|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 8 February 2006
doi: 10.1242/dev.02269
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Université Pierre et Marie Curie-Paris6, CNRS UMR7622, Laboratoire de
Biologie du Développement, Bat C, 6ème étage,
Case 24, 75252 Paris Cedex 05, France.
2 UMR 7128 Laboratoire d'Embryologie Cellulaire et Moléculaire, 49 bis,
avenue de la Belle Gabrielle, 94130 Nogent-sur-Marne, France.
* Author for correspondence (e-mail: jaffredo{at}ccr.jussieu.fr)
Accepted 3 January 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Avian embryo, Aorta, Hemangioblasts, Hematopoiesis, Endothelium, Somite, Vascular smooth muscle
| INTRODUCTION |
|---|
|
|
|---|
Hematopoietic clusters were proposed to originate from the aortic ventral
endothelium via a specialized cell, the aortic hemangioblast
(Murray, 1932
). However,
unlike the yolk sac where ECs and HCs appear in a coordinated manner, the
aorta is formed at least 1 day before hematopoietic clusters became visible,
suggesting the existence of an aorta-specific type of hemangioblast. Before
hematopoiesis, however, these cells ensure endothelial-specific functions and
display a gene repertoire characteristic of ECs
(Jaffredo et al., 1998
;
Jaffredo et al., 2005a
). With
the exception of the Runx1 transcription factor (previously known as
cbfa2 or AML1) (North et
al., 1999
; North et al.,
2002
), aortic hemangioblasts are indistinguishable from the other
bona fide ECs and, in particular those of the aortic roof and sides
(North et al., 1999
;
Bollérot et al., 2005
).
This sequence of events is more evocative of a `hemogenic endothelium', a term
coined by Jordan (Jordan,
1917
).
A corpus of data in birds and mammals demonstrates that, as hemopoiesis
initiates, this hemogenic endothelium looses its endothelial phenotype and
acquires a hematopoietic-specific gene repertoire
(Nishikawa et al., 1998
;
de Bruijn et al., 2002
;
Fraser et al., 2002
;
Oberlin et al., 2002
;
Hirai et al., 2003
;
Sugiyama et al., 2003
;
Jaffredo et al., 2005a
) (K.
Bollérot and T.J., unpublished). Newly born HCs are either released
into the circulation or ingress into the ventral mesentery
(Jaffredo et al., 1998
) before
definitive hematopoietic organs become open to colonization.
Transplantation experiments in birds have demonstrated that embryonic ECs
originate from two different mesodermal lineages
(Pardanaud et al., 1996
). One,
from the splanchnic mesoderm, gives rise to the endothelial network of the
visceral organs. This EC production arises in situ
(Pardanaud et al., 1989
) and
exhibits a dual hemangiopoietic potential, i.e. it gives rise to both ECs and
HCs (Pardanaud et al., 1996
).
The other, from the somites, is purely endothelial, colonizes the
somatopleural mesoderm and gives the vasculature of the body wall
(Pardanaud et al., 1996
;
Ambler et al., 2001
) and
lymphatic vessels (Wilting et al.,
2000
). This mapping also reveals that the aortic endothelium has a
dual origin: roof and sides being contributed by somite-derived ECs, floor by
splanchnopleura-derived ECs (Pardanaud et
al., 1996
). As only splanchnopleura-born ECs display hemogenic
capacities, intra-aortic clusters are restricted to the ventral aspect of the
aorta.
Blood vessels are typically formed by one layer of ECs, one of pericytes
and one or several layers of smooth muscle cells, the importance of which
varies according to the size and identity (arterial versus venous) of the
vessel. ECs originate from the mesoderm whatever the region of the body
concerned. By contrast, vascular smooth muscle cells and pericytes, hereafter
referred as VSM cells, exhibit different origins according to the region of
the body being considered. In the forebrain, face, neck and truncus
arteriosus, VSM cells derive from the cephalic neural crest
(Le Lièvre and Le Douarin,
1975
; Jiang et al.,
2000
; Etchevers et al.,
2001
). In the heart, the septum separating the aorta from the
pulmonary trunk (Waldo et al., 1998) and the VSM cells of the proximal cardiac
artery (Bergwerff et al., 1998
;
Etchevers et al., 2001
) are
derived from neural crest. Coronary vein VSM cells originate from the
myocardium and coronary arteries VSM cells from the epicardium
(Mikawa and Gourdie, 1996
;
Vrancken Peeters et al., 1999
;
Perez-Pomares et al., 2002
).
The origins of VSM cells in the trunk, however, still remain elusive. ECs have
been proposed either to influence mesodermal cells differentiation
(Drake et al., 1998
;
Hungerford and Little, 1999
)
or to generate VSM cells directly
(DeRuiter et al., 1997
;
Drab et al., 1997
;
Yamashita et al., 2000
;
Ema et al., 2003
). Platelet
derived growth factor (PDGF) B and its receptor PDGFRß have been shown to
promote smooth muscle cell differentiation; PDGFB- and PDGFRß-deficient
mice exhibit impaired VSM cell recruitment
(Lindahl et al., 1997
). Chick
and mouse embryos have been shown to harbor multipotent progenitor cells, the
mesoangioblasts, that are able to give rise to ECs and VSM cells
(Cossu and Bianco, 2003
).
Smooth muscle cells are also thought to derive from the somites, although this
assertion has not been documented in detail
(Brand-Saberi and Christ,
2000
).
