First published online 15 February 2006
doi: 10.1242/dev.02281
Development 133, 1069-1077 (2006)
Published by The Company of Biologists 2006
Early Hedgehog signaling from neural to oral epithelium organizes anterior craniofacial development
Johann K. Eberhart*,
Mary E. Swartz,
Justin Gage Crump and
Charles B. Kimmel
Institute of Neuroscience, 1254 University of Oregon, Eugene, OR
97403-1254, USA.
*
Author for correspondence (e-mail:
eberhart{at}uoneuro.uoregon.edu)
Accepted 11 January 2006
 |
SUMMARY
|
|---|
Hedgehog (Hh) signaling plays multiple roles in the development of the
anterior craniofacial skeleton. We show that the earliest function of Hh is
indirect, regulating development of the stomodeum, or oral ectoderm. A subset
of post-migratory neural crest cells, that gives rise to the cartilages of the
anterior neurocranium and the pterygoid process of the palatoquadrate in the
upper jaw, condenses upon the upper or roof layer of the stomodeal ectoderm in
the first pharyngeal arch. We observe that in mutants for the Hh co-receptor
smoothened (smo) the condensation of this specific subset of
crest cells fails, and expression of several genes is lost in the stomodeal
ectoderm. Genetic mosaic analyses with smo mutants show that for the
crest cells to condense the crucial target tissue receiving the Hh signal is
the stomodeum, not the crest. Blocking signaling with cyclopamine reveals that
the crucial stage, for both crest condensation and stomodeal marker
expression, is at the end of gastrulation - some eight to ten hours before
crest cells migrate to associate with the stomodeum. Two Hh genes,
shh and twhh, are expressed in midline tissue at this stage,
and we show using mosaics that for condensation and skeletogenesis only the
ventral brain primordium, and not the prechordal plate, is an important Hh
source. Thus, we propose that Hh signaling from the brain primordium is
required for proper specification of the stomodeum and the stomodeum, in turn,
promotes condensation of a subset of neural crest cells that will form the
anterior neurocranial and upper jaw cartilage.
Key words: Hedgehog, Neurocranium, Neural Crest, Pharyngeal Arch, Stomodeum, Zebrafish
 |
INTRODUCTION
|
|---|
Hedgehog (Hh) signaling is crucial for the development of the anterior face
and skull. Loss of function of a key Hh molecule, Sonic hedgehog (Shh), causes
a wide variety of craniofacial defects, and it is clear that Shh is involved
in multiple steps of craniofacial development
(Cordero et al., 2004
).
However, the existence of these multiple signaling events means that the
precise roles of Hh signaling in individual steps remain largely
unresolved.
Evidence that Hh plays a role in early craniofacial patterning comes from
two different kinds of analyses. First, whereas complete loss of either Shh or
the Hh co-receptor, Smoothened (Smo), causes nearly complete cartilage loss
(Brand et al., 1996
;
Chen et al., 2001
;
Chiang et al., 1996
;
Hu and Helms, 1999
;
Roessler et al., 1996
), less
severe disruptions of the Hh pathway produce defects more specific to the
anterior neurocranium (Brand et al.,
1996
). Second, targeted inactivation of Smo in the mouse,
as well as functional studies in the chicken have shown that Hh signaling is
required for the patterning and outgrowth of the precursors of the
craniofacial skeleton (Abzhanov and Tabin,
2004
; Hu et al.,
2003
; Jeong et al.,
2004
; Washington et al.,
2005
). These analyses suggest a model in which the precursor
domain for the anterior craniofacial skeletal is especially sensitive to Hh
disruption. Therefore, we have detailed the role that Hh plays in patterning
the specific precursor domain of the anterior neurocranium.
Here, we show that zebrafish Hh pathway mutants lose a specific domain of
neural crest-derived skeletal precursors, which normally condense on the
superior surface, or roof, of the stomodeum. By fate mapping and time-lapse
analyses, we find that the neural crest cell precursors for the anterior
neurocranium and pterygoid process, in the upper jaw, migrate to condense onto
the stomodeal roof. Via genetic mosaic analyses, we next show that the ventral
presumptive brain is the crucial source of Hh and that stomodeal ectoderm, not
the neural crest cells, is the crucial recipient of the Hh signal. Moreover,
cyclopamine treatment shows that Hh acts at the end of gastrulation,
substantially before crest cells migrate into the pharyngeal arches.
