissue-specific expression pattern of the receptors at this embryonic stage of
development has not been described. Detailed studies investigating the precise
spatial and temporal expression pattern of the thyroid hormone receptors and
other nuclear hormone receptors will help determine which nuclear hormone
activity is potentially perturbed in the lsn mutants.
In summary, the identification of trap100 as the gene responsible for the lsn mutation has revealed a previously unappreciated tissue-specific function of this gene during development. This finding is of significant interest for studies relating to the function of TRAP/mediator complexes with different subunit compositions. Furthermore, the identification of Trap100 as having an important role in ENS development has potentially identified a new gene that may be associated with HSCR.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/3/395/DC1
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Ajiro, K., Yoda, K., Utsumi, K. and Nishikawa, Y.
(1996). Alteration of cell cycle-dependent histone
phosphorylations by okadaic acid. Induction of mitosis-specific H3
phosphorylation and chromatin condensation in mammalian interphase cells.
J. Biol. Chem. 271,13197
-13201.
Akimenko, M. A., Ekker, M., Wegner, J., Lin, W. and Westerfield,
M. (1994). Combinatorial expression of three zebrafish genes
related to distal- less: part of a homeobox gene code for the head.
J. Neurosci. 14,3475
-3486.[Abstract]
Akoulitchev, S., Chuikov, S. and Reinberg, D.
(2000). TFIIH is negatively regulated by cdk8-containing mediator
complexes. Nature 407,102
-106.[CrossRef][Medline]
Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D.
Y. (1999). casanova plays an early and essential role in
endoderm formation in zebrafish. Dev. Biol.
215,343
-357.[CrossRef][Medline]
Amiel, J. and Lyonnet, S. (2001). Hirschsprung
disease, associated syndromes, and genetics: a review. J. Med.
Genet. 38,729
-739.
Andre, M., Ando, S., Ballagny, C., Durliat, M., Poupard, G.,
Briancon, C. and Babin, P. J. (2000). Intestinal fatty acid
binding protein gene expression reveals the cephalocaudal patterning during
zebrafish gut morphogenesis. Int. J. Dev. Biol.
44,249
-252.[Medline]
Barrallo-Gimeno, A., Holzschuh, J., Driever, W. and Knapik, E.
W. (2004). Neural crest survival and differentiation in
zebrafish depends on mont blanc/tfap2a gene function.
Development 131,1463
-1477.
Baynash, A. G., Hosoda, K., Giaid, A., Richardson, J. A., Emoto,
N., Hammer, R. E. and Yanagisawa, M. (1994). Interaction of
endothelin-3 with endothelin-B receptor is essential for development of
epidermal melanocytes and enteric neurons. Cell
79,1277
-1285.[CrossRef][Medline]
Berti, L., Mittler, G., Przemeck, G. K., Stelzer, G., Gunzler,
B., Amati, F., Conti, E., Dallapiccola, B., Hrabe de Angelis, M., Novelli, G.
et al. (2001). Isolation and characterization of a novel gene
from the DiGeorge chromosomal region that encodes for a mediator subunit.
Genomics 74,320
-332.[CrossRef][Medline]
Bisgrove, B. W., Raible, D. W., Walter, V., Eisen, J. S. and
Grunwald, D. J. (1997). Expression of c-ret in the zebrafish
embryo: potential roles in motoneuronal development. J.
Neurobiol. 33,749
-768.[CrossRef][Medline]
Burns, A. J. and Douarin, N. M. (1998). The
sacral neural crest contributes neurons and glia to the post-umbilical gut:
spatiotemporal analysis of the development of the enteric nervous system.
Development 125,4335
-4347.[Abstract]
Cacalano, G., Farinas, I., Wang, L. C., Hagler, K., Forgie, A.,
Moore, M., Armanini, M., Phillips, H., Ryan, A. M., Reichardt, L. F. et
al. (1998). GFRalpha1 is an essential receptor component for
GDNF in the developing nervous system and kidney.
Neuron 21,53
-62.[CrossRef][Medline]
Chalazonitis, A., Rothman, T. P., Chen, J., Lamballe, F.,
Barbacid, M. and Gershon, M. D. (1994). Neurotrophin-3
induces neural crest-derived cells from fetal rat gut to develop in vitro as
neurons or glia. J. Neurosci.
