|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 February 2006
doi: 10.1242/dev.02245
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Genetics and Howard Hughes Medical Institute, Harvard Medical
School, 77 Avenue Louis Pasteur, Boston, MA 02115, USA.
2 Developmental Genetics Program and the Department of Cell Biology, The
Skirball Institute of Biomolecular Medicine, New York University Medical
Center, New York, NY 10016, USA.
* Author for correspondence (e-mail: cepko{at}genetics.med.harvard.edu)
Accepted 13 December 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Neural development, Retina, Cell fate, Notch, Photoreceptor
| INTRODUCTION |
|---|
|
|
|---|
The retina offers many advantages for the dissection of the roles of a
molecule such as Notch. Retinal development is relatively well characterized.
The vertebrate retina is an exquisitely light-sensitive tissue capable of
transducing the signal from a single photon into a neural stimulus. Moreover,
it performs sophisticated information transformations that begin the process
of vision. To perform these functions, it requires the correct stochiometric
production of seven major cell types during development. Retinal ganglion
cells, horizontal cells, rod and cone photoreceptor cells, amacrine cells,
bipolar cells, and Muller glial cells arise from multipotent RPCs in a
conserved order during development (reviewed by
Altshuler et al., 1991
).
Birthdating studies in the mouse have shown that retinal ganglion cells are
the first-born cell type, whereas rods, bipolar interneurons and Muller glial
cells are the late-born cell types
(Sidman, 1961
;
Young, 1985
).
Although, there is considerable overlap in the generation of the various
cell types, there are a limited number of cell fates available to the daughter
of an RPC at any given time. For example, while extrinsic factors can alter
the ratio of the various cell types produced at one time point (reviewed by
Levine et al., 2000
),
heterochronic mixing experiments have established that progenitor cells from a
particular time in development cannot be induced to generate temporally
inappropriate cell types (Belliveau and
Cepko, 1999
; Belliveau et al.,
2000
; Rapaport et al.,
2001
). The logic of these observations can be accommodated by the
competence model of retinal development
(Cepko et al., 1996
;
Livesey and Cepko, 2001
). This
model proposes that progenitor cells progress through temporal states; in any
particular state, the progenitor is competent to produce only a subset of
retinal cell types. A predicted consequence of the competence model is that
the failure to maintain RPCs would result in the generation of early born cell
types, but not the later born cell types, as progenitor cells would be
prematurely depleted and unavailable for the production of later born cell
types.
Several gain- and loss-of-function studies of the Notch pathway in the
developing retina have suggested a crucial role for this pathway in
controlling progenitor multipotency as well as proliferation and apoptosis
(Ahmad et al., 1997
;
Ahmad et al., 1995
;
Austin et al., 1995
;
Bao and Cepko, 1997
;
Dorsky et al., 1997
;
Dorsky et al., 1995
;
Furukawa et al., 2000
;
Henrique et al., 1997
;
Lindsell et al., 1996
;
Scheer et al., 2001
;
Silva et al., 2003
;
Waid and McLoon, 1998
).
Expression analysis have further established that Notch1 and
Notch3 are both expressed in the developing central retina, whereas
Notch2 is expressed in the peripheral retina and the retinal
pigmented epithelium (Bao and Cepko,
1997
; Lindsell et al.,
1996
). In chick embryos, reduction of Notch1 levels in the early
retina enhanced production of the first born retinal cell type the
retinal ganglion cell. In that study, it was also determined that a high
percentage of retinal progenitors were competent to adopt the retinal ganglion
cell fate, and that Notch signaling was limiting in permitting ganglion cell
production (Austin et al.,
1995
). In complementary studies, the Notch pathway was
constitutively activated, which led cells to adopt an undifferentiated
progenitor-like state (Dorsky et al.,
1995
). In fish and rodent, these progenitor-like cells have glial
properties, suggesting that Notch1 also may be regulating the glial versus
neuronal cell fate decision (Furukawa et
al., 2000
; Scheer et al.,
2001
).
Some of the downstream effectors of Notch signaling have been described;
the most notable of which is the Hes gene family
(Iso et al., 2003
). This class
of basic helix-loop-helix (bHLH) genes are homologous to Drosophila
hairy and Enhancer of split E(spl). In both vertebrates and
invertebrates, these transcription factors are known to mediate at least a
subset of Notch signaling activities. Evidence for the relationship between
Notch1, Hes1 and Hes5 in the retina is supported by misexpression experiments
in which these negative bHLH proteins are sufficient to promote the Muller
glial/late progenitor-like fate at the expense of neurons
(Furukawa et al., 2000
;
Hojo et al., 2000
;
Takatsuka et al., 2004
).
Interestingly, these negative bHLHs do not re-capitulate all of the effects
observed with constitutive Notch activation. It was found in the rat retina
that activated Notch led to glial formation, concomitant with
hyperproliferation, while Hes1 misexpression directed glial formation without
promoting proliferation (Furukawa et al.,
2000
). These data suggest that Notch1 activation engages as yet
unidentified downstream effectors, in addition to Hes gene family members.
