|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 January 2006
doi: 10.1242/dev.02251
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Institut de Biologie du Développement de Marseille (IBDM) Laboratoire
de Génétique et de Physiologie du Développement (LGPD),
UMR6545 CNRS-Université de la Méditerrannée. Campus de
Luminy case 907, Marseille 13288 cedex9, France.
2 Plateforme de microscopie électronique, IBDM, France.
* Author for correspondence (e-mail: lecuit{at}ibdm.univ-mrs.fr)
Accepted 14 December 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Cellularisation, Nuclear envelope, Epithelial morphogenesis, dappled, RNAi, Microarrays, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
As with most developing embryos, the first morphogenetic process in
Drosophila embryos is the formation of the primary epithelium, a
process called cellularisation (Foe et al.,
1993
; Schejter and Wieschaus,
1993b
). Cellularisation is a specialised form of embryonic
cleavage that yields a polarised epithelium within 1 hour
(Lecuit, 2004
). Upon egg
laying, the newly fertilised embryo undergoes a series of 13 synchronous
nuclear divisions in a syncytium, producing about 6000 nuclei at the cell
cortex. During cellularisation, the plasma membrane invaginates in a slow
phase and a fast phase between the nuclei, thus packaging each nucleus, other
organelles and cytoskeletal elements into about 6000 cells
(Lecuit and Wieschaus, 2000
).
Cellularisation involves the polarised growth of the plasma membrane via the
vectorial transport of vesicles through the Golgi and recycling endosomes and
their insertion at specific sites of the plasma membrane
(Lecuit and Wieschaus, 2000
;
Papoulas et al., 2005
;
Pelissier et al., 2003
;
Sisson et al., 2000
). Distinct
plasma membrane domains are already established by this time. Polarised growth
culminates in the formation of apical adherens junctions at the end of
cellularisation and their subsequent stabilisation during gastrulation
(Muller and Bossinger, 2003
).
Failure to form or stabilise apical junctions results in strong epithelial
defects later on during gastrulation (Cox
et al., 1996
; Muller and
Wieschaus, 1996
; Tepass et
al., 1996
; Uemura et al.,
1996
). In addition, the formation of the primary epithelium
involves the polarised organisation of the cytoskeleton and organelles.
Microtubules (MTs) form an apicobasal network, with subpopulations of long MTs
extending the plus ends basally around the nuclei and short MTs projecting
towards the cortex. MTs control the apicobasal distribution of organelles, the
nuclei being anchored apically, the Golgi apparatus mostly basal and lipid
droplets undergoing basal and apical movements in two successive waves called
clearing and clouding phases (Foe et al.,
1993
; Schejter and Wieschaus,
1993b
; Sisson et al.,
2000
; Welte et al.,
1998
). The formation of the primary epithelium thus offers a good
system with which to address how core cellular processes are developmentally
regulated to produce a highly organised tissue exhibiting polarity at the cell
surface and in the cytoplasm.
Cellularisation is concomitant with zygotic genome activation and
inhibition of zygotic transcription totally blocks cellularisation
(Foe et al., 1993
). However,
only five zygotic genes have been reported for their role in cellularisation:
nullo, Serendipity-
(Sry-
) and slam,
which are necessary for stabilisation of the membrane front called the furrow
canal; bottleneck (bnk), which ensures the correct timing of
basal closure of the cells; and frühstart (frs),
required for the arrest in interphase 14
(Grosshans et al., 2003
;
Lecuit et al., 2002
;
Postner and Wieschaus, 1994
;
Rose and Wieschaus, 1992
;
Schejter and Wieschaus, 1993a
;
Schweisguth et al., 1990
;
Stein et al., 2002
).
Remarkably, these five genes are strongly induced during cellularisation. The
fact that the expression of nullo, Sry-
, bnk, frs and
slam display a strong zygotic induction in cellularisation prompted
us to screen for other genes induced during and required for
cellularisation.
It has become a major challenge to integrate into a global cellular
network, the distinct pathways underlying the numerous aspects of epithelial
polarity. Functional genomic approaches based on RNA interference (RNAi),
mostly in Caenorhabditis elegans embryos and Drosophila
cells, have contributed to the identification of many genes involved in
cellular organisation, based on their knock-down phenotype
(Boutros et al., 2004
;
Fraser et al., 2000
;
Gonczy et al., 2000
;
Kamath et al., 2003
;
Kiger et al., 2003
;
Sonnichsen et al., 2005
). The
major advantage of such RNAi screens is the direct association of a gene to a
given biological function. Novel approaches using expression profiling have
also proven successful in identifying genes whose expression correlates with
specific cellular processes (Arbeitman et
al., 2002
; Stathopoulos et
al., 2002
; White et al.,
1999
). Here, we have sought to combine such genomic methodologies
and functional screens to extend the repertoire of genes involved in
epithelial architecture. The screen was performed in early Drosophila
embryos. Instead of screening the full genome in a blind fashion, we have
first established the repertoire of genes induced during Drosophila
epithelial formation and subsequently tested their role by RNAi in early
embryos. We could thus test a selected and limited group of genes making it
possible to assess their function more thoroughly using time-lapse
recordings.
