|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 February 2006
doi: 10.1242/dev.02263
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 The Committee on Developmental Biology, The University of Chicago, 1027 East
57th Street, Chicago, IL 60637, USA.
2 Department of Developmental and Cell Biology, University of California,
Irvine, CA 92697, USA.
3 Department of Organismal Biology and Anatomy, The University of Chicago, 1027
East 57th Street, Chicago, IL 60637, USA.
Author for correspondence (e-mail:
vprince{at}uchicago.edu)
Accepted 22 December 2005
| SUMMARY |
|---|
|
|
|---|
Key words: Pancreas, Zebrafish, Insulin, ß-Cell, Endoderm
| INTRODUCTION |
|---|
|
|
|---|
Several signaling molecules have been implicated in induction of specific
endodermal cell types. Application of fibroblast growth factor 4 (FGF4)
protein in the chick induces posterior endodermal markers in anterior
(foregut) endoderm (Wells and Melton,
2000
). Activin-ßB and FGF2, which function to suppress
endodermal Sonic hedgehog (Shh) signaling, are permissive for pancreas
formation, similar to the role of the embryonic notochord
(Hebrok et al., 1998
). Kumar
and colleagues (Kumar et al.,
2003
) used chick explant cultures to show that pancreatic markers
are induced in anterior endoderm by lateral plate mesoderm from the
pre-pancreatic region. They also showed that activin, bone morphogenetic
proteins (BMPs) or retinoic acid (RA) can all induce pancreatic markers in
anterior endoderm co-cultured with anterior mesoderm
(Kumar et al., 2003
). Of these
molecules, only RA has also been found necessary for pancreas development.
Zebrafish or mice defective in RA synthesis or RA receptor (RAR) function lack
pancreatic cell types (Martin et al.,
2005
; Molotkov et al.,
2005
; Stafford and Prince,
2002
). In addition, exogenous application of RA to zebrafish
embryos induces ectopic pancreatic cells throughout the anterior endoderm.
Work in amphibian and avian systems has yielded similar results, indicating
that the requirement for RA in endocrine pancreas specification is probably a
general feature of vertebrate development
(Chen et al., 2004
;
Stafford et al., 2004
).
Together the gain- and loss-of-function studies suggest that RA plays an
instructive role in specifying the position of the pancreas along the
anteroposterior (AP) axis of the gut.
The mechanism of RA signal transduction is well known
(Bastien and Rochette-Egly,
2004
). The rate-limiting step in RA synthesis is conversion of
retinaldehyde to RA, catalyzed by retinaldehyde dehydrogenase (RALDH). RA
signals are transduced by two types of nuclear hormone receptors: retinoic
acid receptors (RARs) and retinoid receptors (RXRs). RARs and RXRs bind as
heterodimers to retinoic acid response elements (RAREs) and either activate or
repress transcription based on the presence or absence of ligand,
respectively. The expression of RALDH enzymes (RALDH1-3) defines the tissues
that produce RA; the RA essential for early vertebrate embryogenesis depends
on RALDH2 function (Begemann et al.,
2001
; Grandel et al.,
2002
; Niederreither et al.,
1999
). In all vertebrates that have been examined, Raldh2
is expressed during gastrulation in the mesendoderm, and becomes localized to
lateral plate and paraxial mesoderm during segmentation
(Begemann et al., 2001
;
Berggren et al., 1999
;
Niederreither et al., 1997
;
Swindell and Eichele, 1999
;
Wang et al., 1996
;
Zhao et al., 1996
). Similarly,
the expression of RARs and RXRs defines the tissues capable of responding to
RA, and these exhibit broad, dynamic expression patterns during development
(Begemann et al., 2001
;
Joore et al., 1994
;
Mollard et al., 2000
;
Sharpe, 1992
). Consistent with
these broad expression domains, loss-of-function studies have revealed that RA
signaling is important for the development of derivatives of all germ layers
(reviewed by Ross et al.,
2000
). The expression of RARs in a given tissue does not
necessarily imply active RA signaling, as RARs can act as transcriptional
repressors when not bound by RA (Koide et
al., 2001
).
Although RA clearly plays a crucial role in pancreas development, the precise nature of the inductive interaction is unknown. RA synthesized in the mesoderm could act directly on pancreas precursor cells in the endoderm. However, as RA also patterns other germ layers, its influence on the endoderm may be indirect. Distinguishing between these direct and indirect signaling models is crucial to understanding the molecular mechanism of pancreas specification.