14,6571
-6584.[Abstract]
Chalazonitis, A., Rothman, T. P., Chen, J., Vinson, E. N.,
MacLennan, A. J. and Gershon, M. D. (1998). Promotion of the
development of enteric neurons and glia by neuropoietic cytokines:
interactions with neurotrophin-3. Dev. Biol.
198,343
-365.[Medline]
Chalazonitis, A., Pham, T. D., Rothman, T. P., DiStefano, P. S.,
Bothwell, M., Blair-Flynn, J., Tessarollo, L. and Gershon, M. D.
(2001). Neurotrophin-3 is required for the
survival-differentiation of subsets of developing enteric neurons.
J. Neurosci. 21,5620
-5636.
Chalazonitis, A., D'Autreaux, F., Guha, U., Pham, T. D., Faure,
C., Chen, J. J., Roman, D., Kan, L., Rothman, T. P., Kessler, J. A. et al.
(2004). Bone morphogenetic protein-2 and -4 limit the number of
enteric neurons but promote development of a TrkC-expressing
neurotrophin-3-dependent subset. J. Neurosci.
24,4266
-4282.
Concordet, J. P., Lewis, K. E., Moore, J. W., Goodrich, L. V.,
Johnson, R. L., Scott, M. P. and Ingham, P. W. (1996).
Spatial regulation of a zebrafish patched homologue reflects the roles of
sonic hedgehog and protein kinase A in neural tube and somite patterning.
Development 122,2835
-2846.[Abstract]
Couly, G., Creuzet, S., Bennaceur, S., Vincent, C. and Le
Douarin, N. M. (2002). Interactions between Hox-negative
cephalic neural crest cells and the foregut endoderm in patterning the facial
skeleton in the vertebrate head. Development
129,1061
-1073.[Medline]
Crump, J. G., Maves, L., Lawson, N. D., Weinstein, B. M. and
Kimmel, C. B. (2004a). An essential role for Fgfs in
endodermal pouch formation influences later craniofacial skeletal patterning.
Development 131,5703
-5716.
Crump, J. G., Swartz, M. E. and Kimmel, C. B.
(2004b). An integrin-dependent role of pouch endoderm in hyoid
cartilage development. PLoS Biol.
2, E244.[CrossRef][Medline]
Cserjesi, P., Brown, D., Ligon, K. L., Lyons, G. E., Copeland,
N. G., Gilbert, D. J., Jenkins, N. A. and Olson, E. N.
(1995). Scleraxis: a basic helix-loop-helix protein that
prefigures skeletal formation during mouse embryogenesis.
Development 121,1099
-1110.[Abstract]
David, N. B. and Rosa, F. M. (2001). Cell
autonomous commitment to an endodermal fate and behaviour by activation of
Nodal signalling. Development
128,3937
-3947.[Medline]
David, N. B., Saint-Etienne, L., Tsang, M., Schilling, T. F. and
Rosa, F. M. (2002). Requirement for endoderm and FGF3 in
ventral head skeleton formation. Development
129,4457
-4468.
Dickmeis, T., Mourrain, P., Saint-Etienne, L., Fischer, N.,
Aanstad, P., Clark, M., Strahle, U. and Rosa, F. (2001). A
crucial component of the endoderm formation pathway, CASANOVA, is encoded by a
novel sox-related gene. Genes Dev.
15,1487
-1492.
Dutton, K. A., Pauliny, A., Lopes, S. S., Elworthy, S., Carney,
T. J., Rauch, J., Geisler, R., Haffter, P. and Kelsh, R. N.
(2001). Zebrafish colourless encodes sox10 and specifies
non-ectomesenchymal neural crest fates. Development
128,4113
-4125.
Ekker, S. C., Ungar, A. R., Greenstein, P., von Kessler, D. P.,
Porter, J. A., Moon, R. T. and Beachy, P. A. (1995).
Patterning activities of vertebrate hedgehog proteins in the developing eye
and brain. Curr. Biol.
5, 944-955.[CrossRef][Medline]
Elworthy, S., Pinto, J. P., Pettifer, A., Cancela, M. L. and
Kelsh, R. N. (2005). Phox2b function in the enteric nervous
system is conserved in zebrafish and is sox10-dependent. Mech.