Null alleles in Hes1 and Hes5 have been generated in mice
and analyzed for retinal defects. Hes5-null retinae have normal
retinal size and morphology, but display a 30-40% reduction in Muller glial
cell production relative to wild-type littermates
(Hojo et al., 2000
).
Hes1-null mice are more severely affected
(Tomita et al., 1996
). These
retinae are reduced in size and full of abnormal rosettes. Cell fates in these
retinae were dramatically altered as there was an increase in early born cell
types, such as retinal ganglion cells, horizontal cells and amacrine cells,
and a decrease in the later born Muller glial cells
(Takatsuka et al., 2004
;
Tomita et al., 1996
).
Furthermore, horizontal and photoreceptor cell markers were prematurely
expressed. Together, the loss-of-function experiments suggest that Notch-Hes
signaling is important for the maintenance of a pool of progenitor cells and
the acquisition of the glial fate.
The above data support a model in which Notch1 is expressed by RPCs of each competence state. Notch signaling allows cells to remain undifferentiated and continue proliferating, and progenitor cells downregulate Notch activity in order to produce a postmitotic cell that becomes a neuron. We directly tested this model by conditionally inactivating Notch1 at different times in murine retinal development. Notch1 was found to be crucial for multiple aspects of development, including regulating organ size, morphogenesis and cell fate decisions. Consistent with the competence model, ablating Notch1 early led to enhanced production of an early-born cell type, whereas eliminating Notch1 later led to production of a later born cell type. Surprisingly, progenitors in which Notch1 is deleted do not simply produce all neuronal fates available in their competence state; they predominantly produce the rod or cone photoreceptor fates. These unexpected results demonstrate a crucial role for Notch signaling in inhibiting the photoreceptor fate, and suggest a broader role for Notch signaling in not only inhibiting the neuronal fate, but also in selectively biasing production of one neuronal cell type over another.
| MATERIALS AND METHODS |
|---|
|
|
|---|
In vitro and in vivo retroviral infection and BrdU incorporation
In vitro infection was performed on dissected retinae grown as explants on
top of polycarbonate filters in 12-well culture plates with media. The media
consisted of 45% DMEM, 45% F12 medium and 10% fetal calf serum (FCS). The
retina was immediately infected with virus diluted in a 5 µl droplet of
media. In vivo infection was performed by injecting 0.5 µl of highly
concentrated virus into the subretinal space of P0 or P3 mice. Mice were
allowed to develop for 2-4 weeks before processing. Freshly dissected retinae
were cultured with media containing BrdU for 1 hour at 37°C. Labeled cells
were detected according to the manufacturer's instructions (Roche).
Replication incompetent retrovirus production
Myc-tagged cre recombinase (T. Matsuda and C.L.C., unpublished) was cloned
directly into the retroviral expression construct pNIN
(Dyer and Cepko, 2001a
). Virus
was produced and concentrated as described
(Cepko et al., 1998
).
Microarray hybridization and analysis
RNA was purified from mouse retinal tissue by Trizol extraction (GIBCO).
cDNA was prepared from RNA essentially as described
(Tietjen et al., 2003
). In
brief, DNA was reverse transcribed from RNA with reverse transcriptase (GIBCO)
and a polyT primer (TATAGAATTCGCGGCCGCTCGCGAT(24)) (Oligos etc.). PolyA
tailing was achieved with terminal transferase (TdT, Roche). DNA was
subsequently amplified by PCR using the polyT primer and LA-Taq DNA polymerase
(Takara). Between 16 and 22 cycles of PCR amplification was used to obtain the
necessary amount of DNA still within the linear range of amplification. For
microarray hybridization, cDNAs were labeled by incorporation of Cy3- or
Cy5-dCTP (Amersham-Pharmacia). Pairs of labeled probes were hybridized at
42°C overnight microarrays consisting of clones from the Brain Molecular
Anatomy Project clone set (kind gift of Dr Bento Soares) and additional clones
of interest from the laboratory (Livesey
et al., 2004
). Slides were washed extensively
(Young and Cepko, 2004
) before
scanning in an Axon GenePix 4000B Scanner (Axon Instruments). Data images were
retrieved and analyzed using the GenePix software package (Axon
Instruments).
In situ hybridization and immunohistochemistry
All tissue sections were prepared by equilibrating retinae in 30%
sucrose/PBS at 4°C, followed by equilibration in a 1:1 mix of 30%
sucrose/PBS and OCT and finally embedded in OCT. All sections were 20 µm.