This screen uncovered new genes required for various aspects of cellularisation. One of them, charleston (char), on which we focus most of this study, controls nuclear morphogenesis in epithelial cells. In char-depleted embryos, lateral constraints that elongate the nuclei along the apicobasal axis are disrupted and the nuclei round up. In addition, the nuclei lose their apical anchoring. Together, these nuclear defects distort the regular columnar organisation of epithelial cells in the gastrula. Char localises at the nuclear envelope via a lipid anchor and plays a structural role in nuclear morphogenesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
CSIM and UAS-dpld (dpldEP1050 and
dpldEP2291 EP lines) males were crossed to
mat(Tub-Gal4VP16 (67c); mat(Tub-Gal4VP16 (15) (67;15) females and
raised at 18°C. A ru1 klarsicht1 fly stock
(gift from M. Welte) was used for injected embryos shown in Fig. S4 (see
supplementary material) to reveal the gastrulation defects better.
Constructs
UAS-HA-Char
A HA3-CG5175 chimera cDNA (N-terminal HA tag in 3 copies, inserted in frame
after the second AUG of CG5175) was generated by PCR (positions 158-1870 of
the cDNA AY094778 in GenBank). The PCR fragment digested by EcoRI was
inserted into pUAS-T generating pUAS-T-HA-Char.
UAS-HA-Char
CSIM
We mutagenised the pUAS-T-HA-Char vector to introduce a TGA stop codon in
place of the TGC (cystidine at amino acid C567). This modification results in
the deletion of the last four (CSIM) C-terminal amino acids. All constructs
were sequenced.
Microarray experiments
Thirty minute egg collections of OreR and yw flies at
25°C were aged at room temperature (RT) according to the different
temporal classes T0-T4. Embryos were dechorionated with 50% bleach, put on a
cover slip and covered with Halocarbon oil 27 (Sigma). Embryos of the
appropriate stage were manually selected under the dissecting scope. Selected
embryos were transferred to a basket, rinsed with PBS with 0.7% NaCl, 0.04%
triton-X100 and placed on ice in the Trizol solution (GibcoBRL). Trizol
extraction of total RNA was performed according to the manufacturer's
instructions. The quantification was assessed by OD, and the quality on
agarose gel. Three independent pools of 25 µg of total RNA, for each
time-point, were sent to Affymetrix (Illkirch, FRANCE) for hybridisation on
Release 2 microarrays. Microarray data analysis was performed with Windows
Excel and TreeView and Cluster (Eisen laboratory) softwares.
Clustering was performed using hierarchical clustering with average linkage using the Cluster software (information available upon request: pilot{at}ibdm.univ-mrs.fr). For the clusters shown in Fig. 1B-D, a list of genes with potential high variations of expression was first selected from Table S1A (see supplementary material) using the following criteria: at least three present (P) assignments among the 15 values (three independent experiments for each of the five time points); a maximal value among the 15 values of more than 200; and a standard deviation of more than 100 among the 15 values.
dsRNA synthesis
The 500 bp PCR products of the selected genes were from the `Heidelberg
GenomeRNAi Drosophila resources'.
A second probe for dappled was made by PCR amplification of genomic DNA (nucleotides 1978 to 2665 of the transcript AY060421, GenBank) with the following pair of primers containing the sequence of the T7 promoter (TAATACGACTCACTATAGGGAGACCAC): dpld-T7-F, T7seq GCTCTTGATTGGGAACTCAATGG; and dpld-T7-R, T7seq CGTTGATGTCTGGATCAATCAGG.
A second probe targeted against the 3'UTR of char was made by PCR amplification of genomic DNA (between positions +5 to +366, 3' of the stop codon) with the following set of primers: char3'UTR-T7-F, T7seq CAGGCCAGACCACATAATACC; and char3'UTR-T7-R, T7seq GCGAAACAATACATGAACTCGGC.
Transcription from the T7 promoters was performed with Ambion MEGAscript or Promega Ribomax kits. dsRNA were resuspended in DEPC-treated water, quantified by OD, checked on agarose gel and diluted for RNAi at about 3-4 µM in DEPC-treated water.
RNAi screen
Embryos from 30 minute egg-collections of OreR and yw
flies at 25°C were dechorionated in 50% bleach, aligned on agar, stuck on
heptane-glued cover slips, dessicated and covered with Halocarbon 200 oil.
Embryos were injected with dsRNA, stored at 25°C. Phase-contrast
time-lapse images were collected on an inverted microscope (Zeiss) and a
programmable motorised stage to record different positions over time
(Mark&Find module from Zeiss). The system was run with AxioVision software
(Zeiss). At least 40 timelapse movies from two independent injection series
were performed for each dsRNA probe. Embryos were then let to develop at room
temperature. Control embryos for RNAi were non-injected embryos [DIC control
for char, halo and btsz in
Fig. 3, Fig. S2 and Fig. S4
(see supplementary material)] or injected embryos with DEPC-treated water (all
other cases).