We report here the sequence of events contributing to vascularization of the embryo with a special interest for the aorta, i.e. the fate of the hemogenic endothelium and the role of the somite in the origins of the aortic wall from E1.5 to E6 in the chick embryo. Orthotopic and isochronic grafts at E1.5 of segmental plate show that the initial roof and sides of the aorta are replaced by new roof and sides from the somite. Cardinal veins, vasculature of the back, body wall and kidney are also of somitic origin. As hematopoiesis proceeds, the hemogenic endothelium also disappears from the aortic floor and is replaced by somitic ECs. Thus, the aortic floor appears as a transitory structure spent out and replaced. Aortic ECs are thus totally renewed during the first 4 days of development. In addition, we have characterized somite EC precursors at the molecular level. We also demonstrate that somites give rise to smooth muscle cells of the aorta. Finally, by using cell lineage tracing experiments in the aortic endothelium, we show that vascular ECs do not generate VSM cells during in ovo avian development, but do in vitro under appropriate conditions
| MATERIALS AND METHODS |
|---|
|
|
|---|
Immunohistology
Antibodies
QH1 monoclonal antibody (mAb, kind gift of Dr Luc Pardanaud), specific for
quail ECs and HCs (Pardanaud et al.,
1987
), was revealed with a goat anti mouse (GAM) IgM coupled to
either Horse Radish Peroxydase (Southern Biotechnology Associated) or Alexa
Fluor 488 (Molecular Probes). QCPN (Quail non-chick perinuclear antigen)
recognizes all quail cell nuclei. It was developed by Carlson and Carlson, and
obtained from the Developmental Studies Hybridoma Bank developed under the
auspices of the NICHD and maintained by The University of Iowa (Department of
Biological Sciences, Iowa City, IA 52242). QCPN was visualized with a GAM
IgG1-Alexa Fluor 555 (Molecular Probes). Anti
-smooth muscle actin
(
SMA) was purchased from Sigma (clone 1A4) and revealed with a GAM
IgG2a-Alexa Fluor 350 (Molecular Probes). Anti-chick CD 45, anti 68-1 and
74-2, supplied by ID-DLO (The Netherlands), were used to identified
macrophages (Jeurissen and Janse,
1998
). They were revealed with a GAM IgG2a-Alexa 350 or -Alexa 488
for CD45 or GAM IgG1-Alexa 555 for 68-1 and 74-2. MEP21 (generous gift of Dr
K. McNagny) recognized chick ECs and HCs
(McNagny et al., 1997
). MEP21
was revealed with a biotinylated GAM IgG1 followed by an amplification using
the Tyramide Signal Amplification system (TSA, NEN Life Science) using Cyanin3
as a fluorescent probe. When needed, sections were counterstained with
DAPI.
Histology
For cryostat sections, embryos were fixed in 4% paraformaldehyde and
processed as described previously
(Jaffredo et al., 1998
). For
Paraplast sections, embryos were fixed overnight in modified Formoy's
solution. They were embedded in Paraplast (Sigma) and transversally sectioned
at 5-7 µm. After rehydration, sections were submitted to
PBS/H2O2 3% to remove endogenous peroxydases followed by
a PBS/FCS 5% incubation for 30 minutes at room temperature. Primary and
secondary antibodies were deposited in PBS/FCS 5% 1 hour at room temperature.
Sections were washed in PBS four times between each incubation. HRP was
revealed with 3,3'-diaminobenzidine (DAB, Sigma).
RNA probes
The chicken GATA2 plasmid was a gift from Dr Engel (Northwestern
University, Evanston, IL). The chicken SCL/TAL1 was provided from Dr Green
(University of Cambridge, UK). Sense probes were obtained as reported in
(Minko et al., 2003
). The
chick VEGFR2 extracellular domain was isolated as follows (details available
upon request). Total RNA was extracted from yolk sacs of HH17 chick embryos
using the RNAble kit (Eurobio). RT-PCR was performed with the Enhanced Avian
HS RT-PCR 100 kit using the two-step method (Sigma). First step: specific
RT-PCR primer 5' GAGGAACGCCATTTACTGTG. Second step: 40 PCR cycles with
5' primer (TCGGCACGGCTCGGCTTC) and 3' primer
(TCCAGATTTCCCACAAGACG). A 2045 bp fragment was purified from agarose gel using
QIAEX Gel Extraction kit (Qiagen) and subcloned into the pCR2.1 vector
(InVitrogen) using Rapid DNA ligation kit (Roche). The antisense VEGFR2 probe
was obtained by digesting the plasmid with SacI followed by
transcription with T7.
In situ hybridization on sections
Embryos were collected and fixed overnight at 4°C in Formoy's solution.
Paraplast sections were treated as described previously
(Wilting et al., 1997
;
Minko et al., 2003
).
Retroviral constructs and cells lines
The D17.2G cell line was obtained from The American Type Culture Collection
(CRL-8468). D17.2G is a REV-A-based packaging cell line obtained from D17
canine cells. D17.2G was co-transfected with SNV-hPLAP (human Placental
Alkaline Phosphatase) and pUT626-containing phleomycin as a selection vector
(Cayla, Toulouse) as previously described
(Gautier et al., 2000
;
Jaffredo, 2000). Harvesting and concentration were performed as previously
described (Gautier et al.,
1996
; San Clemente et al.,
1996
; Jaffredo et al.,
2000
). Retroviral concentrations were evaluated on QT-6 cells,
ATCC number CRL-1708 (Moscovici et al.,
1977
). PLAP, was estimated to be 1x106 infectious
units/ml and CXL, 2x104 infectious units/ml.
In ovo inoculation
AcLDL-DiI
Human acetylated low density lipoprotein coupled to DiI (AcLDL-DiI,
Molecular Probes) was inoculated into the heart of E2 or E4 chick embryos as
described previously (Bollérot et
al., 2006
). Two hours after inoculation, embryos were either
photographed or processed for Flow Cytometry Analysis.
