|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 January 2006
doi: 10.1242/dev.02190
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

School of Life Sciences, University of Dundee, MSI/WTB Complex, Dow Street, Dundee DD1 5EH, UK.
Author for correspondence (e-mail:
j.g.williams{at}dundee.ac.uk)
Accepted 28 October 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Dictyostelium, bZIP, Prestalk, DIF-1
| INTRODUCTION |
|---|
|
|
|---|
ecmA is more strongly expressed in cells in the front of the
prestalk region than in the back and cells in these two locations use
spatially separated regions of its promoter (Williams et al., 1989;
Early et al., 1993
). PstA cells
occupy the front half of the prestalk region and employ cap-site proximal
promoter elements, while pstO cells occupy the rear half and use cap-site
distal promoter elements. Although they were initially identified using the
bi-partite promoter of the ecmA gene, many other genes are expressed
only in one or other region (Maeda et al.,
2003
). This indicates that the two subtypes are of wide
developmental significance and the fact that they differ in their movement
patterns within the slug and at culmination supports this notion
(Jermyn and Williams, 1991
;
Abe et al., 1994
).
The chlorinated hexaphenone DIF-1 rapidly induces ecmA
transcription (Williams et al.,
1987
) and dmtA-, a biosynthetic mutant which makes little or no
DIF-1, shows a major defect in prestalk cell differentiation
(Thompson and Kay, 2000b
);
pstO-specific gene expression is greatly reduced but pstA differentiation is
unaffected. Thus, DIF-1 appears to be essential for efficient pstO cell
differentiation but not for pstA cell differentiation. A genetic approach has
identified a gene, dimA, that is required for multiple aspects of
DIF-1 signalling (Thompson et al.,
2004
) but its interface with the DIF-1 signalling pathway is
unknown.
The protein encoded by dimA is a bZIP transcription factor. bZIP
proteins are found in all eukaryotes and are characterised by the presence of
a basic, DNA-binding region and a closely apposed leucine zipper
(Hai and Hartman, 2001
;
Jakoby et al., 2002
;
Poels and Broeck, 2004
). The
leucine zipper mediates the formation of homodimers and heterodimers with
other bZIP proteins. We identify a novel bZIP protein that interacts with the
ecmA promoter and show that it is a DIF-1 responsive regulator of
prestalk specific gene expression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DIF induction assays and analysis of ecmA gene expression by RT-PCR
Cells were harvested from growth, washed and plated at densities varying
between 104 and 105 cells/cm2 in stalk medium
[10 mM KCl, 2 mM NaCl, 1 mM CaCl2, 10 mM MES (pH 6.2)] and
incubated at 22°C for 1 hour. The medium was changed to stalk salts,
cerulenin at concentrations between 50 µM and 150 µM, and 5 mM cAMP, and
was incubated for a further 6 hours. The medium was then removed and replaced
with stalk medium, the same concentration of cerulenin
(Kay, 1998
) and concentrations
of DIF-1 up to 100 nM. The plates were incubated at 22°C for 16 hours and
RNA was extracted using an RNeasy kit (Qiagen) and analysed by RT-PCR using a
`TITANIUM' One-Step RT-PCR kit (BD Biosciences). The ecmA primers
are: forward, CCAATTAGCTGTCCAAAACC; reverse, GCAATCACCTTTACCTCCTG. They
generate a 480 nucleotide fragment. IG7, a constitutively expressed mRNA, was
used as control.
Band shift assay, protein purification and mass spectrometry
Nuclear extracts were prepared from slug stage cells
(Kawata et al., 1996
). For
purification, nuclear extract derived from 3.5x1011 slug
cells was precipitated with 40% (w/v) ammonium sulfate, and subjected to
heparin sepharose chromatography. It was then loaded onto a DNA affinity
column bearing R1 or R2 oligonucleotides. These were synthesized as a
duplicate tandem copy, multimerized by ligation and coupled to sepharose
beads. Bound proteins were eluted with 0.4 M KCl. The eluted proteins were
further purified through a second round of binding on the affinity column,
concentrated and loaded onto an SDS gel. After staining with Colloidal Blue
Staining Kit (Invitrogen), protein bands were excised from the gel, digested
with trypsin and analysed by MALDI-TOF mass spectrometry.