RT-PCR
RNAi efficiency was estimated by measuring endogenous mRNA levels using
RT-PCR after injection of dsRNA probe against dpld. Total RNA
extraction from early gastrulating embryos, retro-transcription and PCR
reactions were adapted from (Desbordes and
Sanson, 2003
). Primers used were dpld-T7-F and
dpld-T7-R for dpld and actin42-F
(ACTCCTACATATTTCCATAAA) and actin42-R (CTCCAGGGACGAGCTTGAA) for
Actin 42A. PCR were performed on four sample dilutions for control
and RNAi embryos (1:1; 1:3; 1:9; 1:27), with 30 amplification cycles. In these
conditions, the amount of PCR products correlated to the cDNA input. cDNA
contents between control and RNAi embryos were normalised to actin
42A PCR products. A threefold depletion of dpld cDNA was
observed in dpld RNAi embryos compared with control embryos. Similar
experiments were performed for btsz RNAi. A fourfold depletion was
observed for btsz in btsz RNAi embryos (F.P., J.-M.P., C.L.
and T.L., unpublished). RT-PCR specific to the CG5175/char-RA and
CG5175/char-RB transcripts was performed in early embryos using the
following primers (see Fig. S4): CG5175-AF, AGGTCCCACTAGCGCGTTG; CG5175-BF,
AAGCTTCAGACTTGAATGTGTGC; and CG5175-CR, GGGAACTTCAGCTACCACCAC.
Farnesyl-transferase inhibitor experiments
Injections of FTI-277
Embryos were injected with FTI-277 at a final concentration of 10-20 µM
[injection of 1 mM FTI-277 (Sigma) in early embryos (about 30 minutes old
after egg laying)]. This produced a very penetrant (>95%)
char-like phenotype. Injection shortly before cellularisation (during
cycles 10-12) produced a milder and less penetrant phenotype. Embryos were
then imaged for time-lapse recordings or fixed and stained as indicated for
RNAi.
Cell culture experiments with FTI-277
S2 cells were cultured in Schneider's medium (Sigma) containing 10% FBS
(foetal bovine serum) and maintained at 25°C. Cells were co-transfected
with pUAS-T constructs and pMt-Gal4-VP16 vector using Fugene 6 (Roche)
according to the manufacturer's instructions. Transfected cells were analysed
after 24 hours of cDNA expression induced with 0.5 mM CuSO4 and
incubation with FTI-277 at different concentrations (10 to 40 µM). The
cells were lysed 30 minutes at 4°C in NET buffer (50 mM Tris pH 7.5, 400
mM NaCl, 5 mM EDTA, 1% NP40 supplemented with anti-protease). The lysates were
clarified by centrifugation and analysed by western blot after SDS-PAGE. Rat
anti-HA (Roche) was used at a 1/2000 concentration and revealed by anti-rat
HRP and Lumi-Light Western Blotting Substrate (Roche).
GST pull down
Transfected Drosophila S2 cells were washed in cold PBS and lysed
in buffer A (1% NP-40, 50 mM Tris pH 7.5, 10 mM EDTA, 3 mM MgCl2
supplemented with pepstatin, leupeptin and antipain 1 µg ml-1,
benzamidine 15 µg ml-1, 1 mM sodium orthovanadate and 5 mM
sodium pyrophosphate). The lysates were clarified by centrifugation, incubated
with 50-70 µg of GST and GST fusion protein coated on Gluthatione Sepharose
4B beads (Amersham Biosciences) overnight at 4°C. After washes, the
protein complexes were analysed by western blot after SDS-PAGE. Rat anti-HA
(Roche) was used at a 1/2000 concentration.
Antibody production against Char
An antibody against the peptide EEVDVEEEQ was generated in rabbits
(Eurogenetec). The serum was affinity purified against the peptide.
Immunofluorescent and chemofluorescent staining
Staining of non-injected embryos was carried out on overnight collections
at 25°C. After dechorionation with bleach, embryos were fixed for 20
minutes in 4% formaldehyde (HA, Lamin, WGA and Char staining) and
devitellinised by methanol popping. Injected embryos were prepared as
described above and fixed during cellularisation. Embryos were fixed in 4%
formaldehyde as described above (Lamin, PatJ and Bodipy staining) or in 17%
formaldehyde (
- and
-tubulin staining) or heat-fixed in 10 ml of
boiling HF buffer (68 mM NaCl, 0.03% Triton X100) and rapidly cooled with ice
and cold HF buffer (Neurotactin staining). In general, embryos were then
rinsed with methanol and transferred in BBT (PBS, 0.1% Tween-20, 0.1% BSA,
0.01% NaN3). For Bodiby and phalloidin labelling, however, the embryos were
directly transferred to BBT. Injected embryos were then hand-peeled in BBT.
Antibody staining was performed in BBT (Neurotactin, Patj,
- and
-tubulin) or in BBTx (PBS, 0,1% BSA, 0,1% Triton X-100) (HA, Lamin and
Char) at the following concentrations: mouse Neurotactin BP106, 1/50
(Developmental Study of Hybridoma Bank, DSHB); guinea pig even-skipped, 1/100
(gift of J. Reinitz and D. Kosman); mouse
- and
-tubulin, 1/200
(Sigma); mouse HA 12CA5, 1/200 (Roche); rabbit Char, 1/100; mouse Lamin
ADL67.10, 1/200 (DSHB); rabbit PatJ (previously known as Dlt, gift of H.