Dev. 122,659
-669.[CrossRef][Medline]
Enomoto, H., Araki, T., Jackman, A., Heuckeroth, R. O., Snider,
W. D., Johnson, E. M., Jr and Milbrandt, J. (1998). GFR
alpha1-deficient mice have deficits in the enteric nervous system and kidneys.
Neuron 21,317
-324.[CrossRef][Medline]
Epstein, M. L., Poulsen, K. T. and Thiboldeaux, R.
(1991). Formation of ganglia in the gut of the chick embryo.
J. Comp. Neurol. 307,189
-199.[CrossRef][Medline]
Fu, M., Lui, V. C., Sham, M. H., Pachnis, V. and Tam, P. K.
(2004). Sonic hedgehog regulates the proliferation,
differentiation, and migration of enteric neural crest cells in gut.
J. Cell Biol. 166,673
-684.
Furness, J. B. and Costa, M. (1987).
The Enteric Nervous System. Glasgow: Churchill
Livingstone.
Gavrieli, Y., Sherman, Y. and Ben Sasson, S. A.
(1992). Identification of programmed cell death in situ via
specific labeling of nuclear DNA fragmentation. J. Cell
Biol. 119,493
-501.
Gershon, M. D., Kirchgessner, A. L. and Wade, P. R.
(1994). Functional anatomy of the enteric nervous system. In
Physiology of the Gastrointestinal Tract, Vol.1
(ed. L. R. Johnson). New York: Raven
Press.
Gu, W., Malik, S., Ito, M., Yuan, C. X., Fondell, J. D., Zhang,
X., Martinez, E., Qin, J. and Roeder, R. G. (1999). A novel
human SRB/MED-containing cofactor complex, SMCC, involved in transcription
regulation. Mol. Cell 3,97
-108.[CrossRef][Medline]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A.,
Anderson, D. J. and Joyner, A. L. (1993). Mammalian
achaete-scute homolog 1 is required for the early development of olfactory and
autonomic neurons. Cell
75,463
-476.[CrossRef][Medline]
Haffter, P., Granato, M., Brand, M., Mullins, M. C.,
Hammerschmidt, M., Kane, D. A., Odenthal, J., van Eeden, F. J., Jiang, Y. J.,
Heisenberg, C. P. et al. (1996). The identification of genes
with unique and essential functions in the development of the zebrafish, Danio
rerio. Development 123,1
-36.[Abstract]
Hall, B. K. (1980). Tissue interactions and the
initiation of osteogenesis and chondrogenesis in the neural crest-derived
mandibular skeleton of the embryonic mouse as seen in isolated murine tissues
and in recombinations of murine and avian tissues. J. Embryol. Exp.
Morphol. 58,251
-264.[Medline]
Hatano, M., Aoki, T., Dezawa, M., Yusa, S., Iitsuka, Y., Koseki,
H., Taniguchi, M. and Tokuhisa, T. (1997). A novel
pathogenesis of megacolon in Ncx/Hox11L.1 deficient mice. J. Clin.
Invest. 100,795
-801.[Medline]
Hengartner, C. J., Myer, V. E., Liao, S. M., Wilson, C. J., Koh,
S. S. and Young, R. A. (1998). Temporal regulation of RNA
polymerase II by Srb10 and Kin28 cyclin-dependent kinases. Mol.
Cell 2,43
-53.[CrossRef][Medline]
Herbarth, B., Pingault, V., Bondurand, N., Kuhlbrodt, K.,
Hermans Borgmeyer, I., Puliti, A., Lemort, N., Goossens, M. and Wegner, M.
(1998). Mutation of the Sry-related Sox10 gene in Dominant
megacolon, a mouse model for human Hirschsprung disease. Proc.
Natl. Acad. Sci. USA. 95,5161
-5165.
Heuckeroth, R. O., Lampe, P. A., Johnson, E. M. and Milbrandt,
J. (1998). Neurturin and GDNF promote proliferation and
survival of enteric neuron and glial progenitors in vitro. Dev.