For immunostaining, sections were hydrated in PBS and then blocked in 5% goat
serum in 0.1% Triton X-100/PBS (PBST). Primary antibody was applied for 2
hours at room temperature, followed by three PBST washes and secondary
antibody incubation at room temperature for 2 hours. Antibodies used were:
anti-ß-tubulin III (mouse monoclonal, 1:200, Upstate), anti-RMO 270.7
directed against low-molecular weight neurofilament
(Carden et al., 1987
) and goat
anti-mouse or goat anti-rabbit Cy3 or Cy5 (Jackson Immunoresearch Laboratory
1:200). Cells were counterstained with DAPI and washed several times. For
alkaline phosphatase staining, retinal tissue was harvested and fixed with 4%
PFA/PBS for 15 minutes at room temperature. After extensive washing in PBS,
endogenous alkaline phosphatase activity was heat inactivated by placing the
tissue at 65°C for 1 hour. Retinae were then stained as whole mounts for
1-4 hours at room temperature (Fekete and
Cepko, 1993
). For X-gal staining, retinal tissue was harvested and
fixed with a 1% PFA/0.5% glutaraldehyde mix as described
(Kwan et al., 2001
). Retinae
were stained as whole mounts overnight at 37°C. Section in situ
hybridization was performed on retinal cryosections as described
(Chen and Cepko, 2002
). The
following probes were used: Crx (Furukawa
et al., 1997
), Otx2 (Ang et
al., 1994
), NeuroD1 (Morrow et
al., 1999
), S-opsin and M-opsin
(Corbo and Cepko, 2005
), and
genes listed below in the GenBank Accession Numbers section. All images were
taken on a Nikon Eclipse E1000 microscope using a Leica DC200 digital camera.
For further descriptions see also
http://www.stjude.org/faculty/0,2512,407_2030_10417,00.html.
GenBank Accession Numbers
PNR, BC017521; NRL, BF464350; islet 1, AI845893;
NF-L, BE953485; Hes1, BI557608; Hes5, BE952148;
Hey1, AI851652; Chx10, BF461223; Delta-like 1, AW047187;
Math3, AI846749; clusterin, BE996359; p57, BF464158;
Pax6, BE953199; Notch1, BE981557.
| RESULTS |
|---|
|
|
|---|
E10. The Chx10-CRE line has been
shown to have cre activity beginning around the onset of Chx10
expression (Rowan and Cepko,
2004
As Notch signaling is known to have cell-autonomous and cell non-autonomous
effects on cell proliferation and apoptosis
(Artavanis-Tsakonas et al.,
1999
), it was unclear whether the reduction in retinal size was
due to a cell autonomous reduction in Notch1 in proliferating progenitors or
to a cell non-autonomous effect. To distinguish between these possibilities,
Notch1 flox/flox retinae were explanted at E14.5 and infected with a
low titer replication incompetent retrovirus encoding nuclear
ß-galactosidase without (NIN) or with cre recombinase (NIN-CRE). Retinae
were allowed to grow as explants for 10 days and then processed for
ß-galactosidase histochemical detection using X-gal. Single clones were
easily identified as patches of X-gal+ cells, which were assayed for clone
size (Fig. 1C). NIN-infected
control clones varied from 1-52 cells per clone, with an average of
5.9±1.3 cells per clone. By contrast, NIN-CRE infected clones ranged
from 1-28 cells per clone, with an average of 3.7±0.6 cells per clone.
There was a slight increase in 1-3 and 4-6 cell clones, and a slight decrease
in 7-9 and greater than 10 cell clones, in NIN-CRE versus NIN clones
(Fig. 1D). The overall
reduction in clone size in the Notch1-deleted progenitors suggests
that cell-autonomous effects account for at least some aspects of progenitor
cell proliferation.
Notch1 deficient progenitors differentiate prematurely
To better understand the early events that may have contributed to the
abnormal retinal morphology and size observed in Notch1-null adult
mice, Notch1-deficient mice were examined at embryonic timepoints. In
the course of using the Chx10-CRE transgenic mice, variable levels of
CRE activity have been observed (Rowan and
Cepko, 2004
). As a result, variable degrees of the mutant
phenotype were observed depending on the percentage of cells with deletion of
Notch1. To track the degree of cre recombinase activity more precisely and
fate map the individual cells in which Notch1 was probably deleted,
the R26R cre reporter allele
(Soriano, 1999
) was crossed
into the Chx10-CRE; Notch1 flox/flox mice
(Fig. 2A). Retinae from mutant
mice with a very high percentage of X-gal+ cells were consistently very small
in size and highly rosetted as early as E13.5. Mutant retinae with a much
lower percentage of X-gal+ cells were more wild type in size and displayed
normal lamination.
|
|
|
A decrease in Notch signaling, as well as in expression of progenitor cell markers, might be due to a depletion of RPCs resulting from cell death or precocious neurogenesis. To distinguish between these possibilities, expression of markers of neuronal differentiation, as well as proneuronal genes, were examined. The Notch ligand, Delta-like 1 (Dll1) (Fig. 3I,M), and proneuronal bHLHs Hes6, Neurod1 and Math3 were significantly upregulated in the CKO retinae (Fig. 3J-P). Interestingly, expression profiling and in situ hybridization (data not shown) failed to detect a change in Math5, a proneuronal bHLH that is essential for ganglion cell production. To examine cell death, TUNEL staining was performed on CKO versus wild-type retinae at early stages (E12.5 and E13.5) and later stages (P4 and P10). No differences in TUNEL labeling were observed (data not shown). Together, these data are consistent with an increase in neurogenesis in Notch1-deficient retinae, probably as a consequence of progenitor cells producing a higher ratio of postmitotic to mitotic progeny, relative to control retinae.
|
Microarray analysis was carried out on CKO versus wild-type E13.5 mouse
retinae to determine more broadly the molecular changes that resulted from
deleting Notch1 (Fig. 4B).