Here, we take advantage of the ability to transplant cells into specific
germ layers in zebrafish to pinpoint the source of RA and to demonstrate that
it acts directly on endodermal cells to induce pancreatic fates. To establish
the source, we generated chimeric embryos with a mixture of normal and
RALDH2-deficient cells, an approach similar to previous studies of neural
patterning (Begemann et al.,
2001
). The presence of wild-type donor cells in anterior mesoderm
(somites 1-7) of a host embryo otherwise unable to synthesize RA rescues the
formation of insulin-expressing cells, demonstrating that the crucial
source of RA is the paraxial mesoderm. Conversely, disruption of RAR function
in the endoderm with antisense morpholinos (MOs) and dominant-negative
receptors blocks ß-cell development, whereas loss of RAR function in
other germ layers has no effect on embryonic insulin expression. In
addition, a constitutively active RAR can drive ectopic expression of
insulin in anterior endoderm. Our studies are the first to
demonstrate that ß-cell development requires RA produced in the paraxial
mesoderm and that pancreatic precursors receive the RA signal directly.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2a cDNA was isolated using PCR
primers upstream of the START codon and overlapping the STOP codon (Accession
Number NM_131406): RAR
2a-START, TTGAATTCGCCAGCCGTTGTCTTGAGGAAT;
RAR
2a-STOP, CATCCTCGAGTGATGGTTGTCACGGTGACTG. A DN-RAR
2a
containing a premature stop codon to remove the C-terminal activation domain
was modeled on Xenopus DN-RARs
(Blumberg et al., 1997
2a, the above START primer was
used with a primer that introduced a STOP codon at amino acid residue 403:
DN-RAR
2a-403-STOP, CATCCTCGAG CTATGAGCCTGGGATCTCATTT. PCR products were
digested with EcoRI and XhoI and subcloned into pCS2+
(Turner and Weintraub,
1994
Microinjections
Synthetic capped mRNAs encoding zebrafish SOX32, GFP, RAR
2a,
DN-RAR
2a and Xenopus VP16-RAR
1 were synthesized using
the Ambion Megascript kit according to manufacturer's instructions. mRNA was
suspended in 0.2 M KCl and
100 pl pressure-injected into one-cell stage
embryos. Antisense morpholinos were designed by Gene Tools to target the
raldh2 and rar genes: raldh2-MO, 5'
GCAGTTCTTCACTGGAGGTCAT; RAR
2b-MO, 5' CCACAACGTCCACGCTCTCGTACAT;
RAR
2a-MO, 5' GGTTCACATCCACACTCTCATACAT; RAR
-MO, 5'
CCAGAGCCTCCATACAGTCGAACAT.
Approximately 100 pl of morpholino was injected at the yolk/blastoderm
interface at the one- to two-cell stage, at concentrations ranging from 2
mg/ml to 4 mg/ml in injection buffer (0.25% Phenol Red, 120 mM KCl, 20 mM
HEPES-NaOH pH7.5). Reagents were injected at the following final
concentrations unless otherwise stated: SOX32 mRNA, 20 ng/µl; GFP mRNA, 15
ng/µl; RAR
2a mRNA, 100 ng/µl; DN-RAR
2a mRNA, 125 ng/µl;
VP16-RAR
1, 1 µg/µl; raldh2-MO, 4 mg/ml; RAR
2b-MO, 2 mg/ml;
RAR
2a-MO, 2 mg/ml; RAR
-MO, 2 mg/ml; sox32-MO
(Sakaguchi et al., 2001
), 5
mg/ml; 40 kDa lysinated fluorescein dextran (Molecular Probes), 1 mg/ml.
Luciferase assay
Zebrafish embryos were injected at the one-cell stage with 25 pg of a
RA-responsive reporter (tk-[ßRARE]2-luc, a gift from B.
Blumberg) either with or without 500 pg DN-RAR
2a RNA. Embryos were then
treated with various concentrations of RA diluted in embryo medium and
harvested at 24 hpf. Six embryos were used for each experimental condition,
lysed in 10 µl/embryo lysis buffer (50 mM Tris pH 7.5, 1 mM DTT, 2 mM EDTA)
and centrifuged at 16,000 g to remove cell debris. Lysate (10
µl) was assayed using the Enhanced Luciferase Assay kit (Pharmingen);
Monolight 2010 luminometer measurements were performed in duplicate.