Biol. 200,116
-129.[CrossRef][Medline]
Heuckeroth, R. O., Enomoto, H., Grider, J. R., Golden, J. P.,
Hanke, J. A., Jackman, A., Molliver, D. C., Bardgett, M. E., Snider, W. D.,
Johnson, E. M., Jr et al. (1999). Gene targeting reveals a
critical role for neurturin in the development and maintenance of enteric,
sensory, and parasympathetic neurons. Neuron
22,253
-263.[CrossRef][Medline]
Holzschuh, J., Wada, N., Wada, C., Schaffer, A., Javidan, Y.,
Tallafuss, A., Bally-Cuif, L. and Schilling, T. F. (2005).
Requirements for endoderm and BMP signaling in sensory neurogenesis in
zebrafish. Development
132,3731
-3742.
Hosoda, K., Hammer, R. E., Richardson, J. A., Baynash, A. G.,
Cheung, J. C., Giaid, A. and Yanagisawa, M. (1994). Targeted
and natural (piebald-lethal) mutations of endothelin-B receptor gene produce
megacolon associated with spotted coat color in mice.
Cell 79,1267
-1276.[CrossRef][Medline]
Howard, M., Foster, D. N. and Cserjesi, P.
(1999). Expression of HAND gene products may be sufficient for
the differentiation of avian neural crest-derived cells into catecholaminergic
neurons in culture. Dev. Biol.
215, 62-77.[CrossRef][Medline]
Ito, M., Yuan, C. X., Okano, H. J., Darnell, R. B. and Roeder,
R. G. (2000). Involvement of the TRAP220 component of the
TRAP/SMCC coactivator complex in embryonic development and thyroid hormone
action. Mol. Cell 5,683
-693.[CrossRef][Medline]
Ito, M., Okano, H. J., Darnell, R. B. and Roeder, R. G.
(2002). The TRAP100 component of the TRAP/Mediator complex is
essential in broad transcriptional events and development. EMBO
J. 21,3464
-3475.[CrossRef][Medline]
Jerome, L. A. and Papaioannou, V. E. (2001).
DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1.
Nat. Genet. 27,286
-291.[CrossRef][Medline]
Kapur, R. P. (1999a). Early death of neural
crest cells is responsible for total enteric aganglionosis in
Sox10(Dom)/Sox10(Dom) mouse embryos. Pediatr. Dev.
Pathol. 2,559
-569.[CrossRef][Medline]
Kapur, R. P. (1999b). Hirschsprung disease and
other enteric dysganglionoses. Crit. Rev. Clin. Lab.
Sci. 36,225
-273.[CrossRef][Medline]
Kapur, R. P., Yost, C. and Palmiter, R. D.
(1992). A transgenic model for studying development of the
enteric nervous system in normal and aganglionic mice.
Development 116,167
-175.[Abstract]
Kelsh, R. N. and Eisen, J. S. (2000). The
zebrafish colourless gene regulates development of non-ectomesenchymal neural
crest derivatives. Development
127,515
-525.[Abstract]
Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron,
S., Yelon, D., Thisse, B. and Stainier, D. Y. (2001).
casanova encodes a novel Sox-related protein necessary and sufficient for
early endoderm formation in zebrafish. Genes Dev.
15,1493
-1505.
Kimmel, C. B., Ullmann, B., Walker, M., Miller, C. T. and Crump,
J. G. (2003). Endothelin 1-mediated regulation of pharyngeal
bone development in zebrafish. Development
130,1339
-1351.
Knight, R. D., Nair, S., Nelson, S. S., Afshar, A., Javidan, Y.,
Geisler, R., Rauch, G. J. and Schilling, T. F. (2003).
lockjaw encodes a zebrafish tfap2a required for early neural crest
development. Development
130,5755
-5768.
Kuratani, S. C. and Wall, N. A. (1992).
Expression of Hox 2.1 protein in restricted populations of neural crest cells
and pharyngeal ectoderm. Dev. Dyn.
195, 15-28.[Medline]
Lam, S. H., Chua, H. L., Gong, Z., Wen, Z., Lam, T. J. and Sin,
Y. M. (2002). Morphologic transformation of the thymus in
developing zebrafish. Dev. Dyn.
225, 87-94.[CrossRef][Medline]
Lewis, K. E., Concordet, J. P. and Ingham, P. W.