Expression of DimB in E. coli and gel retardation assay
The DimB-coding region was cloned in pET28a (Novagene), with the addition
of a BamHI site at the N terminus and an XhoI site at the C
terminus. It was expressed in E. coli strain BL21 CodonPlus RIL
(Stratagene), as a C terminal HIS tagged fusion protein and purified using a
`Talon' metal affinity column (Clontech). Gel retardation assays were
performed, as described above, using approximately 1 µg of fusion protein
per assay.
Gene disruption
DimB-coding sequences extending from +1 to +1375 (numbered relative to the
ATG) was cloned into a plasmid vector and a BamHI hygromycin
resistance cassette was inserted at the unique BglII site, positioned
at nucleotide 600 relative to the initiation codon. Transformants were
isolated clonally and screened for gene disruption by PCR and by western
blotting.
Antibody generation
Polyclonal rabbit antisera were generated using the N terminal and C
terminal 15 amino acids of DimB as immunogens. The peptides contained a
non-coded cysteine residue, respectively at their C and N termini, and these
were coupled to an affinity matrix in order to purify the antibody.
DIF-1 induction of DimB nuclear accumulation
Ax2 cells were developed on non-nutrient water agar to form loose
aggregates and DmtA null cells were developed to the tight aggregate stage.
Aggregates were mechanically dissociated in KK2 buffer, by trituration through
a syringe needle. After dissociation, cells were adjusted to a density of
2x107 cells in KK2 and treated with 0.01% ethanol or with
100nM DIF-1 in 0.01% ethanol. Cells were fixed on ice in methanol for 10
minutes and stained with affinity purified, anti-DimB antibody. After
secondary reaction with Alexa Fluor 488-conjugated goat anti-rabbit antibody
(Molecular Probes), samples were analyzed by confocal microscopy.
ChIP analysis of DIF-1 induced cells
Disaggregated cells, from the loose aggregate stage, were induced by
shaking at 4x106/ml in phosphate buffer containing 1 mM cAMP
and 100 nM DIF-1 for 1.75 hours. They were then fixed with paraformaldehyde
(final 1%) in PBS at 4°C for 2 hours. After stopping the reaction with
glycine (final 125 mM) and washing, cells were suspended in TNTE buffer [50 mM
Tris-Cl (pH 8.0) containing 150 mM NaCl, 1% Triton X100, 0.05% SDS, 2 mM EDTA]
containing complete protein inhibitor cocktail (Roche Diagnostics, Germany)
and sonicated to yield fragments of 0.3 to 3.0 kb. Immunoprecipitation was
carried out from the supernatant in TNTE buffer containing 1% blocking reagent
(Roche Diagnostics, Germany): using the anti-DimB antibody or an anti-CudA
antibody, and Protein A-Sepharose CL-4B (Amersham Biosciences, Sweden) at
4°C, overnight.
After washing with TNTE buffer and then with 10 mM Tris-Cl (pH 8.0) containing 250 mM LiCl, 1% NP-40, 1% DOC and 1 mM EDTA, DNA was recovered by incubating with 50 mM Tris-Cl (pH 7.5) containing 1% SDS and 1 mM EDTA at 37°C for 15 minutes. After reversing the crosslinking by heating at 65°C overnight and treating with proteinase K (100 µg/ml) and RNase (10 µg/ml) at 37°C for 1 hour, DNA was purified with a QIA Quick-Spin column (QIAGEN). PCR was performed from immunoprecipitated DNA or from total genomic DNA using the following primers: ecmA, AATTATAACCCCCATTCGC and AGAGTTTGATGATAACAAGAG (region -1257 to -876); and (as a control) the gpbA upstream region, TAAACAAACACACACCCAAC and AGGACTTACTAAAATTACAGG.
| RESULTS |
|---|
|
|
|---|
A 5 to 3' deletion construct of the ecmA promoter with a
cap-site distal end point at -1041 [construct M
(Early et al., 1993
)] directs
high level expression in pstA and pstO cells. Further deletion, to -895
[construct N (Early et al.,
1993
)], reduces expression, equally in pstA and pstO cells. Hence,
oligonucleotide R1 was designed, containing 32 nucleotides of sequence closely
bordering the 5' boundary of construct M. Deletion to -531 (construct O)
generates the `standard' pstA marker and further deletion to -374 (construct
P) greatly reduces expression (Early et
al., 1995
). Hence, oligonucleotide R2 was designed, containing 32
nucleotides of sequence closely bordering the 5' boundary of construct
O.