Retroviral vectors
Intracardiac inoculations of viral supernatant were performed on E4 embryos
as described (Jaffredo et al.,
2000
). Embryos were sacrificed at E6, beheaded, fixed in PFA 4%
for 2 hours at room temperature and stained in toto for PLAP and lacZ
expression with respectively NBT/BCIP and X-Gal. Embryos were embedded for
cryostat and sectioned at 7 µm.
Flow cytometry analysis
Heads, hearts, legs, allantois and extra-embryonic membranes of
AcLDL-DiI-inoculated embryos were removed. Embryo bodies were minced on ice in
a Petri dish and dissociated for 15 minutes at room temperature in sterile
1xPBS/dispase (2 U/ml) (Gibco) supplemented with 1%
penicillin-streptomycin. Enzymatic dissociation was stopped with DMEM/10% FCS.
After several washes with DMEM/10%FCS, cells were incubated for 20 minutes
with the anti-CD45 mAb and for 20 minutes with a GAM IgG2a-Alexa 488.
Non-inoculated embryos were used as controls.
AcLDL-DiI+/CD45- cells were sorted using a Coulter Epics
Elite ESP FACS.
Cell culture
Sorted AcLDL-DiI+/CD45- cells and unsorted cells
(control) were seeded in Lab-Tek Chamber Slides (Nunc) coated with laminin at
20 µg/ml (InVitrogen) at 2500 cells per well in EGM2-MV medium (kind gift
of Dr G. Uzan). This day was considered as day 0. The day after, EGM2-MV
medium was supplemented with either VEGF 50 ng/ml (R&D System), TGFß
5 ng/ml (R&D System), or without growth factor. Growth factors were
renewed every 2 days. Cells were fixed at day 0, 1, 4 and 7 in PFA4% for 20
min at RT and analyzed for MEP 21 and
SMA expression.
| RESULTS |
|---|
|
|
|---|
To make sure that no ECs were left at the surface of quail segmental plates, isolated grafts were submitted to QH1 immunohistochemistry. As a control, isolated quail somite strips attached to the lateral plate mesoderm, displayed strong QH1 staining (not shown). Out of 20 segmental plates examined, 18 were free of contaminating cells (Fig. 1E), whereas two displayed one to three positive cells in the anterior part of the graft. Conversely, in chick embryos submitted to segmental plate ablation, the aortic anlage and the associated vascular network appeared intact (not shown).
Unilateral grafts
Forty-six grafts were performed on the right side of chick hosts, staged
9-18 somite pairs. In rare cases, grafts were performed on the left side with
no difference in results. Embryos were sacrificed 1-5 days after grafting,
fixed and transversely sectioned. Analysis was performed either with the QH1
mAb alone or by double staining with QH1 and QCPN or QH1 and MEP21 mAbs.
One day after the operation (E2.5, n=22), the contribution of
quail somitic ECs varied along the axis, followed somite maturation but was
restricted to the grafted side. At caudal-most levels where the aortae were
still paired, a few QH1+ cells were detected around the neural
tube. The roof of the aorta was found to be colonized by somitic ECs
(Fig. 2A). This contribution,
one of the earliest of somite ECs to the vascular system, also agreed with the
QH1 pattern in non-operated quail embryos (see
Fig. 5E). At more cephalic
levels, dermatome and myotome have separated, the sclerotome began to
dissociate and the aortae have fused. The cardinal vein and vascular networks
of the mesonephros, the neural tube, inter-somitic arteries and the lateral
plate vascular network contained numerous quail ECs
(Fig. 2B). This pattern is
consistent with a centrifugal emigration of somite ECs to the lateral plate
already reported (Pardanaud et al.,
1996
; Ambler et al.,
2001
). In keeping with the results at more caudal levels, the roof
and sides of the aorta on the grafted side were formed entirely by quail ECs
(Fig. 2B). Complete replacement
was preferentially observed at the medial level of the graft and obtained only
when grafts longer than five-somite equivalents are used. With shorter grafts,
vascularization of the structures cited above remained unchanged but the aorta
was found to contain rare quail cells in its dorsal aspect. QH1+
ECs never crossed the dorsal midline (cf.
Klessinger and Christ, 1996
;
Pardanaud et al., 1996
). This
aorta-associated QH1 pattern persisted until aortic hematopoiesis initiated,
i.e. the beginning of E3.
|
|
Three to five days after the operation (E4.5, 5.5, 6.5; n=7, 8 and
2 respectively), intra-aortic hematopoiesis has ceased and the embryo has
substantially developed. The contribution of somite ECs has dramatically
increased. QH1+ vascular plexuses were found around and inside the
neural tube and nerve ganglia, and in the dermis, wing, body wall mesenchyme
and kidney. Double staining of an E6.5 grafted embryo with the EC-specific
MEP21 (chick) (McNagny et al.,
1997
) and QH1 (quail) mAbs showed that most, if not all, vessels
on the grafted side were quail. QH1 was mostly restricted to the grafted side
(Fig. 3A). On the dorsal aspect
of the grafted embryo, however, some QH1+ cells, either organized
into vascular structures or scattered as single cells, had crossed the
midline. These structures remained within 250 µm of the midline (not
shown). In addition to the roof and sides, the aortic floor was now found to
be colonized by QH1+ cells (Fig.
3A, inset). Contrary to the distribution observed for the roof,
QH1+ cells in the floor significantly colonized the contralateral
side (not shown). However, no QH1+ cells were detected in visceral
organs of splanchnopleural origin. Angioblasts participating to this second
remodeling are probably recruited among the numerous migrating angioblasts
present in the body wall. They may also originate from the limb bud vessels by
centripetal migration as previously demonstrated
(Christ et al., 1990
).