(1999). Characterisation of a second patched gene in the
zebrafish Danio rerio and the differential response of patched genes to
Hedgehog signalling. Dev. Biol.
208, 14-29.[CrossRef][Medline]
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T.,
Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et
al. (2001). Tbx1 haploinsufficieny in the DiGeorge syndrome
region causes aortic arch defects in mice. Nature
410,97
-101.[CrossRef][Medline]
Lister, J. A., Robertson, C. P., Lepage, T., Johnson, S. L. and
Raible, D. W. (1999). nacre encodes a zebrafish
microphthalmia-related protein that regulates neural-crest-derived pigment
cell fate. Development
126,3757
-3767.[Abstract]
Liu, Y. W. and Chan, W. K. (2002). Thyroid
hormones are important for embryonic to larval transitory phase in zebrafish.
Differentiation 70,36
-45.[CrossRef][Medline]
Luo, R., An, M., Arduini, B. L. and Henion, P. D.
(2001). Specific pan-neural crest expression of zebrafish Crestin
throughout embryonic development. Dev. Dyn.
220,169
-174.[CrossRef][Medline]
Malik, S. and Roeder, R. G. (2000).
Transcriptional regulation through Mediator-like coactivators in yeast and
metazoan cells. Trends Biochem. Sci.
25,277
-283.[CrossRef][Medline]
Marusich, M. F., Furneaux, H. M., Henion, P. D. and Weston, J.
A. (1994). Hu neuronal proteins are expressed in
proliferating neurogenic cells. J. Neurobiol.
25,143
-155.[CrossRef][Medline]
Mayer, A. N. and Fishman, M. C. (2003). Nil per
os encodes a conserved RNA recognition motif protein required for
morphogenesis and cytodifferentiation of digestive organs in zebrafish.
Development 130,3917
-3928.
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A.,
Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al.
(2001). TBX1 is responsible for cardiovascular defects in
velo-cardio-facial/DiGeorge syndrome. Cell
104,619
-629.[CrossRef][Medline]
Miller, C. T., Schilling, T. F., Lee, K., Parker, J. and Kimmel,
C. B. (2000). sucker encodes a zebrafish Endothelin-1
required for ventral pharyngeal arch development.
Development 127,3815
-3828.[Abstract]
Moore, M. W., Klein, R. D., Farinas, I., Sauer, H., Armanini,
M., Phillips, H., Reichardt, L. F., Ryan, A. M., Carver-Moore, K. and
Rosenthal, A. (1996). Renal and neuronal abnormalities in
mice lacking GDNF. Nature
382, 76-79.[CrossRef][Medline]
Myers, L. C. and Kornberg, R. D. (2000).
Mediator of transcriptional regulation. Annu. Rev.
Biochem. 69,729
-749.[CrossRef][Medline]
Nechiporuk, A., Linbo, T. and Raible, D. W.
(2005). Endoderm-derived Fgf3 is necessary and sufficient for
inducing neurogenesis in the epibranchial placodes in zebrafish.
Development 132,3717
-3730.
Newgreen, D. and Young, H. M. (2002a). Enteric
nervous system: development and developmental disturbances - part 1.
Pediatr. Dev. Pathol. 5,224
-247.[Medline]
Newgreen, D. and Young, H. M. (2002b). Enteric
nervous system: development and developmental disturbances - part 2.
Pediatr. Dev. Pathol. 5,329
-349.[CrossRef][Medline]
Newgreen, D. F., Southwell, B., Hartley, L. and Allan, I. J.
(1996). Migration of enteric neural crest cells in relation to
growth of the gut in avian embryos. Acta Anat. (Basel)
157,105
-115.[Medline]
Ng, A. N., de Jong-Curtain, T. A., Mawdsley, D. J., White, S.
J., Shin, J., Appel, B., Dong, P. D., Stainier, D. Y. and Heath, J. K.
(2005). Formation of the digestive system in zebrafish: III.
Intestinal epithelium morphogenesis. Dev. Biol.
286,114
-135.[CrossRef][Medline]
Nornes, S., Mikkola, I., Krauss, S., Delghandi, M., Perander, M.
and Johansen, T. (1996). Zebrafish Pax9 encodes two proteins
with distinct C-terminal transactivating domains of different potency
negatively regulated by adjacent N-terminal sequences. J. Biol.