Therefore, we conclude that Hh has a specific early role in establishing the
local epithelial environment that promotes the development of the anterior
craniofacial skeletal elements.
 |
MATERIALS AND METHODS
|
|---|
Zebrafish embryos
Embryo care has been described previously
(Westerfield, 1993
).
fli1:GFP transgenic embryos express GFP in cartilage-producing cells
as well as vasculature (Lawson and
Weinstein, 2002
). Heterozygous carriers of the hypomorphic
shh allele syutq252 and the smoothened
null allele smub577 were maintained in both AB and
fli1:GFP backgrounds and will be referred to as
shh- and smo- throughout the text for
clarity. gsc:GFP transgenic zebrafish were generated by inserting a
PCR generated 3 kb 5' upstream promoter region of the gsc gene,
primers GC64 (5' AGGACTACCAAGCTTACTTTCTAACAATGCAAAGC 3') and GC66
(5' TAGGACGAGGGATCCCATCACAAGCGAAAAGATGTG 3'), into pG1 (gift of
Chi-Bin Chien) and injecting early one-cell embryos with 160 ng/µl
linearized plasmid. Cyclopamine treatments
(Hirsinger et al., 2004
) were
performed on fli1:GFP transgenic embryos. Shh and Twhh morpholinos
are described elsewhere (Nasevicius and
Ekker, 2000
).
Cellular analyses
colIIa (Yan et al.,
1995
), fgf8 (Reifers
et al., 1998
), pitx2
(Essner et al., 2000
),
shh (Krauss et al.,
1993
) and sox9a
(Cresko et al., 2003
) probes
were used for in situ hybridization
(Westerfield, 1993
). For
cartilage and bone staining, 4 day postfertilization (dpf) zebrafish embryos
were stained with Alcian Blue and flat mounted
(Kimmel et al., 1998
).
Time-lapse recordings, 10-15 minutes/frame, and confocal analysis of
fli1:GFP and smo-;fli1:GFP embryos were performed
according to established protocols (Crump
et al., 2004a
).
Fate mapping and microelectroporation
Fate-map analyses with Kaede (Ando et
al., 2002
) and microelectroporation
(Crump et al., 2004b
) were
performed in albino;fli1:GFP or albino;fli1:GFP;
h2a:GFP transgenic embryos to allow for specific visualization of
neural crest cells and chondrocytes. Kaede mRNA was injected at the
one-cell stage. Green to red photoconversion of Kaede in a three- to five-cell
diameter column was achieved using a DAPI filter set and a 30 µm pinhole.
Embryos were imaged using a Zeiss Pascal confocal microscope and LSM software
immediately post-labeling and again at 4.5 to 5 dpf. The original and skeletal
locations of labeled cells were compiled into a fate map using the eye, the
ventral limit of the crest population and the curvature of the yolk as
landmarks at 12 hpf and the eye, stomodeum and first pharyngeal pouch as
landmarks at 24 hpf. Statistical analysis was performed using JMP software
(SAS Institute, Cary, NC).
Cell transplants
Genetic mosaics were generated as described elsewhere
(Crump et al., 2004a
;
Maves et al., 2002
).
Transplants placed just to the future ventral side of the animal pole
contribute to stomodeal ectoderm (Fig.
7C). Transplanting gsc:GFP-positive cells into the
gsc:GFP-positive region of host embryos at 30% epiboly targeted axial
mesoderm. An anterior craniofacial `skeletal index' was used to quantify the
level of rescue in shh + twhh MO-injected embryos: 0, no
anterior neurocranium or pterygoid process; 1, anterior neurocranium: a very
short midline bar, no pterygoid process; 2, anterior neurocranium: a longer
midline bar extending between the eyes, pterygoid process present; 3, anterior
neurocranium with bilateral trabeculae and slightly truncated ethmoid plate,
pterygoid process present; 4, wild type.
 |
RESULTS
|
|---|
Hh is required for development of the anterior craniofacial skeleton
Brand et al. described a phenotypic series of zebrafish `midline' mutants
in which cartilages of the anterior region of the skull base, or neurocranium,
are increasingly reduced or lost (Brand et
al., 1996
; Kimmel et al.,
2001
). Subsequent identification of the mutated genes, e.g.
gli1 and gli2, showed that all of them are in the Hh pathway
(Karlstrom et al., 1999
;
Wolff et al., 2004
). We
observe that hypomorphic shh mutant larvae display the entire
phenotypic series reported by Brand et al. In the most severe hypomorphs, the
anterior region of the neurocranium, including the midline ethmoid plate and
the bilateral pair of trabeculae, is entirely absent. The more posterior
neurocranium is only relatively mildly reduced
(Fig. 1A,B). The boundary
between the anterior deleted and posterior nondeleted regions is where the
trabeculae meet the basal plate (`polar cartilage' region)
(Cubbage and Mabee, 1996
;
Schilling and Kimmel, 1997
).