Bellen and M. Bhat), 1/300. Secondary antibodies were conjugated to Alexa488,
Alexa546 and Cy5. Bodipy 505/515 (Molecular Probes) was used for lipid
staining at 100 µM (from a DMSO stock at 10 mM) for 20 minutes. Nuclear
staining was made with Hoechst 33258 (Sigma) at 0.2 µg/ml for 20 minutes
and F-actin staining with TRITC-conjugated phalloidin (Sigma) at 1:500 for 20
minutes. All confocal images were obtained on a Zeiss LSM510 laser-scanning
microscope using a 40x C-Apochromat water immersion objective (NA: 1,2)
except for high resolution images in Fig.
9C-D' where a 63x (NA: 1.4) oil immersion objective
was used on a Leica SP2-NE confocal microsocope.
Immunofluorescence of S2 cells with triton or digitonin permeabilisation
S2 cells were fixed in 3% PFA for 25 minutes, and permeabilised with either
0.1% TritonX-100 for 10 minutes at room temperature, or 5 minutes with 40
µg/ml Digitonin in PBS at 4°C. After saturation with 0.2% gelatin in
PBS for 30 minutes, S2 cells were incubated with primary antibodies following
standard procedures
ImmunoEM
Early embryos were fixed with 8% PFA in heptane, and after the vitelline
membrane was removed by methanol popping, washed and incubated back in PBS
with 0.1% BSA. They were then pelletted in 2% agarose in PBS to better
visualise the position of embryos in the resin bloc. The structure was very
poorly preserved with sucrose embedding and freeze substitution. We obtained
better results with progressive low temperature dehydration without sucrose.
Embryos were dehydrated in methanol series as follows: 50% at 0°C, 70% at
-20°C, 90% at -30°C and 100% at -50°C for 30 minutes each time.
Embryos were then embedded in Lowicryl resin (HM20) at -50°C using a Leica
AFS device. After polymerisation with UV light at -50°C for 36 hours,
ultrathin (80 nm) sections were cut with an ultramicrotome (RMC Mtx),
deposited on nickel grids for subsequent staining. The sections were first
rehydrated in PBS for 5 minutes at room temperature, blocked with 5% goat
serum in PBS for 15 minutes and incubated with the primary antibodies
(monoclonal mouse anti HA, 12CA5, Roche, 1/20; or monoclonal mouse anti
Lamin/Dm0 1/10, DSHB) overnight at 4°C. After 3 washes (5 minutes each) in
PBS, sections were incubated with the secondary antibody (goat anti mouse
coupled to colloidal gold particles, 15 nm, Aurion) for 1 hour, washed and the
reaction was finally fixed in PBS with 2% glutaraldehyde. Sections were
eventually imaged in a Zeiss EM 912 electron microscope and the image acquired
with a CCD camera (Gatan Bioscan).
| RESULTS |
|---|
|
|
|---|
, bnk, slam and frs in particular
are specifically induced during T1 in agreement with in situ hybridisation
data (Fig. 1C,D,
Fig. 2; see Tables S1A-C in the
supplementary material) (Grosshans et al.,
2003
|
We selected from these 2160 genes for functional screening. We applied a number of stringent criteria to yield a reasonable set of genes to be tested. We first focused on genes whose expression during cellularisation (T1 or T2) was at least four times higher than the maternal contribution (T0). Some of them were downregulated later on, but a number showed a sustained expression during gastrulation. Indeed we expected that genes involved in polarity or adhesion could have a prolonged requirement and expression during gastrulation. However, we excluded transcription factors, in order to find direct regulators of epithelial formation and polarisation. Finally, we preferentially selected genes with a low maternal contribution, in order to optimise functional studies by RNAi. Using these criteria, we selected 57 novel genes, which are distributed in three main clusters corresponding to different times of peak expression (Fig. 2).
Functional RNAi screen
RNA interference is a very powerful reverse genetics method for the
functional dissection of cellular or developmental processes
(Boutros et al., 2004
;
Echard et al., 2004
;
Eggert et al., 2004
;
Foley and O'Farrell, 2004
;
Fraser et al., 2000
;
Gonczy et al., 2000
;
Kamath et al., 2003
;
Kiger et al., 2003
;
Lum et al., 2003
;
Sonnichsen et al., 2005
). We
have used this approach to test the function of the 57 selected genes one by
one. Freshly laid embryos were injected with in vitro synthesised dsRNA probes
and subsequently screened by time-lapse phase contrast (DIC) microscopy during
cellularisation and early gastrulation. An automated system allowed the
acquisition of time-lapse data in up to 20 embryos in 2 hours. We could follow
with DIC microscopy the coordination of cellularisation with arrest of the
cell cycle in interphase 14, nuclear elongation and positioning, lipid
droplets transport, membrane invagination and junction integrity through the
stability of the newly formed epithelium during gastrulation. Hatching rate
(see Table S3 in the supplementary material) and stages of developmental
arrest during embryogenesis were also assessed. We recovered striking
phenotypes mostly associated with intracellular organisation, falling into
five phenotypic classes.
|
Nuclear morphogenesis and anchoring
RNAi to CG5175 leads to an abnormal nuclear behaviour during
cellularisation. In control embryos, after the nuclei have elongated along the
apicobasal axis, they remain properly aligned until the end of
cellularisation. However, in CG5175 RNAi embryos, the nuclei elongate
normally but when the membrane invagination front reaches the basal part of
the nuclei, the nuclei lose their proper apical alignment and fall from the
cortex following an abnormal apicobasal `dancing' movement (hence the name
char) (Fig. 3A-D). At
the end of cellularisation, the epithelium adopts a very abnormal
organisation, owing to changes in the morphology and position of the nuclei at
the cortex. This phenotype is also observed in char mutants (see
below).