Consistent with in situ hybridization analysis, components of the Notch
pathway (Notch1, Hey1) as well as progenitor markers (cyclin D1,
Fgf15, Sfrp2) were lower in mutant retinae
(Fig. 4C). In addition, higher
levels of the proneuronal bHLHs Neurod1 and Math3 were seen.
Consistent with the dissociated cell immunostaining analysis, there were lower
levels of the retinal ganglion cell markers, islet 1 and Gap43. By
contrast, higher levels of the photoreceptor transcription factors
Crx and Otx2, and of the photoreceptor specific gene cone
transducin
were observed (Fig.
4D).
To confirm these results, in situ hybridization was carried out on E13.5
Notch1 mutant retinae with the photoreceptor genes, Otx2 and
Crx (Fig. 5A,B,E,F),
and retinal ganglion cell markers, neurofilament light (NF-L; Nefl
Mouse Genome Informatics) and islet 1
(Fig. 5C,D,G,H). As predicted
by the microarray results, a significant increase in photoreceptor markers
concomitant with a decrease in retinal ganglion cell markers were observed.
Thyroid hormone receptor ß 2 and retinoid x receptor gene
are two
additional genes involved in early photoreceptor development
(Forrest et al., 2002
;
Hoover et al., 1998
). Both of
these genes were also observed to be upregulated in Notch1 CKO
retinae at E13.5 by in situ hybridization (data not shown). These data suggest
that enhanced neurogenesis in E13.5 Notch1-deficient retinae included
an increased production of photoreceptors. Interestingly, not all early-born
neurons were increased; in fact, there was a decrease in expression of retinal
ganglion cell markers.
As previous data in other species had suggested that reduction of the Notch
pathway would result in enhanced production of neuronal cell types, and in
particular of the first-born retinal ganglion cell
(Austin et al., 1995
), the
early requirement for Notch1 in the mouse was further determined by breeding
floxed Notch1 mice to mice expressing cre recombinase under the
Foxg1 promoter (Hebert and
McConnell, 2000
). Foxg1 is a winged helix transcription
factor that proceeds Chx10 expression in the retina. Fate-mapping
experiments have determined that Foxg1 descendants are uniformly
labeled in the nasal embryonic retina
(Hebert and McConnell, 2000
;
Pratt et al., 2004
). Deletion
of Notch1 in Foxg1-CRE expressing cells therefore should
exclude the timing or variable expression of Chx10-CRE as a potential
explanation for why photoreceptor production is enhanced, while ganglion cell
production is reduced.
To confirm that the loss of Notch1 reduces progenitor status and
enhances neurogenesis, in situ hybridization was carried out on E13.5
Notch1 flox/flox; Foxg1-CRE mutant retinae for cyclin D1 and
Dll1. As predicted, cyclin D1 expression
(Fig. 5I,M) was reduced,
whereas Dll1 expression was enhanced (data not shown). In situ
hybridization was next performed for the photoreceptor genes Otx2 and
Crx and retinal ganglion cell markers, Nefl and islet 1.
Both photoreceptor genes were upregulated
(Fig. 5J,N and not shown),
whereas both ganglion cell genes were downregulated
(Fig. 5K,L,O,P). These data
further corroborate a requirement for Notch1 in the production of retinal
ganglion cells. The Notch1 flox/flox; Foxg1-CRE mice are
perinatal lethal (Mason et al.,
2005
) and so later developmental aspects of Notch signaling were
examined only in the Notch1 flox/flox; Chx10-CRE mice.
|
To test for a similar requirement for Notch1 in the retina, the fates of X-gal+, presumed Notch1-/-, cells in the fully formed P15 retina were determined. The wild-type littermate retinae revealed X-gal+ cells contributing to all of the cellular layers (Fig. 6A,D). By contrast, X-gal+ cells contributed only to a subset of the mature retinal cell layers in the Notch1 mutants (Fig. 6B,E). In CKO retinae with a very high level of X-gal+ cells, abnormal morphology precluded proper identification of the cell types that were fate mapped (Fig. 6C,F). By contrast, a lower expression of cre recombinase in some Notch1 mutants led to a more normal retinal morphology and size (Fig. 6B,E). In these mice, X-gal staining was most prominent in the scleral region of the outer nuclear layer. Staining was observed also in the scleral portion of the inner nuclear layer, and/or possibly in the outer plexiform layer, and in a subset of cells in the ganglion cell layer. The staining in the scleral region of the outer nuclear layer is most consistent with cone photoreceptor cells. These data suggest that Notch1 deficient progenitors predominantly give rise to cone photoreceptor cells at the expense of all other cell types.
|
|
Deletion of Notch1 in postnatal retinal progenitors promotes rod photoreceptor production
To probe whether late RPCs require Notch1 for proper cell fate
determination, Notch1 was clonally inactivated in postnatal day 0
(P0) and postnatal day 3 (P3) Notch1 flox/flox mice. Newborn or 3 day
old mice were injected with a retrovirus encoding alkaline phosphatase without
(LIA) or with cre recombinase (LIA-CRE). Retinae were harvested and processed
for alkaline phosphatase staining after two or more weeks of development. At
these stages, retinal cell fate decisions are complete and the fates of
infected cells can be readily identified by alkaline phosphatase staining
(Fig. 8A) (Fields-Berry et al., 1992
;
Turner and Cepko, 1987
).