In situ hybridization, immunohistochemistry and microscopy
In situ probes were used as previously described
(Prince et al., 1998
;
Stafford and Prince, 2002
).
GFP protein was detected by immunohistochemistry using rabbit anti-GFP
polyclonal antibody (Molecular Probes) at a dilution of 1:2000, processed with
the Vectastain Universal ABC kit and visualized with TSA substrate (NEN)
according to manufacturer's instructions. Confocal microscopy was performed on
a Zeiss LSM510.
Cell-transplantation
Wild-type embryos used in transplants were from the *AB strain
or a locally obtained pet store variety. Transplantation was performed as
previously described (Ho and Kane,
1990
). For transplants to test where RA signals are produced, the
host embryos were injected with
100 pl of 4 mg/ml raldh2-MO, and donor
embryos were labeled with 40 kDa fixable fluorescein dextran at the one-cell
stage. Groups of 10-15 uncommitted cells from 4 hpf donors were transplanted
along the blastoderm margin of equivalent stage host embryos. The embryos were
then raised to 24 hpf and insulin expression detected to assay for
the presence of endocrine ß-cells. For transplants to test whether RARs
function in mesoderm or ectoderm to specify pancreas, the hosts were injected
with RKD reagents (DN-RAR
2a at 125 ng/µl plus RAR
2b-MO at 2
mg/ml) at the one-cell stage.
For transplants using SOX32 to target cells to the endoderm, donor embryos were injected at the one-cell stage with SOX32 mRNA. The embryos were co-injected with fixable fluorescein dextran, or with GFP mRNA, to allow visualization of donor cells, and with RKD reagents where appropriate. Approximately 25-30 cells from 4 hpf donors were distributed along the blastoderm margin of stage-matched hosts. Donor embryos die by 9 hpf as a consequence of being composed exclusively of endoderm.
| RESULTS |
|---|
|
|
|---|
|
Pancreas development depends on RAR function
RA signals are transduced by RARs; three zebrafish genes encoding RARs have
previously been described (rara2a, rara2b and rarg)
(Begemann et al., 2001
;
Joore et al., 1994
;
Stafford and Prince, 2002
). At
10 hpf, rara2b is expressed at higher levels than rara2a in
the presumptive pancreatic region (Fig.
2A,B). Using the endoderm-labeling method described above and
confocal analysis, we found that rara2b is expressed in both endoderm
and mesoderm (Fig. 2D-F), while
rara2a expression is excluded from endoderm (data not shown). These
findings are consistent with our previous analysis of sections, which also
showed that rarg is localized to endoderm
(Stafford and Prince,
2002
).
To attempt to address the specific roles of individual RARs in pancreatic
development, we designed morpholinos targeted against the 5' coding
regions. Morpholinos targeted against rara2a and rara2b did
not cause a significant reduction in the number of insulin-expressing
cells when injected alone or together (Fig.
2C,H; data not shown). Injection of morpholino targeted against
rarg caused a minor reduction in number of
insulin-expressing cells (Fig.
2H), and this effect was exacerbated by co-injection of
rarg with rara2b morpholino
(Fig. 2H), although even in
co-injected specimens the pancreas retained more than 50% of its normal size.
By contrast, injection of a dominant-negative (DN) RAR
2a lacking the
C-terminal activation domain (Blumberg et
al., 1997
; Sharpe and
Goldstone, 1997
) caused severe defects. Zebrafish embryos injected
with synthetic mRNA encoding DN-RAR
2a exhibited hindbrain and ear
defects similar to those typically caused by reductions in RA signaling, as
well as a dose-dependent reduction in size of the endocrine pancreas (as
assayed by insulin expression;
Fig. 2G). Furthermore, we found
that co-injection of rara2b-morpholino with DN-RAR
2a mRNA
produced a significantly more severe pancreas phenotype than injection of the
DN-RAR alone (Fig. 2H,I).
To confirm the specificity of the DN-RAR, we made use of several assays. We
microinjected zebrafish embryos with a reporter construct in which luciferase
expression is under RARE control and, as expected, found that this reporter
was unable to respond to RA treatments in the presence of DN-RAR
(Fig. 3A). To test further the
specificity of the DN-RAR in vivo, we attempted to rescue pancreas development
by co-injection of full-length RAR
2a mRNA. However, this mRNA had no
effect in the presence of the DN-RAR, and when injected alone led to a
reduction in pancreas size (data not shown). Excess RAR protein has been shown
to bind RA independently of RXR dimerization and DNA binding, which may reduce
the amount of RA available to interact with RARs bound to RAREs
(Blumberg et al., 1997
). As an
alternative test of specificity, we therefore examined the ability of our
DN-RAR to block activation of Hox gene transcription by exogenous RA
(Bel-Vialar et al., 2002
;
Conlon and Rossant, 1992
).