Membrane invagination and cortical organisation
kelch RNAi embryos exhibit, albeit at a low frequency (7%,
n=88), a broad range of defects at the beginning of cellularisation,
including falling of some nuclei from the cortex, a reduction of nuclear
elongation and defects in membrane invagination during cellularisation (not
shown). Kelch is an actin-binding protein consisting of a BTB/POZ domain and
kelch repeats. This phenotype is consistent with the known role of actin in
membrane invagination and nuclear anchoring
(Foe and Alberts, 1983
).
Junction stabilisation
We also uncovered defects in the organisation of the epithelium at the end
of cellularisation. RNAi against CG14858/bitesize
(btsz), a gene also implicated in growth control
(Serano and Rubin, 2003
),
produces a fully penetrant arrest of gastrulation in that the epithelium no
longer elongates along the anteroposterior axis (see Fig. S3 in the
supplementary material). This developmental arrest is due to a collapse of the
epithelium (not shown). Epithelial cells lose their columnar organisation and
become mesenchymal. Different non-overlapping probes produce this phenotype.
RT-PCR experiments show that btsz is indeed downregulated after RNAi
using these different probes. Finally, the phenotype is rescued when
btsz is overexpressed in RNAi embryos (F.P., J.-M.P., C.L. and T.L.,
unpublished).
In addition to cellularisation and gastrulation phenotypes, we also noticed
late epithelial embryonic defects following RNAi against Lachesin.
Lachesin RNAi led to a fully penetrant lethality associated with profound
defects in the development of the tracheal epithelial tubes. Similar
epithelial defects were observed in Lac mutants (34 homozygote mutant
embryos). Characterisation of Lachesin involvement in tracheal
development has been reported since then
(Llimargas et al., 2004
).
We shall focus in the following part on char, a new regulator of nuclear morphogenesis important for epithelial organisation in the embryonic epithelium.
|
300 µm2 to
600
µm2), as in control embryos. A similar, albeit slightly weaker, nuclear phenotype is observed in char mutant embryos (charEY0769: 40%, n=45 of the embryos from homozygous parents). charEY0769 is a hypomorphic char allele resulting from a P-element insertion in the intron of one of the two char isoforms (that only differ in the 5'UTR sequence, see Fig. S4 in the supplementary material). RT-PCR experiments reveal that one of the two char isoforms is removed in charEY0769 mutant embryos (Fig. S4), resulting in lower expression of char transcripts. In embryos homozygous for a deficiency that completely removes the zygotic contribution of char, we also see a clear phenotype (Fig. 7D,F; Dfchar: 30%, n=55 of the embryos from heterozygous parents). A similar phenotype is also observed in Dfchar/charEY0769 embryos (see Fig. S5 in the supplementary material, embryos from homozygous charEY0769 females crossed to heterozygous Dfchar/+ males, 40%, n=40).
Several lines of evidence show that char is, as expected from its induction during cellularisation, required zygotically, although we can also detect a maternal effect. Twenty percent (n=85) of embryos laid by Dfchar/charEY0769 females crossed to OreR control males display a nuclear phenotype. In addition, 55% of the embryos now display the mutant phenotype when the same females are crossed to homozygous charEY0769 males (n=74). Finally, all embryos are wild type when OreR females are crossed to homozygous charEY0769 males (0% mutant phenotype, n=68).
The expression of Char is strongly reduced in Dfchar mutant embryos (see Fig. 7A-F), the remaining low levels of Char in deficiency embryos derives from the maternally produced Char. Char is not detected in char RNAi embryos, suggesting that RNAi to char inhibits both the maternal and zygotic contributions, explaining the stronger nuclear phenotype observed in such embryos.
|
Together, these data suggest that Char constrains nuclear shape along the apicobasal axis in order to maintain the regular columnar morphology of cells during gastrulation.
Nuclear envelope association with microtubules and centrosomes in char RNAi embryos
Cytoskeletal elements, in particular microtubules, control the localisation
and morphology of the nuclei. Actin or microtubule depolymerisation produces
defects in apical nuclear anchoring during cellularisation
(Fig. 5A)
(Foe et al., 1993
;
Schejter and Wieschaus,
1993b
). Moreover, the nuclei also round up when microtubules are
depolymerised (not shown). Defects observed in char-depleted embryos
thus suggested that Char might regulate actin or microtubules. However,
phalloidin staining did not reveal any defect in cortical actin organisation
in char RNAi embryos (not shown). Moreover, serial confocal sections
of embryos stained with an antibody to
-tubulin also revealed no
apparent defect in the apicobasal organisation of MTs. In the wild type,
astral MTs extend from the centrosomes towards the apical surface
(Fig. 5B,D,I) and form a dense
apical network (Fig. 5B).