When P0 retinae were infected with LIA virus, the cells labeled were 80% rod photoreceptor cells, 2% amacrine cells, 13% bipolar interneurons and 5% Muller glial cells. By contrast, infection with LIA-CRE virus resulted in 93% rod photoreceptor cells, 2% amacrine cells, 5% bipolar interneurons and 0% Muller glial cells (Fig. 8B). Similarly, infection of the P3 retina with LIA-CRE led to enhanced rod photoreceptor production from 78% to 93%. Again, this occurred at the expense of other cell types, as bipolar interneurons decreased from 11% to 3% and Muller glial cell production was reduced from 10% to 1% (Fig. 8C). Furthermore, the percentage of clones with more than one cell consisting of only rods increased from 37% (LIA) to 76% (LIA-CRE) in clones initiated at P0 and from 32% (LIA) to 69% (LIA-CRE) in clones initiated at P3. Clones of more than one cell are those in which viral integration occurred in a cell that went on to divide at least once more; these clones tend to be more diverse in terms of cell type, and thus are a more sensitive indicator of an effect of loss of Notch1 on cell fate decisions.
| DISCUSSION |
|---|
|
|
|---|
Chx10 driven expression of cre recombinase most probably
eliminates Notch1 between E11 and E12
(Rowan and Cepko, 2004
),
coincident with the first Notch1 expression observed by in situ
hybridization in the mouse retina (data not shown). By E13.5, in situ
hybridization and microarray analysis showed a reduction in early progenitor
markers, such as Fgf15 and cyclin D1, and BrdU incorporation at E14.5
revealed a decrease in proliferating cells. Understanding which genes are
directly sensitive to Notch signaling will be crucial to furthering our
understanding of how Notch influences progenitor cells. Clonal inactivation of
Notch1 revealed that cell-autonomous effects account for at least some of the
retinal size defects. The known Notch targets, Hes1, Hes5 or
Hey1, may account partly for the reduction in size, as well as the
morphological defects. Hes1 null mice have severely reduced retinal
size and form rosettes (Tomita et al.,
1996
). However, we were unable to detect a reduction in
Hes1 mRNA in the Notch1-deficient retinae at E13.5 by in
situ hybridization and microarray analysis. By contrast, both Hey1
and Hes5 were reduced in the microarray analysis, and these genes
also may be partially responsible for the reduction in size. Further
clarification may require compound inactivation of both Notch1 and Hes family
members. Interestingly, previous experiments examining the status of Hes genes
in Notch1-deficient mice also have shown that some Hes genes are
sensitive to Notch signaling whereas others are not
(de la Pompa et al., 1997
;
Lutolf et al., 2002
). For
example, En1-CRE mediated excision of Notch1 led to a
reduction of Hes5, but not Hes1, in the ventral cerebellum
(Lutolf et al., 2002
).
|
Surprisingly, we found that not all early-born cell fates were enhanced in the mature retina at P15. In fact, markers for all retinal cell types were dramatically reduced, except for the markers of cone photoreceptor cells. As precociously produced neurons can be eliminated by apoptosis, we checked for early neuronal markers at E13.5 by gene profiling and in situ hybridization. These approaches showed that both the proneuronal bHLH genes, Math3 and Neurod1 as well as early photoreceptor genes, Otx2 and Crx, were upregulated. By contrast, the early ganglion cell markers, Gap43, islet 1 and Nefl, were downregulated. Similar in situ hybridization results were observed when Notch1 was deleted by cre driven by the earlier expressed and uniformly acting Foxg1 promoter. Furthermore, TUNEL staining revealed no differences in cell death in the wild-type and CKO retinae at E12.5 and E13.5. A reduction of ß-tubulin III and Nfel-positive cells on dissociated E14.5 CKO retinae further confirmed a loss of retinal ganglion cells and other non-photoreceptor neuronal cells. Together, these data suggest that ganglion cell production is significantly reduced in the absence of Notch1.
The reasons for overproduction of ganglion cells in the chick following
Notch1 knockdown, versus cone photoreceptor cell overproduction in
the mouse following removal of Notch1, are not clear. However,
overproduction of photoreceptor cells was also observed in Xenopus
when Delta1 was misexpressed at early and late timepoints
(Dorsky et al., 1997
).
Presumably, cells overexpressing Delta1, which were surrounded by
wild-type cells, escaped Notch inhibition through negative feedback.
Interestingly, the Delta1-expressing cells predominantly became or
produced photoreceptor cells, even though other cell fates were available at
both timepoints tested. When Delta1 was misexpressed early (16-cell stage),
retinal ganglion cell production increased slightly, whereas cone
photoreceptor production increased dramatically from
7% to
61% at
the expense of other cell types, including the early-born amacrine and
horizontal cells. When Delta1 was introduced at stage 18, rod and cone
photoreceptor production increased dramatically from
26% to greater than
50% at the expense of both bipolar and Muller glial cells
(Dorsky et al., 1997
).