Treatment of 9 hpf embryos with 10-6M RA for 1 hour induced ectopic
hoxa4a expression in the anterior of the embryo
(Fig. 3B,C), suggesting that
hoxa4a is likely to be a direct RA target. Our DN-RAR blocked early
expression of hoxa4a (Fig.
3D), and in addition we found that the ability of RA to induce
ectopic hoxa4a expression in DN-RAR-injected embryos was severely
abrogated (Fig. 3E), indicating
that this reagent acts in a dominant-negative capacity. Similarly, we found
that the capacity of RA to induce ectopic insulin-expressing cells
was lost in DN-RAR-injected embryos (data not shown).
|
|
2a and rara2b-MO,
hereafter referred to as RAR knock-down (RKD), were used in subsequent
experiments as a source of RAR-deficient cells. The inability of
rara2b-MO to block pancreas development in the absence of DN-RAR may
indicate that absence of receptor leads to derepression of downstream targets,
as has been observed in Xenopus
(Koide et al., 2001
or of other RARs
that have not yet been isolated from the zebrafish. In summary, although our
results do not directly address which RAR subtype(s) are required for
pancreatic development, the RKD reagents allow us to generate embryos that are
unable to transduce RA signals while nevertheless expressing the RA synthetic
enzyme raldh2.
Pancreas development requires RAR function in endoderm and not in surrounding tissues
Although RA is required for pancreas development between 9 and 12 hpf
(Stafford and Prince, 2002
),
the onset of expression of the earliest known pancreatic marker,
pdx1, is not until
14 hpf. Thus, there is sufficient time for RA
to induce an intermediate signal rather than acting directly on the endoderm
itself. Potential sources of this intermediate factor(s) are axial mesoderm or
neuroectoderm, or paraxial mesoderm itself. To test the hypothesis that RA
acts indirectly on the endoderm, we transplanted wild-type cells into
RKD-injected hosts. Labeled donor cells were placed into presumptive paraxial
mesoderm in somites 1-7, but in contrast to RALDH2-deficient embryos, these
never rescued insulin expression
(Table 1). Likewise,
transplants of axial mesoderm or overlying neural ectoderm never caused a
significant increase in the number of insulin-expressing cells. Thus,
it is unlikely that a primary response to RA occurs in the mesoderm or
ectoderm. As our transplantation techniques did not target lateral plate
mesoderm, we did not test the possibility that this tissue relays RA signals.
However, our results with endoderm (below) suggest that if such a relay
exists, it acts in parallel with RA that signals to endoderm.
|
|
|
RAR function is sufficient to bias cells towards an endocrine pancreatic fate
To determine if RAR function in the endoderm is sufficient for pancreas
formation, we transplanted endoderm cells into RKD hosts (schematized in
Fig. 5C). Fifty-four percent
had seven or more insulin-expressing cells (n=26;
Fig. 5D;
Table 1), indicating that the
presence of endoderm capable of transducing RA signals is sufficient to allow
pancreas specification. We conclude that RAR function need only be present in
the endoderm for pancreas specification to occur, strengthening our hypothesis
that the signal is direct.
Although we have previously shown that exogenous RA treatment is sufficient
to induce anterior endoderm cells to take on endocrine pancreas fates
(Stafford and Prince, 2002
),
such global RA application probably alters positional information in all three
germ layers. Thus, this experiment does not discriminate between RA acting as
an instructive signal, which confers positional information directly to
endoderm, or as a permissive signal, which allows previously specified
endoderm cells to complete their differentiation program. To distinguish
between these possibilities, we activated RA signal transduction only in the
endoderm germ layer by using a constitutively active RAR (Xenopus
VP16-RAR
1) (Blumberg et al.,
1997
). As expected, this activated receptor expands expression of
a RA reporter transgene (RARE-YFP) when microinjected into zebrafish embryos
(data not shown) (Perz-Edwards et al.,
2001
). When we transplanted endoderm cells expressing the
constitutively active receptor into otherwise normal embryos
(Fig. 5E), we found
insulin-expressing cells differentiated within anterior endoderm
(Fig. 5F-H). All embryos formed
a normal-sized pancreas in the wild-type position
(Table 1). However, in 21 out
of 43 cases, ectopic donor-derived insulin-expressing cells were
found anterior to the first somite (cell locations summarized in
Fig. 5G). These studies confirm
that RA signal transduction in the endoderm is able to promote an endocrine
pancreatic fate even when adjacent mesoderm is of anterior character.