Although not reported previously, we also discovered that a specific anterior
region of the palatoquadrate cartilage, the pterygoid process, was also
missing in severely affected shh hypomorphs
(Fig. 1B). The pterygoid
process articulates with the ethmoid, thus connecting the jaw skeleton to the
neurocranium and acting as the upper jaw cartilage
(DeBeer, 1937
). Additionally,
the posterior portions of the palatoquadrates fuse into a single element
bridging the midline. Whereas partial loss of Hh signaling predominantly
affects anterior craniofacial cartilages, more complete reduction of the
pathway, in severe smo loss-of-function mutants
(Chen et al., 2001
), deletes
nearly all cartilage (Fig.
1C).
From these findings, we hypothesized that Hh signaling plays at least two
roles. One function, revealed in the hypomorphic shh mutant and
examined in detail here, is to pattern the formation of the anterior
craniofacial skeleton specifically. A second function, revealed in the
smo mutant, would direct differentiation of nearly all cartilages
later (Long et al., 2003
;
Long et al., 2001
). This
hypothesis predicts that smo mutants would display early specific
defects, even though specific cartilage loss is not observed later due to the
generalized cartilage deficiency. To look for early patterning defects in
smo mutants, we examined the expression of two of the earliest
chondrogenic markers, sox9a (Fig.
2) and colIIa (data not shown). Both markers prefigure
the wild-type neurocranium at 2 dpf. However, anterior neurocranial expression
is completely missing in smo mutants, while posterior neurocranial
expression remains. Hence, as predicted, we see an early
smo- patterning defect that correlates with the
shh- skeletal defect, even though these defects are
obscured in older smo mutants owing to the generalized cartilage
loss.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 1. Anterior craniofacial cartilages are especially sensitive to loss of Hh
signaling. (A) Flat-mounted 4 dpf wild-type anterior craniofacial
cartilages. The anterior neurocranium consists of the trabeculae (TR) and the
ethmoid plate (EP). The polar cartilages (PC) fuse with TR joining the
anterior and more posterior neurocranium. The dorsal first arch cartilage
palatoquadrate (pPQ) and its pterygoid process (PTP) are flat mounted with the
neurocranium. (B) Hypomorphic shh- embryos have
variable anterior neurocranium defects, including loss of anterior
neurocranium and PTP with fusion of pPQ across the midline. (C) Loss of
Hh signaling in smo- embryos eliminates most neurocranium
cartilages obscuring analysis of defects specific to the anterior
neurocranium. N, notochord; WT, wild type. Dorsal views, anterior is leftwards
in all panels. Scale bar: 50 µm.
|
|
The anterior craniofacial skeleton derives from neural crest cells that condense on stomodeal ectoderm
To understand the early role of Hh signaling in development of the
anterior-most head skeleton we need a detailed knowledge of how this region
develops. Pharyngeal cartilages originate from neural crest cells in zebrafish
as in other vertebrates (Köntges and
Lumsden, 1996
; Langille and
Hall, 1988
; Sadaghiani and
Thiebaud, 1987
; Schilling and
Kimmel, 1994
; Tan and
Morriss-Kay, 1986
). We now show that the zebrafish anterior
neurocranium is also neural crest derived (see also
Wada et al., 2005
). We used
photoconversion of Kaede protein to fate map small clusters of cells in the
premigratory anterior cranial neural crest, resulting in labeling in
descendant chondrocytes of the trabeculae and ethmoid cartilages
(Fig. 3). We also confirmed
(Schilling and Kimmel, 1994
)
that the palatoquadrate and Meckel's cartilage derive from this population.
However, labeling never included the polar cartilages or basal plate,
consistent with the proposed mesodermal origin of these more posterior
cartilages (Couly et al., 1993
;
Huang et al., 1997
).