R1 was used to isolate interacting proteins, by employing its multimerised form in affinity chromatography with slug cell nuclear extracts. After elution the bound proteins were subjected to SDS gel-electrophoresis and the most abundant species identified by mass spectrometry (Fig. 2). Several are RNA-interacting proteins that bind non-specifically to the column. One is a novel bZIP protein that we term DimB (encoded by dimB). Another, lower molecular weight species on the gel, DimB', contains a subset of the DimB peptides and is presumably a degradation product of DimB.
When the R2 region was used in affinity chromatography, multiple species were also purified. Again, mass spectrometry showed that several are RNA-binding proteins but one is DimB (Fig. 2). Another of the proteins (asterisked) binds to R2 but not to R1. It is a novel MYB domain protein, that we have named MybE (M.F. and J.G.W., unpublished).
DimB bears significant homology to DimA
(Thompson et al., 2004
) but is
half its size; DimB has a predicted size of 68,447 Da, while DimA is predicted
to be 140,259 Da (Fig. 3A). One
region of strong homology between the two proteins encompasses the DNA
binding/dimerisation domain and an alignment of the basic regions and leucine
zippers of DimB, DimA and several other members of the bZIP family is
presented in Fig. 3B.
Determination of the DNA binding properties of DimB
DimB was expressed in E. coli as part of a fusion protein,
DimB:HIS, in which oligo-histidine is linked to the C terminus. DimB:HIS was
employed in band shift assays with either R1 or R2 as labelled probe. DimB:HIS
binds to both the R1 and R2 probes, and unlabelled R1 and R2 oligonucleotides
are potent inhibitors of the binding: both in self-competition and in
cross-competition (Fig. 4; data
not shown for R1). Just 10 pmoles of unlabelled R1 or R2 DNA strongly competes
for binding of DimB:HIS to a labelled R1 or R2 probe. As negative controls, a
discoidin 1
promoter oligonucleotide, the TTG box
(Vauti et al., 1990
), and an
ecmB promoter oligonucleotide, the ecmB activator
(Ceccarelli et al., 2000
), were
used as competitors. Both are much weaker competitors than R1 or R2. Thus,
recombinant DimB binds with high relative affinity to R1 and R2.
Identification of the DNA binding sites for DimB
The positions of the DimB-binding sites in R1 and R2 were determined by a
mutational scanning technique (Ceccarelli
et al., 2000
), in which four nucleotide blocks of sequence were
replaced with the arbitrarily chosen sequence GCGC. The mutant forms were used
as competitors in band-shift assays against the respective unmutated probe. In
multiple experiments, using varying amounts of competitor, the M6 mutant form
of R1 (data not shown) and the M7 mutant form of R2 consistently proved to be
relatively ineffective as competitors (Fig.
5A).
|
|
Point mutations in the proximal DimB binding site greatly decrease expression in pstO cells and ALC
R2pM1, the oligonucleotide with the four point mutations that completely
abrogate DimB binding, was cloned within a lacZ fusion construct to
assay its function in vivo. This recipient construct, a newly created
lacZ fusion termed S (Fig.
1, Fig. 6B), has
its cap-site distal terminus at nucleotide -493. It differs significantly from
published ecmA promoter fragment constructs at its cap-site proximal
end (legend to Fig. 6B).
Fusion of R2 to S generates a construct, R2S, that is most strongly expressed in the pstA region but that is also expressed in cells in the pstO region and in large numbers of ALC (Fig. 6B). When this pattern is compared with S and R2pM1S, a striking difference is apparent. With the latter two constructs staining is almost entirely restricted to the pstA region, with very few stained cells in the pstO region and almost no stained ALC (Fig. 6B). Thus, the cap-site proximal (-510) DimB-binding site is not required for expression in pstA cells but is essential for efficient expression in pstO cells and ALC.