Chem. 271,26914
-26923.
O'Brien, E. K., d'Alencon, C., Bonde, G., Li, W., Schoenebeck,
J., Allende, M. L., Gelb, B. D., Yelon, D., Eisen, J. S. and Cornell, R.
A. (2004). Transcription factor Ap-2alpha is necessary for
development of embryonic melanophores, autonomic neurons and pharyngeal
skeleton in zebrafish. Dev. Biol.
265,246
-261.[CrossRef][Medline]
Odenthal, J. and Nusslein-Volhard, C. (1998).
fork head domain genes in zebrafish. Dev. Genes Evol.
208,245
-258.[CrossRef][Medline]
Pack, M., Solnica-Krezel, L., Malicki, J., Neuhauss, S. C.,
Schier, A. F., Stemple, D. L., Driever, W. and Fishman, M. C.
(1996). Mutations affecting development of zebrafish digestive
organs. Development 123,321
-328.[Abstract]
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J.
F. (1997). Expression and interactions of the two closely
related homeobox genes Phox2a and Phox2b during neurogenesis.
Development 124,4065
-4075.[Abstract]
Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J.
F. (1999). The homeobox gene Phox2b is essential for the
development of autonomic neural crest derivatives.
Nature 399,366
-370.[CrossRef][Medline]
Peyrieras, N., Strahle, U. and Rosa, F. (1998).
Conversion of zebrafish blastomeres to an endodermal fate by TGF-beta-related
signaling. Curr. Biol.
8, 783-786.[CrossRef][Medline]
Pichel, J. G., Shen, L., Sheng, H. Z., Granholm, A. C., Drago,
J., Grinberg, A., Lee, E. J., Huang, S. P., Saarma, M., Hoffer, B. J. et
al. (1996). Defects in enteric innervation and kidney
development in mice lacking GDNF. Nature
382, 73-76.[CrossRef][Medline]
Piotrowski, T., Ahn, D. G., Schilling, T. F., Nair, S.,
Ruvinsky, I., Geisler, R., Rauch, G. J., Haffter, P., Zon, L. I., Zhou, Y. et
al. (2003). The zebrafish van gogh mutation disrupts tbx1,
which is involved in the DiGeorge deletion syndrome in humans.
Development 130,5043
-5052.
Pitera, J. E., Smith, V. V., Thorogood, P. and Milla, P. J.
(1999). Coordinated expression of 3' hox genes during
murine embryonal gut development: an enteric Hox code.
Gastroenterology 117,1339
-1351.[CrossRef][Medline]
Poon, K. L., Richardson, M., Lam, C. S., Khoo, H. E. and Korzh,
V. (2003). Expression pattern of neuronal nitric oxide
synthase in embryonic zebrafish. Gene Expr. Patterns
3, 463-466.[CrossRef][Medline]
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K.
(1998). Zebrafish hox genes: expression in the hindbrain region
of wild-type and mutants of the segmentation gene, valentino.
Development 125,393
-406.[Abstract]
Puri, P., Ohshiro, K. and Wester, T. (1998).
Hirschsprung's disease: a search for etiology. Semin. Pediatr.
Surg. 7,140
-147.[Medline]
Rachez, C. and Freedman, L. P. (2001). Mediator
complexes and transcription. Curr. Opin. Cell Biol.
13,274
-280.[CrossRef][Medline]
Raible, D. W. and Kruse, G. J. (2000).
Organization of the lateral line system in embryonic zebrafish. J.
Comp. Neurol. 421,189
-198.[CrossRef][Medline]
Ramalho-Santos, M., Melton, D. A. and McMahon, A. P.
(2000). Hedgehog signals regulate multiple aspects of
gastrointestinal development. Development
127,2763
-2772.[Abstract]
Ren, S. and Rollins, B. J. (2004). Cyclin
C/cdk3 promotes Rb-dependent G0 exit. Cell
117,239
-251.[CrossRef][Medline]
Rossi, J., Luukko, K., Poteryaev, D., Laurikainen, A., Sun, Y.