| DISCUSSION |
|---|
|
|
|---|
We have used cell transplantations to show that the RA signal required for
zebrafish ß-cell development is produced in the anterior paraxial
mesoderm. This finding is consistent with previous zebrafish transplantation
experiments, which revealed a similar reliance of neural ectoderm
regionalization on paraxial mesoderm-derived RA signals
(Begemann et al., 2001
). It
should be noted that although most of the zebrafish ß-cells derive from
the dorsal pancreatic bud, a few ß-cells differentiate at later stages
from the ventral bud (Field et al.,
2003
); the stages at which our experiments were analyzed do not
allow us to make conclusions about the role of RA in development of this later
differentiating population of ß-cells. The requirement for mesodermal
RALDH2 function in pancreas development is conserved between fish and mouse
(Martin et al., 2005
;
Molotkov et al., 2005
): mice
mutant for Raldh2 do not form a dorsal pancreatic bud. The expression
pattern of mouse Raldh2 suggests that the splanchnic component of the
lateral plate mesoderm is the crucial source of RA for pancreas specification
in this species, as this mesoderm is juxtaposed with the dorsal pre-pancreatic
endoderm at the onset of expression of the pancreas progenitor marker
Pdx1 (Martin et al.,
2005
; Molotkov et al.,
2005
). Similarly, explant studies in chick have suggested a
crucial role for the lateral plate mesoderm in conferring pancreatic identity
(Kumar et al., 2003
). By
contrast, our transplants reveal that RA produced in paraxial mesoderm is
sufficient to induce the zebrafish pancreas. As our transplants did not target
lateral plate mesoderm, RA from this source might also be capable of inducing
pancreas in zebrafish. Alternatively, this apparent discrepancy between
species may reflect differences in the relative locations of germ layer
derivatives during gastrulation of different vertebrates.
During the course of this study, we developed a novel transplantation
technique using activity of the SOX32 transcription factor to direct or
exclude reagents from the endoderm germ layer. Our transplantations of
RAR-deficient cells into the gut show that the RA signal required for
zebrafish pancreas specification is received directly by the endodermal cells.
These data rule out an indirect model for RA-mediated pancreas induction in
which RA first confers positional information to an intermediate tissue, such
as the paraxial mesoderm, which subsequently signals to the endoderm. Although
RA had previously been shown to play a role in endoderm regionalization
(Chen et al., 2004
;
Kumar et al., 2003
;
Martin et al., 2005
;
Molotkov et al., 2005
;
Stafford et al., 2004
;
Stafford and Prince, 2002
),
this is the first direct demonstration that mesoderm-derived RA signals
directly to endoderm cells to induce pancreatic fates. Consistent with our
finding, reporters driven by RA response elements (RAREs) are expressed in the
mouse pancreatic endoderm (Martin et al.,
2005
; Molotkov et al.,
2005
). Martin and colleagues
(Martin et al., 2005
) have
also reported low level RARE reporter activity in adjacent pancreatic
mesenchyme, suggesting that RA signals are additionally received by the
mesoderm. However, our transplantation results show that, at least in
zebrafish, RA receptor function in mesoderm is not required for pancreas
specification.
Signals required for pancreas development may function in either a
permissive or an instructive fashion: for our purposes we define permissive
signals as allowing cells to continue along a pre-specified differentiation
program, whereas instructive signals confer positional information. We have
shown that a dominant active RA receptor is capable of conferring ß-cell
fate on anterior endoderm, suggesting that RA acts as an instructive signal.
However, it should be noted that in these experiments only a small proportion
of the anterior endoderm cells expressing active RA receptor go on to express
insulin, and further that the majority of these
insulin-positive cells are located posterior to the level of the otic
vesicle. These findings may imply that additional signals normally act at
foregut level to further bias progenitor cells towards a ß-cell fate, and
that these signals are lacking from the most anterior part of the embryo.
Alternatively, they may merely suggest that the Xenopus
dominant-active receptor used does not have full function in the zebrafish.