DimB accumulates during multicellular development
Polyclonal antibodies were raised against an N terminus-proximal and a C
terminus-proximal peptide of DimB and purified by affinity chromatography on
the respective peptide immunogen. The N terminus proximal-antibody recognises
DimB and a higher molecular weight species (data not shown), and was used only
to characterise potential null strains (see below). The C terminus-proximal
antibody was used in western transfer to obtain a developmental time course of
DimB accumulation (Fig. 7). The
only species recognised by this antibody is a protein of 70 kDa, the
approximate size of DimB. DimB is present at very low concentration at zero
hours, rises in concentration to the tight mound stage and then remains at a
relatively constant concentration throughout subsequent development.
|
Early development and culmination of the null strains appear normal but at the slug stage several differences from control, random-integrant slugs become apparent. The null strains form elongated slugs (Fig. 8B, upper). When control cells are spotted on agar and exposed to a dim unidirectional source, the slugs that are formed move towards the light source (Fig. 8B, lower). DimB-slugs do not leave the point of origin. Examination of the point of origin suggests that this is not caused by a failure to enter the migratory slug stage. It would appear to reflect a defect in the intrinsic ability of the slug to move.
Analysis of prestalk gene expression in the dimB- strain using cell type specific markers reveals no gross defects
In order to analyse total prestalk cell differentiation, a dimB-
strain and a random integrant strain were transformed with ecmAO:lacZ. After
development to the standing slug stage, the slugs were stained for
ß-galactosidase. A control and a mutant field, each containing three
slugs, is shown in Fig. 9.
These particular control and mutant slugs appear similar in the average
relative sizes of their prestalk regions. This conclusion is supported by
quantitative analysis of a larger number of slugs, but this revealed a higher
level of heterogeneity in the prestalk: prespore ratio in the mutant slug
population (explained in the legend to Fig.
9).
|
pspA:lacZ is, as expected, expressed in the rear of the slug and expression completely abuts the prestalk zone (Fig. 9). As in the control slugs, ecmA:lacZ is most highly expressed in the pstA region and ecmO:lacZ is expressed selectively in the pstO cells. The presence of a pstO zone is completely reproducible from slug to slug, and is of critical importance because it constitutes a clear difference from the dimA and dmtA null strains.
The ecmB:lacZ construct is expressed in a cone of pstAB cells within the
slug tip and in the group of pstB cells, situated close to the
prestalk-prespore boundary (Jermyn and
Williams, 1991
). Analysis of control and mutant ecmB:lacZ
transformants at culmination shows the expected pattern, with strong staining
in the stalk and the cups that cradle the spore head (data not shown).
Prestalk cell differentiation in the dimB- strain is subtly aberrant
The above results were obtained using cells developed under overhead light
and analysed at the standing slug stage. In addition, the staining times were
of 1-2 hours, by which time the enzymatic reactions for the ecmAO:lacZ
transformants were approaching a plateau. Using ecmAO:lacZ marked slugs
developed in the presence of a dim uni-directional light source, and with
shorter (c. 5-10 minutes) staining times, an anteroposterior gradient of
staining becomes apparent in the control
(Fig. 10). These short
staining times also show that staining in control slugs is stronger at the
periphery of the prestalk region than in the core. The dimB- slugs
display a very different pattern from the control slugs, their staining is
uniform throughout the prestalk region.
|
|
|
We also analysed cells that were rendered competent to respond to DIF-1 by allowing them to develop normally to the loose aggregate stage. After disaggregation, the cells were shaken in suspension with and without DIF-1 for 2 hours; ecmA expression was activated in the control cells but not in the dimB- cells (data not shown).
DIF-1 rapidly induces nuclear accumulation of DimB
In order to determine whether DIF-1 directly regulates DimB loose
aggregate, parental cells (data not shown) or tight aggregate stage cells
derived from the DIF-1 deficient mutant dmtA-
(Fig. 12) were exposed to
DIF-1 and subjected to immunohistochemical staining. Similar results were
obtained with both strains. There is a rise in nuclear staining, with a peak
three minutes after DIF-1 addition.