To evaluate the actual contribution of the somitic compartment, we performed six bilateral grafts of segmental plate. Three samples were sacrificed at E4 (two days after the graft) and three at E5. Embryos were sectioned and double stained for QCPN and QH1 expression. At the graft level, vascular networks of the neural tube, dermis and body wall were of quail origin (Fig. 3B). Aortic ECs were entirely from quail, confirming the results obtained with unilateral grafts (Fig. 3B).
Somites contribute to the formation of vascular smooth muscle cells of the aorta
QCPN staining revealed the presence of numerous
QH1-/QCPN+ cells around the aorta. The first
QH1-/QCPN+ cells reached the aorta at the time
sclerotomal cells began to colonize the notochord region. By E5, the vessel
was completely wrapped by a QCPN+ tunica media
(Fig. 3C). These
QCPN+ cells express the
SMA protein demonstrating the smooth
muscle nature of the cells (Fig.
3C, arrows). Cells contributing vascular smooth muscle, however,
displayed at least two major differences compared with QH1 angioblasts. First,
angioblasts are highly motile and dissociated from their original tissue,
whereas QCPN+/QH1- cells contributing to the vascular
tunica media are tightly associated with the movement of other somitic cells
in the body wall. Second, contrary to angioblasts that display QH1 expression
early during development, smooth muscle cell progenitors never expressed
SMA, considered as one of the earliest marker for VSM cells
(Hungerford and Little, 1999
),
during their migration.
SMA expression was switched on when cells
reached the vicinity of the aorta. Identity and contribution of the two cell
lineages were clearly dissociated during aorta morphogenesis as analyzed with
segmental plates grafts. QH1 staining remained restricted to the luminal, i.e.
endothelial, layer, whereas
SMA was expressed by abluminal cells and
never overlap with QH1+ cells
(Fig. 3D-F).
|
We have performed a clonal analysis of vascular EC derivatives with
non-replicative retroviral vectors carrying either lacZ or PLAP reporter genes
(Fig. 4A). Vectors were
inoculated into the heart thus in close contact to ECs lining the vessels
(Jaffredo et al., 2000
). E4
inoculated embryos were sacrificed at E6 (n=5) and stained for
lacZ and PLAP expression. Data were collected at the level of the
aorta. Reporter gene detection was combined to anti MEP21 and
SMA
immunohistochemistry (Fig. 4B).
A clone refers to either a single cell or a small group of cells expressing
one or the other reporter gene. None of the clones was found to be expressed
in more than one cell layer, i.e. endothelium or smooth muscle layer. Most
were distributed in vascular ECs. Out of 297 cells or cell groups counted, 233
(78.4%) were found in the endothelial layer
(Fig. 4B and inset) and 64
(21.5%) in the smooth muscle cell layer. Among the latter, most cells
displayed the characteristics of tissue macrophages (large cells with numerous
filopodia) as detected with the combined use of 68-1 and 74-2 mAbs (not shown)
that, respectively, recognize avian monocytes and mature macrophages
(Jeurissen and Janse, 1998
)
(T.J., unpublished). Out of 812 `macrophage-like' clones, 740 (90.3%) were of
the monocyte/macrophage lineage. However, 72 could not be identified as
macrophages and, on the basis of their position and shape, were identified as
VSM cells.
Purified endothelial cells transdifferentiate into smooth muscle cells in culture
Vascular ECs were FACS purified on the basis of AcLDL-DiI uptake and
exclusion of CD45 antigen expression (Fig.
4C). Purity was 99% at the time of plating. Cells were cultured in
the endothelium-specific medium EGM2-MV supplemented or not with 50 ng/ml VEGF
or 5 ng/ml TGFß. Cultures were analyzed at different time points for
MEP21 and
SMA expression. Twenty-four hours after VEGF addition, cells
displayed a uniform, spindle-shape phenotype, expressed MEP21 but not
SMA (Fig. 4D, top).
Similar antigenic characteristics were observed in TGFß conditions,
except that cells displayed a flat phenotype. Seventy-two hours after growth
factor addition (Fig. 4D,
bottom), cells cultured with VEGF retained the spindle-shape aspect but
co-expressed MEP21 and
SMA antigens. The flat cells in TGFß
conditions were enlarged and displayed a conspicuous
SMA expression.
However, some cells retained signs of MEP21 expression. The
SMA
phenotype was even more striking in the absence of growth factors; MEP21
expression was totally absent. Taken together, these results demonstrate that
embryonic ECs retain the capacity to transdifferentiate into smooth muscle
cells. This capacity is not, however, revealed in vivo, suggesting a tight
environmental control.
Formation of the aorta and molecular characterization of somite ECs
We have established the developmental patterns of the aorta from deposition
of the mesoderm to the paired vessel stage. We have also studied the molecular
characteristics of the endothelial somite compartment in quail and chick
embryos ranging from 10 to 25 somite pairs. QH1+ aggregates,
probably angioblasts, were detected at the primitive streak level in a lateral
position, in close contact with the embryonic endoderm
(Fig. 5A). At the segmental
plate level, QH1+ vascular structures have formed but remained
positioned lateral to the segmental plate. These structures were segregated
from the overlying tissues and situated between the splanchnopleural mesoderm
and the endoderm (Fig. 5B). At
the level of the nascent somites, the paired aortae have formed and begin to
position underneath the somites. A few QH1+ cells were detected in
a dorsal position between the ectoderm and the somatopleural mesoderm
(Fig. 5C). This QH1 pattern was
even more visible at a more anterior level when the somite has epithelialized
(Fig. 5D). QH1+
cells appeared to be associated with the Wolffian duct and, in some cases, in
close contact with the roof of the aorta
(Fig. 5E). Somites were
analyzed for the expression of several markers known to recognize endothelial
cells, i.e. GATA2, VEGFR2 and SCL/TAL1. As previously reported for VEGFR2
(Eichmann et al., 1993
;
Nimmagadda et al., 2004
), the
two last-formed somites never expressed EC-specific markers. Expression of
GATA2, VEGFR2 and SCL/TAL1 first appeared in a few cells visible as a
triangle-like area localized in the dorsolateral quadrant of the
epithelialized somite (Fig.