Explant studies in chick (Kumar et al.,
2003
) have shown that RA is not able to induce pancreatic markers
in explants of anterior endoderm cultured in the absence of mesoderm,
revealing that a second mesoderm-derived signal in addition to RA is necessary
for pancreas specification. Our experiments suggest that mesoderm anterior to
the first somite can supply this second signal, implying that the signal is RA
independent and permissive in nature.
A major determinant of pancreas position may be the localized source of
mesoderm-derived RA. This source is dependent on activity of both the
synthetic RALDH2 enzyme and the RA degrading Cyp26 enzymes
(Kudoh et al., 2002
;
Sakai et al., 2001
). In future
studies, it will be important to determine the precise locations of the
pancreatic progenitors during gastrulation stages, in order to deduce whether
localized activity of RA is sufficient, in turn, to localize the pancreas.
Finally, as an instructive signal, RA is likely to prove a crucial component
of protocols to induce stem cells to differentiate into pancreatic
ß-cells. Consistent with this, a novel three-step approach to inducing
ß-cells from stem cells, using both Activin A and RA, has recently been
reported (Shi et al.,
2005
).
| ACKNOWLEDGMENTS |
|---|
1 constructs. We thank Ken Cho, Maike Sander, Jon Clarke and
members of the Schilling laboratory for helpful comments on the manuscript.
This work was supported by grants from JDRF (1-2003-257) and NIH (DK-064973)
to V.E.P.; and by NIH (NS-41353, DE-13828), March of Dimes (1-FY01-198) and
Pew Scholars Foundation (2615SC) to T.F.S. | Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Bastien, J. and Rochette-Egly, C. (2004). Nuclear retinoid receptors and the transcription of retinoid-target genes. Gene 328,1 -16.[CrossRef][Medline]
Begemann, G., Schilling, T. F., Rauch, G. J., Geisler, R. and Ingham, P. W. (2001). The zebrafish neckless mutation reveals a requirement for raldh2 in mesodermal signals that pattern the hindbrain. Development 128,3081 -3094.
Bel-Vialar, S., Itasaki, N. and Krumlauf, R. (2002). Initiating Hox gene expression: in the early chick neural tube differential sensitivity to FGF and RA signaling subdivides the HoxB genes in two distinct groups. Development 129,5103 -5115.
Berggren, K., McCaffery, P., Drager, U. and Forehand, C. J. (1999). Differential distribution of retinoic acid synthesis in the chicken embryo as determined by immunolocalization of the retinoic acid synthetic enzyme, RALDH-2. Dev. Biol. 210,288 -304.[CrossRef][Medline]
Blumberg, B., Bolado, J. J., Moreno, T. A., Kintner, C., Evans, R. M. and Papalopulu, N. (1997). An essential role for retinoid signaling in anteroposterior neural patterning. Development 124,373 -379.[Abstract]
Chen, Y., Pan, F. C., Brandes, N., Afelik, S., Solter, M. and Pieler, T. (2004). Retinoic acid signaling is essential for pancreas development and promotes endocrine at the expense of exocrine cell differentiation in Xenopus. Dev. Biol. 271,144 -160.[CrossRef][Medline]
Conlon, R. A. and Rossant, J. (1992). Exogenous retinoic acid rapidly induces anterior ectopic expression of murine Hox-2 genes in vivo. Development 116,357 -368.[Medline]
David, N. B. and Rosa, F. (2001). Cell autonomous commitment to an endodermal fate and behaviour by activation of Nodal signalling. Development 128,3937 -3947.
Field, H. A., Dong, P. D., Beis, D. and Stainier, D. Y. (2003). Formation of the digestive system in zebrafish. II. Pancreas morphogenesis. Dev. Biol. 261,197 -208.[CrossRef][Medline]
Grandel, H., Lun, K., Rauch, G. J., Rhinn. M., Piotrowski, T., Houart, C., Sordino, P., Kuchler, A. M., Schulte-Merker, S., Geisler, R. et al. (2002). Retinoic acid signalling in the zebrafish embryo is necessary during pre-segmentation stages to pattern the anterior-posterior axis of the CNS and to induce a pectoral fin bud. Development 129,2851 -2865.
Hebrok, M., Kim, S. K. and Melton, D. A.
(1998). Notochord repression of endodermal Sonic hedgehog permits
pancreas development. Genes Dev.
12,1705
-1713.