Similarly, addition of the
secretase inhibitor DAPT in the early
developing chick retina led to a significant increase in visinin positive
photoreceptor cells (Kubo et al.,
2005
). By contrast, introduction of a dominant negative form of
Delta1 led to enhanced production of ganglion and amacrine cells at the
expense of photoreceptor cells in both Xenopus and chick
(Dorsky et al., 1997
;
Henrique et al., 1997
;
Kubo et al., 2005
). The
relative levels of Notch activity in DAPT treated or Delta1- and
dnDelta1-misexpressing cells is unclear. However, one interpretation
consistent with all of the data from chick, mouse and Xenopus is that
the level of Notch signal is crucial for cell fate determination
(Fig. 9). Very low levels of
Notch would favor photoreceptor production, probably through induction of Otx2
(Nishida et al., 2003
), while
slightly higher levels of Notch would favor production of other neuronal cell
types (Hatakeyama and Kageyama,
2004
). Very high levels of Notch would prohibit exit from cell
cycle and inhibit production of any postmitotic cell type
(Dorsky et al., 1995
) (A.P.J.
and C.L.C., unpublished).
|
Hes1-null mutants show precocious and enhanced development of many
early born cell types, including retinal ganglion cells, horizontal cells and
amacrine cells, and a decrease in the later born Muller glial cells.
Hes5-null mice are also deficient in Muller glial cells, but the
production of neuronal cell types is unaffected. As neither Hes1- nor
Hes5-null mice exhibit a bias in producing the photoreceptor versus
non-photoreceptor cell fate (Hojo et al.,
2000
; Takatsuka et al.,
2004
; Tomita et al.,
1996
), this aspect of Notch activity is most likely Hes
independent. Single or compound mutations in various positive bHLH
transcription factors also lead to a relatively specific loss of particular
non-photoreceptor cell fates. Null mutations in Math5 lead to loss of
ganglion cells (Brown et al.,
2001
; Wang et al.,
2001
), mice lacking both Mash1 and Math3 fail to
produce bipolar interneurons (Hatakeyama
et al., 2001
), while mice lacking both Neurod1 and
Math3 are missing amacrine cells
(Inoue et al., 2002
). The loss
of non-photoreceptor cell fates in the Notch1 CKO mice is most
probably not due to the loss of specific bHLH transcription factors, as a
decrease in Math5 expression could not be appreciated by gene
profiling or in situ hybridization (data not shown). Furthermore, Math3 and
Neurod1 are both required for the amacrine and bipolar fates, and expression
of both these genes was significantly upregulated in the Notch1 CKO
retinae. Another gene significantly increased in E13.5 Notch1 ablated retinae
was Otx2, a transcription factor recently shown to be expressed in
newly postmitotic neurons and essential for photoreceptor differentiation
(Nishida et al., 2003
). In
that study, misexpression of Otx2 in postnatal day 0 rat increased the
production of rod photoreceptor-only clones from 80.7% to 95%
(Nishida et al., 2003
). Our
results suggest that Notch signaling directly or indirectly regulates the
level of Otx2, which is crucial for ensuring the proper ratio of
photoreceptor versus non-photoreceptor fates produced. High levels of
Otx2 might be dominant to the activities of bHLH and other genes that
can induce non-photoreceptor neuronal fates.
In the developing Drosophila retina, Notch signaling is recruited
for multiple activities including: (1) setting up a dorsal/ventral boundary,
(2) establishing planar polarity, (3) upregulating early atonal levels to
promote neurogenesis and (4) antagonizing late atonal activity to inhibit
neurogenesis (Frankfort and Mardon,
2002
). This study and previous reports suggest similarly diverse
roles for Notch activity in the vertebrate retina. First the early developing
vertebrate retina expresses Notch1 initially only in the central
region of the retina (Lindsell et al.,
1996
) (data not shown), suggesting that Notch-Delta signaling is
necessary only when neurogenesis begins. As ablation of Notch1
dramatically influences organ size and introducing activated Notch can lead to
hyperproliferation (Bao and Cepko,
1997
), Notch1 most probably engages the cell cycle machinery.
Interestingly, when Notch1 was deleted in E14.5 retinal progenitor
cells, smaller clones were observed, but a total loss of more than three cell
clones was not observed. The modest effect of loss of Notch on clone size is
in keeping with data from Drosophila. Loss of Notch from the entire
eye disc leads to a dramatic reduction in size, whereas loss of Notch in
clones does not dramatically reduce clone size. A non-autonomous ligand,
unpaired, that is activated by Notch is thought to mediate these effects
(Chao et al., 2004
). In
vertebrates, it is not known if there is such a non-autonomous ligand.