DimB associates with the ecmA promoter when cAMP-treated cells are induced with DIF-1
In order to determine whether DIF-1 induces DimB to bind to the
ecmA promoter in vivo, ChIP analysis was performed. In initial
experiments, cells dissociated at the loose aggregate stage were incubated for
several hours with cAMP, DIF-1 or cAMP and DIF-1. RT-PCR analysis was then
used to monitor ecmA expression. As was observed previously
(Berks and Kay, 1990
), a
combination of cAMP and DIF proved most effective and these conditions were
employed for the ChIP assay.
|
|
There was no enrichment when cAMP and DIF-1 were omitted (Fig. 13) and a lower, statistically non-significant degree of enrichment when either DIF-1 alone or cAMP alone was used (data not shown). Enrichment depended upon the presence of the DimB antibody; CudA antibody produced no enrichment (Fig. 13). In addition, there was no enrichment when dimB- cells were treated with cAMP and DIF-1 (Fig. 13).
|
| DISCUSSION |
|---|
|
|
|---|
The DimB binding site in R2 is required for expression in pstO and ALC
The region within R1 that is essential for DimB binding is contained within
the sequence CATCATC. Interestingly, a very similar sequence within the
promoter of the 7E gene, CATCACC, is essential for expression in pstA cells
and for repressing prestalk expression in prespore cells
(Seager et al., 2001
).
However, we did not analyse the R1 element functionally. Instead we determined
the biological function of the DimB binding site in R2.
|
|
Although it has become the standard pstA marker, construct O is weakly
expressed and is not totally specific; at extended times of staining it
displays a finite level of expression in pstO cells and ALC. By contrast,
construct S is highly specific to the pstA cells. This is manifest in a highly
foreshortened region of prestalk staining and in the almost complete lack of
expression in ALC. This expression pattern is, to our knowledge, novel.
However, it is in accord with a previous study that suggested that the pstO
cells and the ecmO:lacZ expressing ALC may be a unitary population
(Abe et al., 1994
). The fact
that construct S is efficiently and selectively expressed in pstA cells make
it a useful marker for future studies.
|
There is evidence that DIF-1 selectively induces pstO-specific gene
expression (Thompson et al.,
2004
; Thompson and Kay,
2000b
). Hence, the fact that pstO-specific expression is
eliminated by the four point mutations present in R2pM1S implies a role for
the -510 site in DIF-1 signalling. The corollary, that pstA expression is
unaffected by the four point mutations present in R2pM1S, is also in accord
with analyses of the DIF-1 deficient mutant dmtA-, which suggest that
pstA-specific gene expression uses a DIF-1-independent signalling pathway
(Thompson and Kay, 2000a
).
DimB establishes a gradient of ecmA gene expression in the slug tip
Analysis of the dimB-null mutant shows that a prespore marker and
the standard prestalk markers are expressed in a similar spatial pattern to
the control. The most telling result is the presence of an apparently normal
pstO region in the dimB-null strain. This is an important difference
from both the dmtA- and dimB- mutants, where there is a defect in
pstO cell differentiation. The dimB null does, however, show a more
subtle difference from the control.
In control slugs, there is both an anteroposterior and a radial gradient of ecmA expression, with their respective peaks at the tip and the slug exterior; this creates a thimble shaped cell grouping that ensheaths the prestalk region. These gradients are lost in the dimB- strain. Hence, DimB functions as a repressor that reduces ecmA expression in the more posteriorly and centrally located prestalk cells.
A similar ecmA:lacZ staining pattern has been described previously, again
for slugs migrating towards a dim unidirectional light source
(Jermyn and Williams, 1991
).
Interestingly, the pattern was absent when slugs were allowed to migrate under
overhead light (Jermyn and Williams,
1991
). Perhaps, therefore, exposure to a high light intensity
downregulates the repressive activity of DimB and disrupts the ecmA
expression gradient.
Functional implications of a gradient of DimB activity
EcmA is a major component of the slime sheath, the extracellular matrix
that surrounds the slug and a DimB activity gradient may help ensure that EcmA
is selectively synthesised in the region of the slug where it needs to be most
highly concentrated: i.e. at the surface. Slug movement is directed by the
tip, so if other genes needed for slug migration are modulated in a similar
manner to ecmA, disruption of their graded expression could account
for the lack of slug migration in the dimB- mutant.
Integration of the promoter and genetic analyses: does DimB function as a competitive inhibitor by binding to the site at -510?