Ho, R. K. and Kane, D. A. (1990). Cell-autonomous action of zebrafish spt-1 mutation in specific mesodermal precursors. Nature 348,728 -730.[CrossRef][Medline]
Horb, M. E. and Slack, J. M. (2001). Endoderm specification and differentiation in Xenopus embryos. Dev. Biol. 236,330 -343.[CrossRef][Medline]
Joore, J., van der Lans, G. B., Lanser, P. H., Vervaart, J. M., Zivkovic, D., Speksnijder, J. E. and Kruijer, W. (1994). Effects of retinoic acid on the expression of retinoic acid receptors during zebrafish embryogenesis. Mech. Dev. 46,137 -150.[CrossRef][Medline]
Kikuchi, Y., Agathon, A., Alexander, J., Thisse, C., Waldron,
S., Yelon, D., Thisse, B. and Stainier, D. Y. (2001).
casanova encodes a novel Sox-related protein necessary and sufficient for
early endoderm formation in zebrafish. Genes Dev.
15,1493
-1505.
Kim, S. K., Hebrok, M. and Melton, D. (1997). Notochord to endoderm signaling is required for pancreas development. Development 124,4243 -4252.[Abstract]
Kimmel, C. B., Warga, R. M. and Schilling, T. F.
(1990). Origin and organization of the zebrafish fate map.
Development 108,581
-594.
Koide, T., Downes, M., Chandraratna, R., Blumberg, B. and
Umesono, K. (2001). Active repression of RAR signaling is
required for head formation. Genes Dev.
15,2111
-2121.
Kudoh, T., Wilson, S. W. and Dawid, I. B. (2002). Distinct roles for Fgf, Wnt and retinoic acid in posteriorizing the neural ectoderm. Development 129,4335 -4346.
Kumar, M., Jordan, N., Melton, D. and Grapin-Botton, A. (2003). Signals from lateral plate mesoderm instruct endoderm toward a pancreatic fate. Dev. Biol. 259,109 -122.[CrossRef][Medline]
Lee, K. H., Xu, Q. and Breitbart, R. E. (1996). A new tinman-related gene, nkx2.7, anticipates the expression of nkx2.5 and nkx2.3 in zebrafish heart and pharyngeal endoderm. Dev. Biol. 15,722 -731.
Martin, M., Gallego-Llamas, J., Ribes, V., Kedinger, M., Niederreither, K., Chambon, P., Dolle, P. and Gradwohl, G. (2005). Dorsal pancreas agenesis in retinoic acid-deficient Raldh2 mutant mice. Dev. Biol. 284,399 -411.[Medline]
Mollard, R., Viville, S., Ward, S. J., Decimo, D., Chambon, P. and Dolle, P. (2000). Tissue-specific expression of retinoic acid receptor isoform transcripts in the mouse embryo. Mech. Dev. 94,223 -232.[CrossRef][Medline]
Molotkov, A., Molotkova, N. and Duester, G. (2005). Retinoic acid generated by Raldh2 in mesoderm is required for mouse dorsal endodermal pancreas development. Dev. Dyn. 232,950 -957.[CrossRef][Medline]
Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P. and Dolle, P. (1997). Restricted expression and retinoic acid-induced downregulation of the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse development. Mech. Dev. 62, 67-78.[CrossRef][Medline]
Niederreither, K., Subbarayan, V., Dollé, P. and Chambon, P. (1999). Embryonic retinoic acid synthesis is essential for early mouse post-implantation development. Nat. Genet. 21,444 -448.[CrossRef][Medline]
Ober, E. A., Field, H. A. and Stainier, D. Y. (2003). From endoderm formation to liver and pancreas development in zebrafish. Mech. Dev. 120, 5-18.[CrossRef][Medline]
Odenthal, J. and Nüsslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Perz-Edwards, A., Hardison, N. L. and Linney, E. (2001). Retinoic acid-mediated gene expression in transgenic reporter zebrafish. Dev. Biol. 229,89 -101.[CrossRef][Medline]
Prince, V. E., Moens, C. B., Kimmel, C. B. and Ho, R. K. (1998). Zebrafish hox genes: expression in the hindbrain region of wild-type and mutants of the segmentation gene, valentino. Development 125,393 -406.[Abstract]
Ross, S. A., McCaffery, P. J., Drager, U. C. and De Luca, L.
M. (2000). Retinoids in embryonal development.
Physiol. Rev. 80,1021
-1054.
Rossi, J. M., Dunn, N. R., Hogan, B. L. and Zaret, K. S.
(2001). Distinct mesodermal signals, including BMPs from the
septum transversum mesenchyme, are required in combination for hepatogenesis
from the endoderm. Genes Dev.