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2. smo- mutant embryos have no anterior neurocranium
precartilage condensations. Embryos were stained with RNA probe to the
precartilage marker sox9a, the pharyngeal arches were dissected away
from the embryos and ventral views of the neurocranium were imaged. (A)
At 48 hpf, sox9a-positive cells prefigure the morphology of the 4 dpf
neurocranium in wild-type embryos. (B) Embryos lacking all Hh signaling
have a complete loss of anterior neurocranium precartilage condensations;
however, immediately posterior precartilage condensations are present (arrows
in A,B). EP, ethmoid plate; TR, trabeculae; WT, wild type. Anterior is
leftwards. Scale bar: 50 µm.
|
|
The fates of specific skeletal elements might be nonrandomly distributed
within the premigratory crest, in spite of overlaps being present. The more
anterior crest cells preferentially contribute to the anterior neurocranium
(Fig. 3A,B), and the more
posterior cells contribute to the first arch pharyngeal skeleton (Meckel's
cartilage and posterior palatoquadrate;
Fig. 3E,F). Notably, the
pterygoid process of the palatoquadrate maps largely in between these two
regions (Fig. 3C,D), in fact
more frequently overlapping with neurocranial fates than with the posterior
palatoquadrate (Fig. 3G,H).
We examined fates of the more anterior region at higher resolution by
marking single crest cells (occasionally neighboring cell pairs) by
microelectroporation before (Fig.
4A) or after (Fig.
4E) migration to the first pharyngeal arch. This method shows the
precursors for the pterygoid process and anterior neurocranial cartilages, and
the dermal parasphenoid bone to be largely localized to a small region along
the side of the neural keel and just posterior to the rudiment of the eye
(Fig. 4, data not shown). The
premigratory domain is largely surrounded by crest cells that contribute, in
part, to non-skeletal tissues such as the sclera of the eye.
This study also reveals that after migration, the neural crest-derived
cells generating the skeletal fates described above all populate the first
pharyngeal arch. Here, those cells forming specifically the pterygoid process
and anterior neurocranium reside within a compact condensation closely
associated with invaginated oral, or stomodeal ectoderm. Furthermore, the
cells in question occupy just the part of the condensation that is present on
the roof of the stomodeal epithelium (Fig.
4E-H, the extent of the domain is demarcated by the broken line in
Fig. 4F). In addition, we
labeled maxillary osteocytes from precursors within this domain in two cases
(data not shown). Fate mapping of postmigratory posterior palatoquadrate and
Meckel's cartilage precursors within the first arch is described elsewhere
(J.G.C., M.E.S., J.K.E. and C.B.K., unpublished). In summary, we show that the
cartilages that have an early and sensitive requirement for Hh signaling also
have a distinctive origin in the neural crest, both before and after crest
cells migrate to the first pharyngeal arch.

View larger version (110K):
[in this window]
[in a new window]
|
Fig. 3. The anterior neurocranium of zebrafish is neural crest-derived.
(A,C,E) Lateral views of premigratory crest labeled via photoconversion of
Kaede at 12 hpf. (B,D,F) Embryos reimaged at 4.5-5 dpf. (A,B) Cells
labeled just posterior to the eye contributed to the ethmoid plate (EP) and
trabeculae (TR). (C,D) Neural crest cells slightly more posterior
contributed to pterygoid process of the palatoquadrate (PTP). (E,F)
Premigratory non-pterygoid palatoquadrate (pPQ) precursors were the most
posteriorly localized first arch derivative. (G,H) Schematic
representations of fate mapping results show an anteroposterior bias in first
arch cartilage elements. Premigratory anterior neurocranium (n=18)
and pterygoid process (n=3) precursors (yellow and olive,
respectively) are localized more anteriorly than Meckel's cartilage (MC)
(n=1) and palatoquadrate (n=11) precursors (red and blue,
respectively). Black outlined circles represent individual labeled embryos.