It seems paradoxical that: (1) DimB should bind to the -510 site in vitro;
(2) mutation of the -510 site should prevent ecmA expression in pstO
and ALC; yet (3) the dimB- mutant should overexpress ecmA in
parts of the prestalk region. We believe that this can best be explained if
the -510 site is bound in vivo by two proteins: an, as yet unidentified,
activator; and DimB, functioning as a repressor. The relative occupancy of the
-510 site by these two proteins would establish the observed gradients of
expression in the prestalk region. One obvious candidate for the activator is
the previously mentioned MYB domain protein that binds to R2 but not R1 (M.F.
and J.G.W., unpublished).
DimB, DIF-1 and the regulation of ecmA gene expression
Analysis of the dimB- mutant provides a further apparent link
between DimB and DIF-1 signalling: the mutant is DIF-1 non-responsive in a
monolayer assay that measures induction of ecmA gene expression.
However, ecmA and cell-type specific markers derived from its
promoter are expressed during multicellular development of the dimB-
strain.
The monolayer result presumably reflects some limitation of the assay
system: deprived of cell-cell interactions and cell-matrix interactions, the
signalling inputs to a monolayer cell would be expected to be significantly
aberrant. The result can be explained by assuming that under monolayer
conditions dimB acts alone, either as a direct activator of
ecmA or as a factor needed to achieve DIF responsiveness. It implies
a second protein, which is conditionally redundant with DimB, that receives
signalling inputs from other cells and that fulfils these functions in normal
development. Nineteen bZIP proteins are encoded within the
Dictyostelium genome (Eichinger et
al., 2005
). Hence, there are abundant candidates for such a role.
The crucial issue is whether DIF-1 is the normal inducer in the whole organism
and here the biochemical evidence is very telling.
DIF-1 and the activation of DimB
Although the genetic evidence from monolayer cells appears to be
misleading, certainly as far as an obligate role for DimB in ecmA
expression, analysis of the behaviour of DimB establishes a clear link to
DIF-1 signalling. DimB rapidly accumulates in the nucleus when cells are
treated with DIF-1 and it becomes associated with the ecmA promoter
after cells are exposed to a combination of cAMP and DIF-1. Many
post-aggregative functions require that cells be continuously exposed to a
high concentration of cAMP (Kay,
1982
; Mehdy et al.,
1983
; Schaap and van Driel,
1985
; Berks and Kay, 1988). Hence, we favour the notion that cAMP
is also permissive rather than instructive in this instance.
Thus, we propose that DimB is induced by DIF-1 to accumulate in the nuclei
of a subset of the prestalk cells and that, by binding to the ecmA
promoter at the -510 site, DimB represses ecmA gene transcription.
How then is DimB activated by DIF-1? Dd-STATc provides a precedent for DIF-1
induced nuclear accumulation of a Dictyostelium protein. However, in
contrast to the STAT proteins, where there is a paradigm for activation, bZIP
proteins display varied activation mechanisms. Some, such as the mammalian
CREB protein, are constitutively nuclear and are activated as transcription
factors by serine or threonine phosphorylation
(Montminy, 1997
). Others, such
as the fission yeast protein Pap1, are regulated at the level of nuclear
export (Toone et al., 1998
).
There is, to our knowledge, no precedent for activation of a bZIP by a direct
tyrosine phosphorylation event of the kind that initiates the nuclear
accumulation of DdSTATc. Presumably, therefore, two wholly or partially
separate DIF-1 regulated signalling pathways activate these two different
transcription factors.
Note added in proof
During the course of the above study, we learnt that the same gene was
under investigation by Huang et al. (Huang
et al., 2005
). These authors identified DimB bio-informatically,
rather than biochemically, and they showed that it dimerises with DimA. The
two studies are in generally good accord and the differences in ecmA
expression patterns that are observed in the slug are probably explicable by
strain differences; they used strain Ax4, whereas we used Ax2.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, T., Early, A., Siegert, F., Weijer, C. and Williams, J.
(1994). Patterns of cell movement within the
Dictyostelium slug revealed by cell type-specific, surface labeling
of living cells. Cell
77,687
-699.[CrossRef][Medline]
Berks, M. and Kay, R. R. (1990). Combinatorial
control of cell differentiation by cAMP and DIF-1 during development of
Dictyostelium discoideum. Development
110,977
-984.