15,1998
-2009.
Sakaguchi, T., Kuroiwa, A. and Takeda, H. (2001). A novel sox gene, 226D7, acts downstream of Nodal signaling to specify endoderm precursors in zebrafish. Mech. Dev. 107,25 -38.[CrossRef][Medline]
Sakai, Y., Meno, C., Fujii, H., Nishino, J., Shiratori, H.,
Saijoh, Y., Rossant, J. and Hamada, H. (2001). The retinoic
acid-inactivating enzyme CYP26 is essential for establishing an uneven
distribution of retinoic acid along the anterio-posterior axis within the
mouse embryo. Genes Dev.
15,213
-225.
Sharpe, C. R. (1992). Two isoforms of retinoic acid receptor alpha expressed during Xenopus development respond to retinoic acid. Mech. Dev. 39,81 -93.[CrossRef][Medline]
Sharpe, C. and Goldstone, K. (1997). Retinoid receptors promote primary neurogenesis in Xenopus. Development 124,515 -523.[Abstract]
Shi, Y., Hou, L., Tang, F., Jiang, W., Wang, P., Ding, M. and
Deng, H. (2005). Inducing embryonic stem cells to
differentiate into pancreatic beta cells by a novel three-step approach with
activin A and all-trans retinoic acid. Stem Cells
23,656
-662.
Stafford, D. and Prince, V. E. (2002). Retinoid signaling is required for a critical early step in zebrafish pancreatic development. Curr. Biol. 12, 1-20.[CrossRef][Medline]
Stafford, D., Hornbruch, A., Mueller, P. R. and Prince, V. E. (2004). A conserved role for retinoid signaling in vertebrate pancreas development. Dev. Genes Evol. 214,432 -441.[Medline]
Swindell, E. C. and Eichele, G. (1999). Retinoid metabolizing enzymes in development. Biofactors 10,85 -89.[Medline]
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Wang, X., Penzes, P. and Napoli, J. L. (1996).
Cloning of a cDNA encoding an aldehyde dehydrogenase and its expression in
Escherichia coli. Recognition of retinal as substrate. J. Biol.
Chem. 271,16288
-16293.
Wells, J. M. and Melton, D. A. (2000). Early mouse endoderm is patterned by soluble factors from adjacent germ layers. Development 127,1563 -1572.[Abstract]
Zhao, D., McCaffery, P., Ivins, K. J., Neve, R. L., Hogan, P., Chin, W. W. and Drager, U. C. (1996). Molecular identification of a major retinoic-acid-synthesizing enzyme, a retinaldehyde-specific dehydrogenase. Eur. J. Biochem. 240, 15-22.[Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. D. Kinkel, E. M. Sefton, Y. Kikuchi, T. Mizoguchi, A. B. Ward, and V. E. Prince Cyp26 enzymes function in endoderm to regulate pancreatic field size PNAS, May 12, 2009; 106(19): 7864 - 7869. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Zaret and M. Grompe Generation and Regeneration of Cells of the Liver and Pancreas Science, December 5, 2008; 322(5907): 1490 - 1494. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Huang, H. Ruan, M. Y. Aw, A. Hussain, L. Guo, C. Gao, F. Qian, T. Leung, H. Song, D. Kimelman, et al. Mypt1-mediated spatial positioning of Bmp2-producing cells is essential for liver organogenesis Development, October 1, 2008; 135(19): 3209 - 3218. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Shiraki, T. Yoshida, K. Araki, A. Umezawa, Y. Higuchi, H. Goto, K. Kume, and S. Kume Guided Differentiation of Embryonic Stem Cells into Pdx1-Expressing Regional-Specific Definitive Endoderm Stem Cells, April 1, 2008; 26(4): 874 - 885. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Kinkel, S. C. Eames, M. R. Alonzo, and V. E. Prince Cdx4 is required in the endoderm to localize the pancreas and limit {beta}-cell number Development, March 1, 2008; 135(5): 919 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Jorgensen, J. Ahnfelt-Ronne, J. Hald, O. D. Madsen, P. Serup, and J. Hecksher-Sorensen An Illustrated Review of Early Pancreas Development in the Mouse Endocr. Rev., October 1, 2007; 28(6): 685 - 705. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Gibert, A. Gajewski, A. Meyer, and G. Begemann Induction and prepatterning of the zebrafish pectoral fin bud requires axial retinoic acid signaling Development, July 15, 2006; 133(14): 2649 - 2659. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||