Nonetheless, in mice, Notch appears to be one regulator of cell proliferation,
but it is not essential for cell cycle progression. It is, however, sufficient
for at least some period of time, as sustaining Notch activity in late retinal
progenitor cells leads to formation of very large clones
(Furukawa et al., 2000
). Notch
activation also leads to a block in neuronal fates and an increase in cells
with some glial characteristics. The data presented here also clearly indicate
a cell fate role for Notch1 in the vertebrate retina. The specific promotion
of the photoreceptor fate at the expense of both glial and other neuronal cell
fates following deletion of Notch1 reveals that it normally represses the
photoreceptor fate. If photoreceptors were the initial cell type when the
retina first evolved, one speculative interpretation of these data is that
Notch was recruited to allow preservation of a pool of RPCs for later cellular
diversification
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/5/913/DC1
| REFERENCES |
|---|
|
|
|---|
Ahmad, I., Zaqouras, P. and Artavanis-Tsakonas, S. (1995). Involvement of Notch-1 in mammalian retinal neurogenesis: association of Notch-1 activity with both immature and terminally differentiated cells. Mech Dev. 53, 73-85.[CrossRef][Medline]
Ahmad, I., Dooley, C. M. and Polk, D. L. (1997). Delta-1 is a regulator of neurogenesis in the vertebrate retina. Dev. Biol. 185,92 -103.[CrossRef][Medline]
Altshuler, D., Lo Turco, J. J. and Cepko, C. (1991). Specification of cell type in the vertebrate retina. In Development of the Visual System (ed. M.-K. Lam and C. Shatz), pp. 37-58. Cambridge (MA): MIT Press.
Ang, S. L., Conlon, R. A., Jin, O. and Rossant, J. (1994). Positive and negative signals from mesoderm regulate the expression of mouse Otx2 in ectoderm explants. Development 120,2979 -2989.[Abstract]
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Austin, C. P., Feldman, D. E., Ida, J. A., Jr and Cepko, C. L. (1995). Vertebrate retinal ganglion cells are selected from competent progenitors by the action of Notch. Development 121,3637 -3650.[Abstract]
Bao, Z. Z. and Cepko, C. L. (1997). The
expression and function of Notch pathway genes in the developing rat eye.
J. Neurosci. 17,1425
-1434.
Belliveau, M. J. and Cepko, C. L. (1999). Extrinsic and intrinsic factors control the genesis of amacrine and cone cells in the rat retina. Development 126,555 -566.[Abstract]
Belliveau, M. J., Young, T. L. and Cepko, C. L.
(2000). Late retinal progenitor cells show intrinsic limitations
in the production of cell types and the kinetics of opsin synthesis.
J. Neurosci. 20,2247
-2254.
Blackshaw, S., Harpavat, S., Trimarchi, J., Cai, L., Huang, H., Kuo, W. P., Weber, G., Lee, K., Fraioli, R. E., Cho, S. H. et al. (2004). Genomic analysis of mouse retinal development. PLoS Biol. 2,E247 .[CrossRef][Medline]
Brown, N. L., Patel, S., Brzezinski, J. and Glaser, T.
(2001). Math5 is required for retinal ganglion cell and optic
nerve formation. Development
128,2497
-2508.
Carden, M. J., Trojanowski, J. Q., Schlaepfer, W. W. and Lee, V. M. (1987). Two-stage expression of neurofilament polypeptides during rat neurogenesis with early establishment of adult phosphorylation patterns. J. Neurosci. 7,3489 -3504.[Abstract]
Cepko, C. L., Austin, C. P., Yang, X., Alexiades, M. and
Ezzeddine, D. (1996). Cell fate determination in the
vertebrate retina. Proc. Natl. Acad. Sci. USA
93,589
-595.
Cepko, C. L., Ryder, E., Austin, C., Golden, J., Fields-Berry, S. and Lin, J. (1998). Lineage analysis using retroviral vectors. Methods 14,393 -406.[CrossRef][Medline]
Chao, J. L., Tsai, Y. C., Chiu, S. J. and Sun, Y. H.
(2004). Localized Notch signal acts through eyg and upd to
promote global growth in Drosophila eye. Development
131,3839
-3847.
Chen, C. M. and Cepko, C. L. (2002). The
chicken RaxL gene plays a role in the initiation of photoreceptor
diffentiation. Development
129,5363
-5375.
Corbo, J. C. and Cepko, C. L. (2005). A hybrid photoreceptor expressing both rod and cone genes in a mouse model of enhanced S-cone syndrome. PLoS Genet. 1, E11.
de la Pompa, J. L., Wakeham, A., Correia, K. M., Samper, E., Brown, S., Aguilera, R. J., Nakano, T., Honjo, T., Mak, T. W., Rossant, J. et al. (1997). Conservation of the Notch signalling pathway in mammalian neurogenesis. Development 124,1139 -1148.[Abstract]
Dorsky, R. I., Rapaport, D. H. and Harris, W. A. (1995). Xotch inhibits cell differentiation in the Xenopus retina. Neuron 14,487 -496.[CrossRef][Medline]
Dorsky, R. I., Chang, W. S., Rapaport, D. H. and Harris, W. A. (1997). Regulation of neuronal diversity in the Xenopus retina by Delta signalling. Nature 385, 67-70.[CrossRef][Medline]
Dyer, M. A. and Cepko, C. L. (2001a). p27Kip1
and p57Kip2 regulate proliferation in distinct retinal progenitor cell
populations. J. Neurosci.