Ceccarelli, A., Zhukovskaya, N., Kawata, T., Bozzaro, S. and
Williams, J. (2000). Characterisation of a DNA sequence
element that directs Dictyostelium stalk cell-specific gene
expression. Differentiation
66,189
-196.[CrossRef][Medline]
Early, A. E., Gaskell, M. J., Traynor, D. and Williams, J.
G. (1993). Two distinct populations of prestalk cells within
the tip of the migratory Dictyostelium slug with differing fates at
culmination. Development
118,353
-362.[Abstract]
Early, A., Abe, T. and Williams, J. (1995).
Evidence for positional differentiation of prestalk cells and for a
morphogenetic gradient in Dictyostelium. Cell
83, 91-99.[CrossRef][Medline]
Eichinger, L., Pachebat, J. A., Glockner, G., Rajandream, M. A.,
Sucgang, R., Berriman, M., Song, J., Olsen, R., Szafranski, Ku, Q. et al.
(2005). The genome of the social amoeba Dictyostelium
discoideum. Nature 435,43
-57.[CrossRef][Medline]
Fujii, Y., Shimizu, T., Toda, T., Yanagida. M. and Hakoshima,
T. (2000). Structural basis for the diversity of DNA
recognition by bZIP transcription factors. Nat. Struct.
Biol. 7,889
-893.[CrossRef][Medline]
Fukuzawa, M., Hopper, N. and Williams, J.
(1997). cudA: A Dictyostelium gene with pleiotropic
effects on cellular differentiation and slug behaviour.
Development 124,2719
-2728.[Abstract]
Hai, T. and Hartman, M. G. (2001). The
molecular biology and nomenclature of the activating transcription factor/cAMP
responsive element binding family of transcription factors: Activating
transcription factor proteins and homeostasis. Gene
273, 1-11.[CrossRef][Medline]
Huang, E., Blagg, S. L., Keller, T., Katoh, M., Shaulsky, G. and
Thompson, C. R. L. (2005). bZIP transcription factor
interactions regulate DIF responses in Dictyostelium.Development 133,449
-458.
Jakoby, M., Weisshaar, B., Drage-Laser, W., Vicente-Carbajosa,
J., Tiedemann, J., Kroj, T. and Parcy, F. (2002). bZIP
transcription factors in Arabidopsis. Trends Plant
Sci. 7,106
-111.[CrossRef][Medline]
Jermyn, K. A. and Williams, J. G. (1991). An
analysis of culmination in Dictyostelium using prestalk and
stalk-specific cell autonomous markers. Development
111,779
-787.[Abstract]
Kawata, T., Early, A and Williams, J. G.
(1996). Evidence that a combined activator-repressor protein
regulates Dictyostelium stalk cell differentiation. EMBO
J. 15,3085
-3092.[Medline]
Kay, R. R. (1982). cAMP and spore
differentiation in Dictyostelium discoideum. Proc. Natl. Acad. Sci.
USA 79,3228
-3231.
Kay, R. R. (1998). The biosynthesis of
differentiation-inducing factor, a chlorinated signal molecule regulating
Dictyostelium development. J. Biol. Chem.
273,2669
-2675.
Maeda, M., Sakamoto, H., Iranfar, N., Fuller, D., Maruo, T.,
Ogihara, S., Morio, T., Urushihara, H., Tanaka, Y. and Loomis, W. F.
(2003). Changing patterns of gene expression in
Dictyostelium prestalk cell subtypes recognized by in situ
hybridization with genes from microarray analysis. Eukaryot.
Cell 2,627
-637.
Mehdy, M. C., Ratner, D. and Firtel, R. A.
(1983). Induction and modulation of cell-type specific gene
expression in Dictyostelium. Cell
32,763
-771.[CrossRef][Medline]
Montminy, M. (1997). Transcriptional regulation
by cyclic AMP. Annu. Rev. Biochem.
66,807
-822.[CrossRef][Medline]
Nellen, W., Silan, C. and Firtel, R. A. (1984).
DNA-mediated transformation in Dictyostelium discoideum: regulated
expression of an actin gene fusion. Mol. Cell. Biol.
4,2890
-2898.
Pears, C. J. and Williams, J. G. (1988).
Multiple copies of a G-rich element upstream of a cAMP-inducible
Dictyostelium gene are necessary but not sufficient for efficient
gene expression. Nucleic Acids Res.
16,8467
-8486.