Another population of MTs extends basally surrounding the nuclei and in tight
association with the NE (Fig.
5B). This population of MTs is believed to constrain nuclear
shape. Grazing sections show that both apical astral MTs
(Fig. 5D,E,E') and the
tight association between MTs and the NE (section z3 in
Fig. 5E and E', and
Fig. 5E'') are, however,
normal in char RNAi embryos.
|
Strikingly, even before nuclei can be seen to fall from the cortex, in
char RNAi embryos the centrosomes (labelled with
-tubulin),
are not properly aligned apically and do not show a tight association with the
NE, unlike in control embryos (Fig.
6A,B). This defect becomes stronger as the nuclei fall out
(Fig. 6B' and B'') and at the end of cellularisation, the dissociation between centrosomes and
nuclei is very pronounced. We noticed that most of the times only one
centrosome is dissociated from the NE, reflecting a possible difference
between the two centrosomes at this stage. The fact that the centrosome defect
is observed before the nuclei fall out, argues that Char may primarily control
the organisation of the NE, thereby affecting its interaction with
centrosomes. Our data thus argue that the nuclear fall-out phenotype stems
from a disruption of this interaction, and not the opposite.
We conclude that Char controls nuclear morphology of the NE, as well as its surface properties, which are required for its interaction with centrosomes. To gain further insight into the mechanism of Char function, we looked at its subcellular localisation.
Char is farnesylated and membrane anchored at the NE
Char is a 570 amino acid protein with a Coiled-coil domain (amino acids
143-190) and a farnesylation site (CSIM motif) at the C terminus.
Farnesylation is commonly used to anchor a protein in a phospholipid bilayer,
such as the NE (Zhang and Casey,
1996
). For example, Lamin (also known as Dm0), which accumulates
at the inner nuclear membrane, is farnesylated
(Mounkes et al., 2003
).
Antibodies raised against a C-terminal peptide of Char reveal a striking
localisation of Char at the NE in early embryos and all other developmental
stages inspected (Fig. 7A; data
not shown). This distinct localisation is lost in char RNAi embryos
and is greatly reduced in embryos bearing a deficiency for char
(Dfchar), in which maternally expressed Char is present
(Fig. 7A-F).
Char localisation at the NE supports our conclusion that Char controls
early nuclear morphology and the interaction between the NE and centrosomes.
We tested the possibility that Char is farnesylated and that this may be
essential for its localisation at the NE and, as a result, for its function.
We first checked that Char is anchored via its farnesylation group by
comparing the localisation of HA-tagged full length Char (at the N terminus,
HA-Char) and a form of Char devoid of the CSIM farnesylation motif
(HA-Char
CSIM). These proteins were expressed in early embryos. HA-Char
localises at the NE like the endogenous protein
(Fig. 8A). By contrast,
HA-Char
CSIM is almost completely removed from the NE and
correspondingly accumulates in the cytoplasm and the nucleoplasm
(Fig. 8B). This suggests that
the farnesylation motif is required for proper nuclear localisation of Char.
In order to show more directly that Char is farnesylated, we treated S2 cells
expressing HA-Char with increasing concentrations of the farnesyl-transferase
inhibitor FTI-277 (10-40 µM). In contrast to cells not exposed to FTI-277,
after 24 hours exposure to this inhibitor, HA-Char appears on western blot as
a doublet (Fig. 8C, left). As
the concentration of FTI-277 increases, the faster migrating fraction
(Fig. 8C, lower band, arrow)
increases with respect to the slower fraction (upper band). The fast migrating
fraction represents non-farnesylated HA-Char as HA-Char
CSIM migrates at
the same position irrespective of the presence of FTI-277
(Fig. 8C, right). We conclude
that Char is farnesylated.
|
|
Char is localised at the inner nuclear membrane together with Lamin
The nuclear envelope is composed of an inner and an outer membrane.
Farnesylation can potentially anchor protein to either membrane. For example,
Lamin/Dm0, is farnesylated and localises to the inner membrane.
High-resolution confocal imaging reveals that Char co-localises with Lamin at
the NE (Fig. 9A,B), suggesting
that Char may in part localise to the inner membrane. To further test this, we
compared the localisation of Char and wheat germ agglutinin (WGA), a marker of
the nuclear pores. Char (red) and WGA (green) co-localise
(Fig. 9C-D', arrowheads)
but Char is also clearly detected alone in a more internal region of the NE
(Fig. 9C-D', arrows).
These data argue that Char localises in the inner nuclear membrane of the NE,
and possibly also in the outer membrane. We confirmed this using
immunoelectron microscopy (IEM) to localise HA-Char and Lamin. The NE was
identified at the boundary between the cytoplasm and the nucleoplasm that have
different electron densities (Fig.