5F,G,H). These markers appeared at the same time and follow a
similar pattern, probably labeling the same cell population in both chick and
quail species. QH1 expression was generally very weak at the epithelialized
somite stage but a few QH1+ cells could be revealed
(Fig. 5I). At a slightly later
stage, QH1 expression became conspicuous
(Fig. 5E).
|
| DISCUSSION |
|---|
|
|
|---|
10 future somites)
plus the last segmented somite; (2) the host embryos were examined at
different time points.
Contribution of the somite-derived ECs to the maturation of the aorta
First remodeling: new roof and sides
Replacement of the aortic roof is one of the earliest contributions of
somite ECs to vascular development. It occurs when the aortae that are
splanchnopleural in origin are still paired and when no somitic ECs have yet
seeded the lateral plate (Fig.
6A,B). The seeding of intermediate and lateral plate mesoderm as
well as formation of the cardinal vein by somitic ECs is in agreement with
previous reports (Wilting et al.,
1995
; Pardanaud et al.,
1996
; Ambler et al.,
2001
). At E3, vessels surrounding the neural tube, intersomitic
arteries, cardinal veins, kidney vasculature, body wall and limb bud vessels
are quail derived at the level of the graft. The only exception is the aorta
that displays a chimeric and complementary pattern: the roof and sides
originated from the grafted somites, whereas the floor remains of host origin
(Fig. 6C). Cooperation between
the somite and the splanchnopleural mesoderm is thus required at this stage to
construct the aorta. As only splanchnopeural-derived ECs have the capacity to
generate hematopoietic cells, restriction of hematopoiesis to the aortic floor
is obvious.
Second remodeling: the hemogenic endothelium disappears from the aortic floor and a new floor is contributed to by somite-derived ECs
A new finding is that the hemogenic endothelium lining the aortic floor
disappears and is replaced by somite-derived ECs. Replacement is tightly
associated with the production of intra-aortic clusters, always of host origin
(Fig. 6D,E). When intra-aortic
hematopoiesis has ceased, aortic ECs are totally of quail origin, and thus
from the somite (Fig. 6F).
Contrary to the first remodeling phase, ECs are now able to cross the ventral
midline to settle in the contralateral side of the host. However, they never
enter visceral organs, suggesting a tight spatiotemporal control of EC
distribution in the embryo.
|
|
The somite: a source of smooth muscle cells
This origin had been proposed some years ago
(Brand-Saberi and Christ, 2000
)
but has never been demonstrated experimentally. Our unpublished results show
that, contrary to head and heart (Le
Douarin et al., 2004
), trunk neural crest cells do not contribute
to VSM cells. Several origins for trunk VSM cells have been proposed. One
privileged hypothesis is that EC-secreted factors locally recruit mesodermal
cells surrounding the vessels (Drake et
al., 1998
; Hungerford and
Little, 1999
). The fact that QCPN+ cells initiate
SMA expression in the vicinity of the aorta is in keeping with this
hypothesis. It has also been proposed that ECs may generate smooth muscle
cells (DeRuiter et al., 1997
).
This hypothesis has been revived to experiments with ES cells and lineage
tracing. In vitro and in vivo approaches reported the generation of ECs and
VSM cells from a single mesodermal precursor expressing VEGFR2 or TIE2
(Ema et al., 2003
;
Yamashita et al., 2000
;
Marchetti et al., 2002
).
However, VSM cell traits are also obtained in vitro during establishment of
hematopoietic-supportive stromal cell lines
(Charbord et al., 2002
).
Another hypothesis is the presence of pluripotent precursors, designated as
mesoangioblasts (Minasi et al.,
2002
; Cossu and Bianco,
2003
). Our tracing experiments show that retroviral expression is
mainly restricted to ECs, identified with MEP21 expression, and is rarely
found in the tunica media. Thus, ECs do not make a major contribution to VSM
cell when integrated into a vascular structure. However, derivation of VSM
cells from ECs at earlier stages cannot be ruled out. When ECs were labeled
with wheat germ agglutinin (WGA) coupled to gold particles, labeled VSM cells
were found. WGA is not, however, a specific marker for ECs but binds
N-acetylglucosamine oligomers at the surface of the cells. Leakage to
subendothelial layers is thus possible. When the aortic endothelium was traced
earlier, at E2 or E3, with either AcLDL-DI or a non-replicative retroviral
vector, derivatives of the tagged cells were restricted to the hematopoietic
lineage and were never found in other cell lineages
(Jaffredo et al., 1998
;
Jaffredo et al., 2000
). In
keeping with this, genetic analyses suggest that EC and VSM cell
differentiation is uncoupled as mice lacking PDGFB or PDGFRß have
functional endothelial cells but lack pericytes
(Lindahl et al., 1997
;
Enge et al., 2002
). A model
based on our results, of the different steps from the paired aorta to the end
of hematopoiesis, is presented in (Fig.
6). In contrast to these in vivo approaches, we now provide
evidence that ECs purified from the embryo change their phenotype and acquire
SMA expression. This lineage switch is striking in the absence of growth
factor or in the presence of TGBß. In the presence of VEGF, ECs retain
endothelial traits and, at the same time, express SMA. Taken together, these
result point out the major differences between in vivo and vitro approaches
and at the same time shed a new light on some yet unexplained results obtained
after in vitro culture.