Poels, J. and Broeck, J. V. (2004). Insect
basic leucine zipper proteins and their role in cyclic amp-dependent
regulation of gene expression. Int. Rev. Cytol.
241,277
-309.[Medline]
Schaap, P. and van Driel, R. (1985). Induction
of post-aggregative differentiation in Dictyostelium discoideum by cAMP.
Evidence for the involvement of the cell surface cAMP receptor.
Exp. Cell Res. 159,388
-398.[CrossRef][Medline]
Seager, J. H. J., Stevens, B. A., McCaffery, I. and Hames, B.
D. (2001). Identification of novel elements which regulate
the cell-type specificity of Dictyostelium 7E gene expression.
Differentiation 68,22
-30.[CrossRef][Medline]
Thompson, C. R. L. and Kay, R. R. (2000a).
Cell-fate choice in Dictyostelium: intrinsic biases modulate
sensitivity to DIF signaling. Dev. Biol.
227, 56-64.[CrossRef][Medline]
Thompson, C. R. L. and Kay, R. R. (2000b). The
role of DIF-1 signaling in Dictyostelium development. Mol.
Cell 6,1509
-1514.[CrossRef][Medline]
Thompson, C. R. L., Fu, Q., Buhay, C., Kay, R. R. and Shaulsky,
G. (2004). A bZIP/bRLZ transcription factor required for DIF
signaling in Dictyostelium. Development
131,513
-523.
Toone, W. M., Kuge, S., Samuels, M., Morgan, B. A., Toda, T. and
Jones, N. (1998). Regulation of the fission yeast
transcription factor Pap1 by oxidative stress: requirement for the nuclear
export factor Crm1 (Exportin) and the stress-activated MAP kinase Sty1/Spc1.
Genes Dev. 12,1453
-1463.
Vauti, F., Morandini, P., Blusch, J., Sachse, A. and Nellen,
W. (1990). Regulation of the discoidin-Igamma-gene in
Dictyostelium discoideum - identification of individual promoter
elements mediating induction of transcription and repression by cyclic AMP.
Mol. Cell. Biol. 10,4080
-4088.
Williams, J. G., Ceccarelli, A., McRobbie, S., Mahbubani, H.,
Kay, R. R., Farly, A., Berks, M. and Jermyn, K. A. (1987).
Direct induction of Dictyostelium prestalk gene expression by DIF
provides evidence that DIF is a morphogen. Cell
49,185
-192.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
J. Langenick, T. Araki, Y. Yamada, and J. G. Williams A Dictyostelium homologue of the metazoan Cbl proteins regulates STAT signalling J. Cell Sci., November 1, 2008; 121(21): 3524 - 3530. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yamada, H. Y. Wang, M. Fukuzawa, G. J. Barton, and J. G. Williams A new family of transcription factors Development, September 15, 2008; 135(18): 3093 - 3101. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Keller and C. R. L. Thompson Cell type specificity of a diffusible inducer is determined by a GATA family transcription factor Development, May 1, 2008; 135(9): 1635 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Araki, J. Langenick, M. Gamper, R. A. Firtel, and J. G. Williams Evidence that DIF-1 and hyper-osmotic stress activate a Dictyostelium STAT by inhibiting a specific protein tyrosine phosphatase Development, April 1, 2008; 135(7): 1347 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Lam, A. Kosta, M.-F. Luciani, and P. Golstein The Inositol 1,4,5-Trisphosphate Receptor Is Required to Signal Autophagic Cell Death Mol. Biol. Cell, February 1, 2008; 19(2): 691 - 700. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. West, H. van der Wel, and Z. A. Wang Prolyl 4-hydroxylase-1 mediates O2 signaling during development of Dictyostelium Development, September 15, 2007; 134(18): 3349 - 3358. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fukuzawa, N. V. Zhukovskaya, Y. Yamada, T. Araki, and J. G. Williams Regulation of Dictyostelium prestalk-specific gene expression by a SHAQKY family MYB transcription factor Development, May 1, 2006; 133(9): 1715 - 1724. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Huang, S. L. Blagg, T. Keller, M. Katoh, G. Shaulsky, and C. R. L. Thompson bZIP transcription factor interactions regulate DIF responses in Dictyostelium Development, February 1, 2006; 133(3): 449 - 458. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||