Small colored dots within a field represent secondary cartilage fates from the
field of cells. (A,C-G) Lateral views. (B,H) Dorsal views. Anterior is
leftwards in all panels. Scale bar: 50 µm.
|
|
Condensation of a subset of first arch crest cells and stomodeal ectoderm marker expression is dependent on Smo function
What is the effect of reduced Hh signaling on early development of the
crest-derived anterior craniofacial precursors? We observed no changes in
crest cell migration between wild types and smo mutants, either by
examining expression of a crest cell marker, sox9b (12 and 18 hpf,
data not shown) or by Kaede labeling of premigratory neural crest cells (see
Fig. S1 in the supplementary material). However, we found that postmigratory
smo- cells in the first arch fail to undergo condensation
on the roof of the stomodeum. To show this defect directly, we made confocal
time-lapse recordings and followed cells expressing the fli1:GFP
transgene, which labels crest cells beginning shortly after their migration
and throughout skeletogenesis. At 20 hpf, postmigratory neural crest cells
distribute in a broad anteroposterior swath in the first arch of wild-type and
smo- embryos alike
(Fig. 5A,E). Similarly, in both
wild type and smo-, the inpocketed stomodeal ectoderm upon
which the crest cells normally condense becomes evident at 21 hpf as an
unlabeled (dark) indentation of the GFP-expressing cell mesenchyme
(Fig. 5B,F, arrowhead).
Beginning at 22 hpf, the wild-type crest cells form a prominent condensation,
coating both the stomodeal roof and floor, i.e. the superior and inferior
surfaces (Fig. 5C,D, see Movie
1 in the supplementary material). By contrast, in smo mutant embryos,
neural crest cells condense only poorly or not at all on the stomodeal roof,
whereas cells condense seemingly normally on the floor of the stomodeum
(Fig. 5G,H, see Movie 2 in the
supplementary material). Thus, the selective requirement for
smo+ in the condensation of crest cells on the stomodeal
roof, but not floor, corresponds exactly to the selective loss of the anterior
neurocranium and pterygoid process cartilages that we fate mapped to this
superior region of the condensation. By 30 hpf, we could detect few, if any,
crest cells condensed on the roof of the stomodeum in smo-
embryos (see below, Fig. 7B). Time lapse analyses of smo- embryos from 22-48 hpf show
that the mesenchymal cells that would normally condense tightly on the roof of
the stomodeum instead remained loosely associated with one another and
eventually migrated immediately posterior to the eye (see Movie 3 in the
supplementary material). In addition, we detect no cell death in these neural
crest cells even as late as 60 hpf (Acridine Orange labeling, data not shown),
suggesting that Hh signaling is necessary for the condensation but not
survival of this subpopulation of first arch neural crest cells.

View larger version (130K):
[in this window]
[in a new window]
|
Fig. 4. Pre- and postmigratory anterior neurocranium and upper jaw precursors
co-localize. Single or two adjacent neural crest cells were labeled via
microelectroporation at 12 hpf (A-D) or 24 hpf (E-H, Meckel's cartilage and
palatoquadrate data reanalyzed from Crump et al. unpublished). (A-D) At
12 hpf, pterygoid process (C, arrows, n=2) and anterior neurocranium
(D, arrow, n=14) precursors are localized to a discrete cluster
postoptically (B). (E-H) Within the first arch, at 24 hpf, pterygoid
process (G, arrow, n=8) and anterior neurocranium (H, arrow,
n=7) progenitors co-mingle on the stomodeal roof, away from Meckel's
cartilage (n=5) and palatoquadrate (n=16) precursors. The
condensed anterior craniofacial neural crest precursor domain is indicated by
arrowheads in E and F. (B,F) Schematic enlargements of A and E showing
compiled fate mapping data for 12 hpf (B) and 24 hpf (F). Anterior
neurocranium, yellow; pterygoid process, olive; non-pterygoid palatoquadrate,
blue; Meckel's cartilage, red. Black dots in B represent fates other than 4.5
dpf skeletal elements. EP, ethmoid plate; MC, Meckel's cartilage; NC, neural
crest; pPQ, non-pterygoid palatoquadrate; PTP, pterygoid process of the
palatoquadrate; TR, trabeculae. Anterior is leftwards in all panels.
(A,B,D-F,H) Dorsal is upwards. (C,G) Dorsal views. Scale bar: 50 µm.
|
|

View larger version (129K):
[in this window]
[in a new window]
|
Fig. 5. Neural crest cells fail to condense upon the stomodeal roof in
smo- embryos. (A-D) Wild-type fli1:GFP
embryo. Movie frames are shown every hour from 20 to 23 hpf. Wild-type crest
cells are condensing on the stomodeum by 22 hpf (C, arrow) and by 23 hpf (D,
arrow) a solid mass surrounding the stomodeum (arrowhead) has formed.
(E-H) Neural crest cell behavior in smo- embryos.
Crest cells are present just posterior to the eye in
smo-;fli1:GFP at 20 hpf (E, arrow). However,
these cells fail to condense on the roof of the stomodeum (F-H, arrow).