9E). Quantification of immunogold particles to localise HA-tagged
Char and Lamin revealed a striking enrichment of both HA-Char (70%,
n=127) and Lamin (65%, n=26) at the NE, although a fraction
is also present in the nucleoplasm (20 and 30% respectively)
(Fig. 9E,H). We determined the
position of the Lamin and HA-Char gold particles with respect to the NE at the
boundary between the nucleoplasm and cytoplasm, and find a clear bias towards
the nucleoplasmic side of the NE for both proteins
(Fig. 9F-H). We point out that
Lamin and Char have very similar distributions.
|
Together we conclude that Char is localised strictly at the inner nuclear membrane. Char and Lamin share similar localisations and targeting mechanisms. The localisation of Char at the inner nuclear membrane suggests that Char participates in the organisation of a robust nucleoskeleton that is able to structure the nuclear envelope in tightly packed epithelial cells in response to microtubules.
| DISCUSSION |
|---|
|
|
|---|
Efficiency of the functional screen
Although standard genetic screens have proven very powerful to identify
many genes required for Drosophila embryonic development using static
pictures of development such as the morphology of the cuticle, it has long
been appreciated that such blind approaches could not be used to screen
systematically dynamic developmental processes using time-lapse recordings.
However, aneuploid screens have proven a very good alternative to find purely
zygotic loci whose deletion produces strong phenotypes during early
development (Merrill et al.,
1988
; Wieschaus and Sweeton,
1988
). Many loci originally identified have been cloned
(Lecuit et al., 2002
;
Postner and Wieschaus, 1994
;
Rose and Wieschaus, 1992
;
Schejter and Wieschaus, 1993a
;
Schweisguth et al., 1990
;
Stein et al., 2002
). In some
cases, however, cloning approaches have been difficult, and some loci remain
uncloned.
To try to overcome these difficulties, we developed an alternative approach combining accurate gene expression profiling of early development and a functional screen using RNAi. We here present exhaustive and accurate expression profiles of the whole genome with a high temporal resolution allowing us to select a limited number of genes with a higher chance of being functionally required than would offer a blind screen. This selection allowed us to conduct a very accurate time-lapse assessment of phenotypes, with the possibility of scoring directly a broad range of defects during cellularisation and gastrulation. A large time-lapse data set was collected to carefully analyse and quantify even subtle phenotypes (e.g. a mild reduction in membrane invagination). In practice, over 10% (6/57) of the genes tested indeed showed a striking phenotype. Apart from kelch, we focussed only on very penetrant phenotypes (>80%).
|
Although MTs control nuclear morphogenesis, we also showed that, to our surprise, the function of Char is independent of MTs interaction with the NE. When Char is depleted, MTs still bind properly to the NE (Fig. 5). This suggests that, although necessary, MTs are not sufficient to constrain nuclear morphogenesis and that Char is required to let MTs shape the NE properly.
What are the mechanisms of Char function? The earliest defects observed when char is downregulated are an absence of infolding of the NE together with a dissociation of the NE with the centrosomes. Later, the nuclei lose their elongated and constrained morphology, round up, fall from the cortex and consequently distort cell shape. The sequence of events, as the phenotype unfolds, thus points to a direct role of Char at the NE. In agreement with this, we show that Char localises at the inner nuclear membrane of the NE and that farnesylation of Char provides a lipid anchor required for its localisation and for its function. This suggests two possible mechanisms. Char may directly control the structural organisation of the NE and thereby indirectly affect attachment to centrosomes. Alternatively, Char may primarily regulate centrosome-NE interaction. The fact that Char affects NE morphogenesis and is localised at the inner nuclear membrane together with Lamin, supports the former possibility and argues that Char is a component of a nucleoskeleton required to respond to MTs in the inner nuclear membrane. Supporting the idea that Char may form a structural scaffold at the inner NE, immunofluorescence labelling with a Char antibody reveals small protein clusters (Fig. 9B, top inset) that are also evident and more striking in immunogold labelling (Fig. 9F). Interestingly, we found that HA-Char can be pulled down on GST-Char beads (using GST-pull down assays, see Fig. S6 in the supplementary material) arguing that multiple Char proteins can form a complex. This could contribute to the scaffolding properties of Char as for Lamins, which are known top dimerize.
The char phenotype is also reminiscent of the
unc-83/unc-84 and zyg-12 phenotypes of C. elegans
embryos. UNC-83 and UNC-84 localise to the NE and ensure the correct
positioning of the nuclei, probably via interactions with MTs
(Gruenbaum et al., 2005
;
Starr et al., 2001
). ZYG-12
localises to the centrosomes and the NE and controls the attachment of the
centrosomes to the male pronucleus. ZYG-12 interacts with a dynein chain
(DLI-1) (Malone et al., 2003
).