F., Laakso, T., Eerikainen, S., Tuominen, R., Lakso, M., Rauvala, H. et
al. (1999). Retarded growth and deficits in the enteric and
parasympathetic nervous system in mice lacking GFR alpha2, a functional
neurturin receptor. Neuron
22,243
-252.[CrossRef][Medline]
Roy, S., Qiao, T., Wolff, C. and Ingham, P. W.
(2001). Hedgehog signaling pathway is essential for pancreas
specification in the zebrafish embryo. Curr. Biol.
11,1358
-1363.[CrossRef][Medline]
Rubinstein, A. L., Lee, D., Luo, R., Henion, P. D. and Halpern,
M. E. (2000). Genes dependent on zebrafish cyclops function
identified by AFLP differential gene expression screen.
Genesis 26,86
-97.[CrossRef][Medline]
Schilling, T. F. and Kimmel, C. B. (1994).
Segment and cell type lineage restrictions during pharyngeal arch development
in the zebrafish embryo. Development
120,483
-494.[Abstract]
Schilling, T. F., Piotrowski, T., Grandel, H., Brand, M.,
Heisenberg, C. P., Jiang, Y. J., Beuchle, D., Hammerschmidt, M., Kane, D. A.,
Mullins, M. C. et al. (1996). Jaw and branchial arch mutants
in zebrafish I: branchial arches. Development
123,329
-344.[Abstract]
Schorpp, M., Leicht, M., Nold, E., Hammerschmidt, M.,
Haas-Assenbaum, A., Wiest, W. and Boehm, T. (2002). A
zebrafish orthologue (whnb) of the mouse nude gene is expressed in the
epithelial compartment of the embryonic thymic rudiment. Mech.
Dev. 118,179
-185.[CrossRef][Medline]
Schuchardt, A., D'Agati, V., Larsson-Blomberg, L., Costantini,
F. and Pachnis, V. (1994). Defects in the kidney and enteric
nervous system of mice lacking the tyrosine kinase receptor Ret.
Nature 367,380
-383.[CrossRef][Medline]
Shepherd, I. T., Beattie, C. E. and Raible, D. W.
(2001). Functional analysis of zebrafish GDNF. Dev.
Biol. 231,420
-435.[CrossRef][Medline]
Shepherd, I. T., Pietsch, J., Elworthy, S., Kelsh, R. N. and
Raible, D. W. (2004). Roles for GFR{alpha}1 receptors in
zebrafish enteric nervous system development.
Development 131,241
-249.
Shimoda, N., Knapik, E. W., Ziniti, J., Sim, C., Yamada, E.,
Kaplan, S., Jackson, D., de, Sauvage, F., Jacob, H. and Fishman, M. C.
(1999). Zebrafish genetic map with 2000 microsatellite markers.
Genomics 58,219
-232.[CrossRef][Medline]
Shirasawa, S., Yunker, A. M., Roth, K. A., Brown, G. A.,
Horning, S. and Korsmeyer, S. J. (1997). Enx
(Hox11L1)-deficient mice develop myenteric neuronal hyperplasia and megacolon.
Nat. Med. 3,646
-650.[CrossRef][Medline]
Southard Smith, E. M., Kos, L. and Pavan, W. J.
(1998). Sox10 mutation disrupts neural crest development in Dom
Hirschsprung mouse model. Nat. Genet.
18, 60-64.[CrossRef][Medline]
Srivastava, D., Cserjesi, P. and Olson, E. N.
(1995). A subclass of bHLH proteins required for cardiac
morphogenesis. Science
270,1995
-1999.
Stickney, H. L., Schmutz, J., Woods, I. G., Holtzer, C. C.,
Dickson, M. C., Kelly, P. D., Myers, R. M. and Talbot, W. S.
(2002). Rapid mapping of zebrafish mutations with SNPs and
oligonucleotide microarrays. Genome Res.
12,1929
-1934.
Strahle, U., Blader, P., Henrique, D. and Ingham, P. W.
(1993). Axial, a zebrafish gene expressed along the developing
body axis, shows altered expression in cyclops mutant embryos.
Genes Dev. 7,1436
-1446.
Sukegawa, A., Narita, T., Kameda, T., Saitoh, K., Nohno, T.,
Iba, H., Yasugi, S. and Fukuda, K. (2000). The concentric
structure of the developing gut is regulated by Sonic hedgehog derived from
endodermal epithelium. Development
127,1971
-1980.[Abstract]
Talbot, W. S. and Schier, A. F. (1999).