The somite: a source of pluripotent cells?
Although our data demonstrate that the somite contributes to ECs and VSM
cells of the aorta, the allocation of these cells to a specific somite
compartment remains elusive. A clonal retroviral approach
(Kardon et al., 2002
) showed
that striated muscle cell precursors of the myotome and ECs in the limb share
a common progenitor in the dermomyotome of the somite. More recently, the
existence of dermomyotomal progenitors endowed with dermal and muscle
potential was demonstrated (Ben-Yair and
Kalcheim, 2005
), leading to the suggestion that the dermomyotome
harbored an homogeneous population of self-renewing progenitors able to give
rise to different lineages. Do VSM cells originate from the same stem cell
compartment or do they differentiate from an alternative source of cells? Our
experimental approach with transplantation of the entire somite, do not allow
us to identify which compartment contributes to VSM cells. However, our
immunohistological analyses show that VSM cell precursors colonize the aorta
from the medioventral aspect of the somite, in close association with the
sclerotomal compartment. Whether VSM cell precursors actually originate from
the sclerotome or from the dermomyotome and cross the sclerotome is currently
under investigation. In addition, molecular markers of VSM cell precursors are
required.
SMA is expressed in differentiated smooth muscle and
furthermore its expression is shared with the striated muscle lineage. The
recent identification of myocardin and myocardin-like molecules as master
regulators for smooth muscle cell differentiation may provide better
identification of smooth muscle cell progenitors and their fates during
embryogenesis. In addition, an eventual link with mesoangioblasts stem cells
can be tested as smooth muscle differentiation of these cells depends on
different regulatory genes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ambler, C. A., Nowicki, J. L., Burke, A. C. and Bautch, V. L. (2001). Assembly of trunk and limb blood vessels involves extensive migration and vasculogenesis of somite-derived angioblasts. Dev. Biol. 234,352 -364.[CrossRef][Medline]
Ben-Yair, R. and Kalcheim, C. (2005). Lineage
analysis of the avian dermomyotome sheet reveals the existence of single cells
with both dermal and muscle progenitor fates.
Development 132,689
-701.
Bergwerff, M., Verberne, M. E., DeRuiter, M. C., Poelmann, R. E.
and Gittenberger-de Groot, A. C. (1998). Neural crest cell
contribution to the developing circulatory system: implications for vascular
morphology? Circ. Res.
82,221
-231.
Bollérot, K., Romero, S., Dunon, D. and Jaffredo, T.
(2005). Core binding factor in the early avian embryo: cloning of
Cbfbeta and combinatorial expression patterns with Runx1. Gene
Expr. Patterns 6,1
-11.
Bollérot, K., Sugiyama, D., Escriou, V., Gautier, R., Tozer, S., Scherman, D. and Jaffredo, T. (2006). Widespread lipoplex-mediated gene transfer to vascular endothelial cells and hemangioblasts in the vertebrate embryo. Dev. Dyn. 235,105 -114.[CrossRef][Medline]
Brand-Saberi, B. and Christ, B. (2000). Evolution and development of distinct cell lineages derived from somites. Curr. Top. Dev. Biol. 48, 1-42.[Medline]
Charbord, P., Oostendorp, R., Pang, W., Herault, O., Noel, F., Tsuji, T., Dzierzak, E. and Péault, B. (2002). Comparative study of stromal cell lines derived from embryonic, fetal, and postnatal mouse blood-forming tissues. Exp. Hematol. 30,1202 -1210.[CrossRef][Medline]
Christ, B., Poelmann, R. E., Mentink, M. M. and Gittenberger-de Groot, A. C. (1990). Vascular endothelial cells migrate centripetally within embryonic arteries. Anat. Embryol. (Berl.) 181,333 -339.[Medline]
Cossu, G. and Bianco, P. (2003). Mesoangioblasts - vascular progenitors for extravascular mesodermal tissues. Curr. Opin. Genet. Dev. 13,537 -542.[CrossRef][Medline]
de Bruijn, M., Ma, X., Robin, C., Ottersbach, K., Sanchez, M. J. and Dzierzak, E. (2002). Hematopoietic stem cells localise to the endothelial cell layer in the midgestation mouse aorta. Immunity 16,673 -683.[CrossRef][Medline]
DeRuiter, M. C., Poelmann, R. E., VanMunsteren, J. C., Mironov,
V., Markwald, R. R. and Gittenberger-de Groot, A. C. (1997).
Embryonic endothelial cells transdifferentiate into mesenchymal cells
expressing smooth muscle actins in vivo and in vitro. Circ.
Res. 80,444
-451.
Drab, M., Haller, H., Bychkov, R., Erdmann, B., Lindschau, C., Haase, H., Morano, I., Luft, F. C. and Wobus, A. M. (1997). From totipotent embryonic stem cells to spontaneously contracting smooth muscle cells: a retinoic acid and db-cAMP in vitro differentiation model. FASEB J. 11,905 -915.[Abstract]
Drake, C. J., Hungerford, J. E. and Little, C. D.
(1998). Morphogenesis of the first blood vessels. Ann.
New York Acad. Sci 857,155
-179.
Eichmann, A., Marcelle, C., Breant, C. and Le Douarin, N. M. (1993). Two molecules related to the VEGF receptor are expressed in early endothelial cells during avian embryonic development. Mech. Dev. 42,33 -48.[CrossRef][Medline]
Ema, M., Faloon, P., Zhang, W. J., Hirashima, M., Reid, T.,
Stanford, W. L., Orkin, S., Choi, K. and Rossant, J. (2003).