No functional orthologues of unc-83/-84 and
zyg-12 have been described in Drosophila. However,
Lis1 and Klarsicht, both of which regulate Dynein, have been implicated in
nuclear positioning, in particular during eye imaginal disc morphogenesis but
not in early embryos (Guo et al.,
2005
; Mosley-Bishop et al.,
1999
; Swan et al.,
1999
; Welte et al.,
1998
). Interestingly, the inactivation of Dynein during
cellularisation after injection of blocking antibodies causes a phenotype
partly reminiscent of char loss of function, in that the nuclei round
up and lose their apical alignment
(Papoulas et al., 2005
) (John
Sisson, personal communication). Moreover, centrosome-NE attachment is also
compromised in dynein mutant embryos
(Robinson et al., 1999
). We
propose that the role of Char in NE organisation provides a link with such a
machinery. Although char does not appear to regulate microtubules
interaction with the NE, the membrane association of Char may indeed control
the assembly of a structural scaffold that indirectly couples to microtubules
across the NE. Analogous to the morphogenesis of the plasma membrane, where
membrane associated proteins form large scaffolds that couple the internal
actin filaments to external matrix proteins, Char may link the structural
protein Lamin inside the nucleus to `external', cytoplasmic microtubules. This
mechanism may also explain how the polarised organisation of microtubules
directs the polarised constrained morphology of nuclei controlled by Char.
Determining the structural link between the outer nuclear membrane to which
MTs bind and the inner nuclear membrane where Char and Lamin structure the NE
will require the identification of Char molecular partners and of other genes
with similar phenotypes. Interestingly, after injection of
-amanitin
(an inhibitor of pol-II transcription and hence of zygotic induction) prior to
cellularisation, the nuclei display a typical char-like phenotype but
the association of MTs with the NE is lost (T.L., unpublished), indicating
that other zygotic genes control the link between MT and NE morphogenesis.
Cellularisation thus provides a particularly interesting system with which to
study the developmental control of nuclear morphogenesis.
A broad family of diseases called laminopathies are caused by defects in
the organisation of the NE in vertebrates
(Gruenbaum et al., 2005
;
Mounkes et al., 2003
).
Identifying molecular partners of Char and genes required for NE morphogenesis
may thus shed light on the developmental pathway underlying NE in
Drosophila and on these poorly understood diseases.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/133/4/711/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Arbeitman, M. N., Furlong, E. E., Imam, F., Johnson, E., Null,
B. H., Baker, B. S., Krasnow, M. A., Scott, M. P., Davis, R. W. and White, K.
P. (2002). Gene expression during the life cycle of
Drosophila melanogaster. Science
297,2270
-2275.
Boutros, M., Kiger, A. A., Armknecht, S., Kerr, K., Hild, M.,
Koch, B., Haas, S. A., Consortium, H. F., Paro, R. and Perrimon, N.
(2004). Genome-wide RNAi analysis of growth and viability in
Drosophila cells. Science
303,832
-835.
Cox, R. T., Kirkpatrick, C. and Peifer, M.
(1996). Armadillo is required for adherens junction assembly,
cell polarity, and morphogenesis during Drosophila embryogenesis.
J. Cell Biol. 134,133
-148.
Desbordes, S. C. and Sanson, B. (2003). The
glypican Dally-like is required for Hedgehog signalling in the embryonic
epidermis of Drosophila. Development
130,6245
-6255.
Echard, A., Hickson, G. R., Foley, E. and O'Farrell, P. H. (2004). Terminal cytokinesis events uncovered after an RNAi screen. Curr. Biol. 14,1685 -1693.[CrossRef][Medline]
Eggert, U. S., Kiger, A. A., Richter, C., Perlman, Z. E., Perrimon, N., Mitchison, T. J. and Field, C. M. (2004). Parallel chemical genetic and genome-wide RNAi screens identify cytokinesis inhibitors and targets. PLoS Biol. 2, E379.
Foe, V., Odell, G. and Edgar, B. (1993). Mitosis and morphogenesis in the Drosophila embryo: point and counterpoint. In The Development of Drosophila melanogaster, vol. 1 (ed. A. Martinez Arias and M. Bate), pp. 149-300. New York: Cold Spring Harbor Laboratory Press.
Foe, V. E. and Alberts, B. M. (1983). Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J. Cell Sci. 61,31 -70.[Abstract]
Foley, E. and O'Farrell, P. H. (2004). Functional dissection of an innate immune response by a genome-wide RNAi screen. PLoS Biol. 2,E203 .[CrossRef][Medline]
Fraser, A. G., Kamath, R. S., Zipperlen, P., Martinez-Campos, M., Sohrmann, M. and Ahringer, J. (2000). Functional genomic analysis of C. elegans chromosome I by systematic RNA interference. Nature 408,325 -330.[CrossRef][Medline]
Gonczy, P., Echeverri, C., Oegema, K., Coulson, A., Jones, S. J., Copley, R. R., Duperon, J., Oegema, J., Brehm, M., Cassin, E. et al. (2000). Functional genomic analysis of cell division in C. elegans using RNAi of genes on chromosome III. Nature 408,331 -336.[CrossRef][Medline]
Gross, S. P., Welte, M. A., Block, S. M. and Wieschaus, E.
F. (2000). Dynein-mediated cargo transport in vivo. A switch
controls travel distance. J. Cell Biol.
148,945
-956.
Gross, S. P., Welte, M. A., Block, S. M. and Wieschaus, E.
F. (2002). Coordination of opposite-polarity microtubule
motors. J. Cell Biol.
156,715
-724.
Gross, S. P., Guo, Y., Martinez, J. E. and Welte, M. A. (2003). A determinant for directionality of organelle transport in Drosophila embryos. Curr. Biol. 13,1660 -1668.[CrossRef]