21,4259
-4271.
Dyer, M. A. and Cepko, C. L. (2001b). The p57Kip2 cyclin kinase inhibitor is expressed by a restricted set of amacrine cells in the rodent retina. J. Comp. Neurol. 429,601 -614.[CrossRef][Medline]
Fekete, D. M. and Cepko, C. L. (1993).
Replication-competent retroviral vectors encoding alkaline phosphatase reveal
spatial restriction of viral gene expression/transduction in the chick embryo.
Mol. Cell. Biol. 13,2604
-2613.
Fields-Berry, S. C., Halliday, A. L. and Cepko, C. L.
(1992). A recombinant retrovirus encoding alkaline phosphatase
confirms clonal boundary assignment in lineage analysis of murine retina.
Proc. Natl. Acad. Sci. USA
89,693
-697.
Forrest, D., Reh, T. A. and Rusch, A. (2002). Neurodevelopmental control by thyroid hormone receptors. Curr. Opin. Neurobiol. 12,49 -56.[CrossRef][Medline]
Frankfort, B. J. and Mardon, G. (2002). R8 development in the Drosophila eye: a paradigm for neural selection and differentiation. Development 129,1295 -1306.
Furukawa, T., Morrow, E. M. and Cepko, C. L. (1997). Crx, a novel otx-like homeobox gene, shows photoreceptor-specific expression and regulates photoreceptor differentiation. Cell 91,531 -541.[CrossRef][Medline]
Furukawa, T., Mukherjee, S., Bao, Z. Z., Morrow, E. M. and Cepko, C. L. (2000). rax, Hes1, and notch1 promote the formation of Muller glia by postnatal retinal progenitor cells. Neuron 26,383 -394.[CrossRef][Medline]
Gaiano, N., Nye, J. S. and Fishell, G. (2000). Radial glial identity is promoted by Notch1 signaling in the murine forebrain. Neuron 26,395 -404.[CrossRef][Medline]
Hatakeyama, J. and Kageyama, R. (2004). Retinal cell fate determination and bHLH factors. Semin. Cell Dev. Biol. 15,83 -89.[CrossRef][Medline]
Hatakeyama, J., Tomita, K., Inoue, T. and Kageyama, R. (2001). Roles of homeobox and bHLH genes in specification of a retinal cell type. Development 128,1313 -1322.[Abstract]
Hebert, J. M. and McConnell, S. K. (2000). Targeting of cre to the Foxg1 (BF-1) locus mediates loxP recombination in the telencephalon and other developing head structures. Dev. Biol. 222,296 -306.[CrossRef][Medline]
Henrique, D., Hirsinger, E., Adam, J., Le Roux, I., Pourquie, O., Ish-Horowicz, D. and Lewis, J. (1997). Maintenance of neuroepithelial progenitor cells by Delta-Notch signalling in the embryonic chick retina. Curr. Biol. 7, 661-670.[CrossRef][Medline]
Hojo, M., Ohtsuka, T., Hashimoto, N., Gradwohl, G., Guillemot, F. and Kageyama, R. (2000). Glial cell fate specification modulated by the bHLH gene Hes5 in mouse retina. Development 127,2515 -2522.[Abstract]
Hoover, F., Seleiro, E. A., Kielland, A., Brickell, P. M. and Glover, J. C. (1998). Retinoid X receptor gamma gene transcripts are expressed by a subset of early generated retinal cells and eventually restricted to photoreceptors. J. Comp. Neurol. 391,204 -213.[CrossRef][Medline]
Inoue, T., Hojo, M., Bessho, Y., Tano, Y., Lee, J. E. and Kageyama, R. (2002). Math3 and NeuroD regulate amacrine cell fate specification in the retina. Development 129,831 -842.
Iso, T., Kedes, L. and Hamamori, Y. (2003). HES and HERP families: multiple effectors of the Notch signaling pathway. J. Cell Physiol. 194,237 -255.[CrossRef][Medline]
Kubo, F., Takeichi, M. and Nakagawa, S. (2005).
Wnt2b inhibits differentiation of retinal progenitor cells in the absence of
Notch activity by downregulating the expression of proneural genes.
Development 132,2759
-2770.
Kwan, C. T., Tsang, S. L., Krumlauf, R. and Sham, M. H. (2001). Regulatory analysis of the mouse Hoxb3 gene: multiple elements work in concert to direct temporal and spatial patterns of expression. Dev. Biol. 232,176 -190.[CrossRef][Medline]
Levine, E. M., Fuhrmann, S. and Reh, T. A. (2000). Soluble factors and the development of rod photoreceptors. Cell Mol. Life Sci. 57,224 -234.[CrossRef][Medline]
Lindsell, C. E., Boulter, J., diSibio, G., Gossler, A. and Weinmaster, G. (1996). Expression patterns of Jagged, Delta1, Notch1, Notch2, and Notch3 genes identify ligand-receptor pairs that may function in neu