Combinatorial effects of Flk1 and Tal1 on vascular and hematopoietic
development in the mouse. Genes Dev.
17,380
-393.
Enge, M., Bjarnegard, M., Gerhardt, H., Gustafsson, E., Kalen, M., Asker, N., Hammes, H. P., Shani, M., Fassler, R. and Betsholtz, C. (2002). Endothelium-specific platelet-derived growth factor-B ablation mimics diabetic retinopathy. EMBO J. 21,4307 -4316.[CrossRef][Medline]
Etchevers, H. C., Vincent, C., Le Douarin, N. M. and Couly, G. F. (2001). The cephalic neural crest provides pericytes and smooth muscle cells to all blood vessels of the face and forebrain. Development 128,1059 -1068.[Abstract]
Fraser, S. T., Ogawa, M., Yu, R. T., Nishikawa, S. and Yoder, M. C. (2002). Definitive hematopoietic commitment within the embryonic vascular endothelial-cadherin(+) population. Exp. Hematol. 30,1070 -1078.[CrossRef][Medline]
Gautier, R., Drocourt, D. and Jaffredo, T. (1996). Generation of small fusion genes carrying phleomycin resistance and Drosophila alcohol dehydrogenase reporter properties: their application in retroviral vectors. Exp. Cell Res. 224,291 -301.[CrossRef][Medline]
Gautier, R., Jiang, A., Rousseau, V., Dornburg, R. and Jaffredo,
T. (2000). Avian reticuloendotheliosis virus strain A and
spleen necrosis virus do not infect human cells. J.
Virol. 74,518
-522.
Hirai, H., Ogawa, M., Suzuki, N., Yamamoto, M., Breier, G.,
Mazda, O., Imanishi, J. and Nishikawa, S. (2003). Hemogenic
and nonhemogenic endothelium can be distinguished by the activity of fetal
liver kinase (Flk)-1 promoter/enhancer during mouse embryogenesis.
Blood 101,886
-893.
Hungerford, J. E. and Little, C. D. (1999). Developmental biology of the vascular smooth muscle cell: building a multilayered vessel wall. J. Vasc. Res. 36, 2-27.[CrossRef][Medline]
Jaffredo, T., Gautier, R., Eichmann, A. and Dieterlen-Lièvre, F. (1998). Intraaortic hemopoietic cells are derived from endothelial cells during ontogeny. Development 125,4575 -4583.[Abstract]
Jaffredo, T., Gautier, R., Brajeul, V. and Dieterlen-Lièvre, F. (2000). Tracing the progeny of the aortic hemangioblast in the avian embryo. Dev. Biol. 224,204 -214.[CrossRef][Medline]
Jaffredo, T., Bollérot, K., Sugiyama, D., Gautier, R. and Drevon, C. (2005a). Tracing the hemangioblast during embryogenesis: developmental relationships between endothelial and hematopoietic cells. Int. J. Dev. Biol. 49,269 -277.[CrossRef][Medline]
Jaffredo, T., Nottingham, W., Liddiard, K., Bollérot, K., Pouget, C. and de Bruijn, M. (2005b). From hemangioblast to hematopoietic stem cell: an endothelial connection? Exp. Hematol. 33,1029 -1040.[CrossRef][Medline]
Jeurissen, S. H. and Janse, E. M. (1998). The use of chicken-specific antibodies in veterinary research involving three other avian species. Vet. Q. 20,140 -143.[Medline]
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cardiac neural crest. Development 127,1607 -1616.[Abstract]
Jordan, H. E. (1917). Aortic cell clusters in
vertebrate embryos. Proc. Natl. Acad. Sci. USA
3, 149-156.
Kardon, G., Campbell, J. K. and Tabin, C. J. (2002). Local extrinsic signals determine muscle and endothelial cell fate and patterning in the vertebrate limb. Dev. Cell 3,533 -545.[CrossRef][Medline]
Klessinger, S. and Christ, B. (1996). Axial structures control laterality in the distribution pattern of endothelial cells. Anat. Embryol. (Berl.) 193,319 -330.[Medline]
Le Douarin, N. M., Creuzet, S., Couly, G. and Dupin, E.
(2004). Neural crest cell plasticity and its limits.
Development 131,4637
-4650.
Le Lièvre, C. S. and Le Douarin, N. M. (1975). Mesenchymal derivatives of the neural crest: analysis of chimaeric quail and chick embryos. J. Embryol. Exp. Morphol. 34,125 -154.[Medline]
Lindahl, P., Johansson, B. R., Leveen, P. and Betsholtz, C.
(1997). Pericyte loss and microaneurysm formation in
PDGF-B-deficient mice. Science
277,242
-245.
Marchetti, S., Gimond, C., Iljin, K., Bourcier, C., Alitalo, K.,
Pouyssegur, J. and Pages, G. (2002). Endothelial cells
genetically selected from differentiating mouse embryonic stem cells
incorporate at sites of neovascularization in vivo. J. Cell
Sci. 115,2075
-2085.
McNagny, K. M., Pettersson, I., Rossi, F., Flamme, I.,
Shevchenko, A., Mann, M. and Graf, T. (1997). Thrombomucin, a
novel cell surface protein that defines thrombocytes and multipotent
hematopoietic progenitors. J. Cell Biol.
138,1395
-1407.
Mikawa, T. and Gourdie, R. G. (1996). Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev. Biol. 174,221 -232.[CrossRef][Medline]
Minasi, M. G., Riminucci, M., De Angelis, L., Borello, U.,
Berarducci, B., Innocenzi, A., Caprioli, A., Sirabella, D., Baiocchi, M., De
Maria, R. et al. (2002). The meso-angioblast: a multipotent,
self-renewing cell that originates from the dorsal aorta and differentiates
into most mesodermal tissues. Development
129,2773
-2783.