Positional cloning of mutated zebrafish genes. Methods Cell
Biol. 60,259
-286.[Medline]
Thisse, C., Thisse, B., Schilling, T. F. and Postlethwait, J.
H. (1993). Structure of the zebrafish snail1 gene and its
expression in wild-type, spadetail and no tail mutant embryos.
Development 119,1203
-1215.[Abstract]
Tudor, M., Murray, P. J., Onufryk, C., Jaenisch, R. and Young,
R. A. (1999). Ubiquitous expression and embryonic requirement
for RNA polymerase II coactivator subunit Srb7 in mice. Genes
Dev. 13,2365
-2368.
Westerfield, M. (1993). The
Zebrafish Book. Eugene (OR): University of Oregon
Press.
Willett, C. E., Zapata, A. G., Hopkins, N. and Steiner, L.
A. (1997). Expression of zebrafish rag genes during early
development identifies the thymus. Dev. Biol.
182,331
-341.[CrossRef][Medline]
Wu, X. and Howard, M. J. (2002). Transcripts
encoding HAND genes are differentially expressed and regulated by BMP4 and
GDNF in developing avian gut. Gene Expr.
10,279
-293.[Medline]
Xu, Q., Alldus, G., Holder, N. and Wilkinson, D. G.
(1995). Expression of truncated Sek-1 receptor tyrosine kinase
disrupts the segmental restriction of gene expression in the Xenopus and
zebrafish hindbrain. Development
121,4005
-4016.[Abstract]
Yanagisawa, H., Yanagisawa, M., Kapur, R. P., Richardson, J. A.,
Williams, S. C., Clouthier, D. E., de Wit, D., Emoto, N. and Hammer, R. E.
(1998). Dual genetic pathways of endothelin-mediated
intercellular signaling revealed by targeted disruption of endothelin
converting enzyme-1 gene. Development
125,825
-836.[Abstract]
Yelick, P. C. and Schilling, T. F. (2002).
Molecular dissection of craniofacial development using zebrafish.
Crit. Rev. Oral Biol. Med.
13,308
-322.
Young, H. M. and Newgreen, D. (2001). Enteric
neural crest-derived cells: origin, identification, migration, and
differentiation. Anat. Rec.
262, 1-15.[CrossRef][Medline]
Young, H. M., Bergner, A. J., Anderson, R. B., Enomoto, H.,
Milbrandt, J., Newgreen, D. F. and Whitington, P. M. (2004).
Dynamics of neural crest-derived cell migration in the embryonic mouse gut.
Dev. Biol. 270,455
-473.[CrossRef][Medline]
Yuan, C. X., Ito, M., Fondell, J. D., Fu, Z. Y. and Roeder, R.
G. (1998). The TRAP220 component of a thyroid hormone
receptor-associated protein (TRAP) coactivator complex interacts directly with
nuclear receptors in a ligand-dependent fashion. Proc. Natl. Acad.
Sci. USA 95,7939
-7944.
Zhang, J. and Fondell, J. D. (1999).
Identification of mouse TRAP100: a transcriptional coregulatory factor for
thyroid hormone and vitamin D receptors. Mol.
Endocrinol. 13,1130
-1140.
Zhu, Y., Qi, C., Jia, Y., Nye, J. S., Rao, M. S. and Reddy, J.
K. (2000). Deletion of PBP/PPARBP, the gene for nuclear
receptor coactivator peroxisome proliferator-activated receptor-binding
protein, results in embryonic lethality. J. Biol.
Chem. 275,14779
-14782.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  X. Wang, N. Yang, E. Uno, R. G. Roeder, and S. Guo A subunit of the mediator complex regulates vertebrate neuronal development PNAS, November 14, 2006; 103(46): 17284 - 17289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Durr, J. Holzschuh, A. Filippi, A.-K. Ettl, S. Ryu, I. T. Shepherd, and W. Driever Differential Roles of Transcriptional Mediator Complex Subunits Crsp34/Med27, Crsp150/Med14 and Trap100/Med24 During Zebrafish Retinal Development Genetics, October 1, 2006; 174(2): 693 - 705. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