Minko, K., Bollérot, K., Drevon, C., Hallais, M. F. and Jaffredo, T. (2003). From mesoderm to blood islands: patterns of key molecules during yolk sac erythropoiesis. Gene Expr. Patterns 3,261 -272.[CrossRef][Medline]
Moscovici, C., Moscovici, M. G., Jimenez, H., Lai, M. M., Hayman, M. J. and Vogt, P. K. (1977). Continuous tissue culture cell lines derived from chemically induced tumors of Japanese quail. Cell 11,95 -103.[CrossRef][Medline]
Murray, P. D. F. (1932). The Development "In Vitro" of Blood of the Early Chick Embryo, pp. 497-521.Cambridge: Strangeways Research Laboratory.
Nimmagadda, S., Loganathan, P. G., Wilting, J., Christ, B. and Huang, R. (2004). Expression pattern of VEGFR-2 (Quek1) during quail development. Anat. Embryol. (Berl.) 208,219 -224.[Medline]
Nishikawa, S. I., Nishikawa, S., Hirashima, M., Matsuyoshi, N. and Kodama, H. (1998). Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages. Development 125,1747 -1757.[Abstract]
North, T., Gu, T. L., Stacy, T., Wang, Q., Howard, L., Binder, M., Marin-Padilla, M. and Speck, N. A. (1999). Cbfa2 is required for the formation of intra-aortic hematopoietic clusters. Development 126,2563 -2575.[Abstract]
North, T. E., de Bruijn, M. F., Stacy, T., Talebian, L., Lind, E., Robin, C., Binder, M., Dzierzak, E. and Speck, N. A. (2002). Runx1 expression marks long-term repopulating hematopoietic stem cells in the midgestation mouse embryo. Immunity 16,661 -672.[CrossRef][Medline]
Oberlin, E., Tavian, M., Blazsek, I. and Péault, B.
(2002). Blood-forming potential of vascular endothelium in the
human embryo. Development
129,4147
-4157.
Pardanaud, L. and Dieterlen-Lièvre, F. (1995). Does the paraxial mesoderm of the avian embryo have hemangioblastic capacity? Anat. Embryol. (Berl.) 192,301 -308.[CrossRef][Medline]
Pardanaud, L., Altmann, C., Kitos, P., Dieterlen-Lièvre,
F. and Buck, C. A. (1987). Vasculogenesis in the early quail
blastodisc as studied with a monoclonal antibody recognizing endothelial
cells. Development 100,339
-349.
Pardanaud, L., Yassine, F. and Dieterlen-Lièvre, F.
(1989). Relationship between vasculogenesis, angiogenesis and
haemopoiesis during avian ontogeny. Development
105,473
-485.
Pardanaud, L., Luton, D., Prigent, M., Bourcheix, L.-M., Catala, M. and Dieterlen-Lièvre, F. (1996). Two distinct endothelial lineages in ontogeny, one of them related to hemopoiesis. Development 122,1363 -1371.[Abstract]
Perez-Pomares, J. M., Carmona, R., Gonzalez-Iriarte, M., Atencia, G., Wessels, A. and Munoz-Chapuli, R. (2002). Origin of coronary endothelial cells from epicardial mesothelium in avian embryos. Int. J. Dev. Biol. 46,1005 -1013.[Medline]
San Clemente, H., Dieterlen-Lièvre, F. and Jaffredo, T. (1996). in vivo diversification and migration of chick embryo heart muscle cells: a morphometric analysis with ALV- and SNV-based non-replicative vectors. Dev. Genes Evol. 206,169 -179.[CrossRef]
Sheng, G. and Stern, C. D. (1999). Gata2 and Gata3: novel markers for early embryonic polarity and for non-neural ectoderm in the chick embryo. Mech. Dev. 87,213 -216.[CrossRef][Medline]
Sugiyama, D., Ogawa, M., Hirose, I., Jaffredo, T., Arai, K. and
Tsuji, K. (2003). Erythropoiesis from acetyl LDL
incorporating endothelial cells at the preliver stage.
Blood 101,4733
-4738.
Tavian, M. and Péault, B. (2005). Embryonic development of the human hematopoietic system. Int. J. Dev. Biol. 49,243 -250.[CrossRef][Medline]
Vrancken Peeters, M. P., Gittenberger-de Groot, A. C., Mentink, M. M. and Poelmann, R. E. (1999). Smooth muscle cells and fibroblasts of the coronary arteries derive from epithelial-mesenchymal transformation of the epicardium. Anat. Embryol. (Berl.) 199,367 -378.[CrossRef][Medline]
Wilting, J., Brand-Saberi, B., Huang, R., Zhi, Q., Kontges, G., Ordahl, C. P. and Christ, B. (1995). Angiogenic potential of the avian somite. Dev. Dyn. 202,165 -171.[Medline]
Wilting, J., Eichmann, A. and Christ, B. (1997). Expression of the avian VEGF receptor homologues Quek1 and Quek2 in blood-vascular and lymphatic endothelial and non-endothelial cells during quail embryonic development. Cell Tissue Res. 288,207 -223.[CrossRef][Medline]
Wilting, J., Papoutsi, M., Schneider, M. and Christ, B. (2000). The lymphatic endothelium of the avian wing is of somitic origin. Dev. Dyn. 217,271 -278.[CrossRef][Medline]
Yamashita, J., Itoh, H., Hirashima, M., Ogawa, M., Nishikawa, S., Yurugi, T., Naito, M. and Nakao, K. (2000). Flk1-positive cells derived from embryonic stem cells serve as vascular progenitors. Nature 408,92 -96.[CrossRef][Medline]