Lateral views, dorsal is upwards. WT, wild type. Scale bar: 50 µm.
|
|
The association of the crest-derived mesenchyme with the superior surface
of the stomodeal ectoderm, intimate in the wild type and missing in the
smo mutant, prompted us to look, using marker expression, for defects
in the smo- stomodeum that could indicate a missing
crucial epithelial-mesenchymal interaction
(Crump et al., 2004b
;
Hall, 1992
). pitx2
(expressed broadly in wild type, Fig.
6A), fgf8 (lateral stomodeum,
Fig. 6C) and shh
(medial stomodeum, Fig. 6E) are
all strikingly downregulated in the smo- stomodeum
(Fig. 6B,D,F). Some
shh-expressing cells, probably endodermal but possibly stomodeal, are
still present in the mutant near the midline
(Fig. 6F, see Fig. S2 in the
supplementary material). The stomodeum is not simply missing in smo
mutants; we can detect it by morphology with DIC optics and it expresses
epithelial markers (see Fig. S3 in the supplementary material, data not
shown). Moreover, we detected no cell death by Acridine Orange staining, loss
of proliferation by anti-phosphohistone H3 or alterations of the early
gastrula fate map of the stomodeum in smo- embryos (data
not shown).
Reception of Hh signaling is required in the stomodeal ectoderm, not neural crest cells, for condensation of crest cells on the stomodeal roof
Smo-dependent gene expression points to the stomodeal ectoderm as a
potential direct target of Hh signaling, in which case the disruption of
condensation of the crest-derived mesenchyme in smo mutants could be
indirect. However, the opposite interpretation is also possible: work in mouse
has shown that reception of Hh signaling is required by neural crest cells for
craniofacial development (Jeong et al.,
2004
), and neural crest cells have been shown to regulate the
timing of gene expression in avian facial ectoderm
(Schneider and Helms, 2003
).
To determine which tissue needs to receive Hh signaling to promote crest cell
condensation, we used mosaic analysis with wild-type and
smo- embryos. In wild-type hosts that received transplants
of smo- crest cell precursors, smo-
crest cells condensed apparently normally on the stomodeal roof
(Fig. 7A,C). This rescue
suggests that Smo functions nonautonomously in crest condensation. However, we
rarely observed smo- cells in cartilages at 4 dpf in these
mosaics (data not shown), consistent with a later autonomous Smo-dependency in
crest for cartilage differentiation (as also reported recently by
Wada et al., 2005
). In the
reciprocal experiment, wild-type crest when transplanted into
smo- hosts failed to condense on the stomodeal roof, just
as in smo mutants (Fig.
7B,D), and again suggesting that the Smo requirement for
condensation is crest nonautonomous. Furthermore, time-lapse analyses of
mosaics directly show that wild-type crest cells in the
smo- environment enter the region superior to the
stomodeum (Fig. 7E) but they
fail to condense (Fig. 7F-H,
see Movie 4 in the supplementary material), just as described for the
smo mutants themselves (Fig.
5).

View larger version (112K):
[in this window]
[in a new window]
|
Fig. 6. Loss of Hh function causes loss of stomodeum specification. Lateral
views of 30 hpf (A,B) or 33 hpf (C-F) wild-type (A,C,E) or
smo- (B,D,F) embryos labeled with RNA probe to
pitx2 (A,B), fgf8 (C,D) or shh (E,F). (A)
Wild-type embryos strongly express pitx2 throughout the stomodeum
(arrow), while (B) smo- embryos have no detectable
pitx2 expression in the stomodeum, although a morphologically
identifiable stomodeum is present (outlined in B). (C) fgf8
labels the lateral stomodeum in wild-type embryos (arrow). (D) No
fgf8 expression is detectable in the stomodeum of
smo- embryos. (E) shh labels wild-type
medial stomodeum (arrow). (F) However, shh is not evident in
the stomodeum of smo- embryos, although some medial cells,
presumably endoderm, maintain shh expression. Arrowheads in E and F
indicate the level of sections shown in Fig. S3. Dorsal is upwards. WT, wild
type. Scale bar: 50 µm.
|
|

View larger version (96K):
[in this window]
[in a new window]
|
Fig. 7. Reception of Hh signaling is not required in neural crest cells to
condense on the stomodeum. (A) A tight neural crest cell
condensation coats the stomodeum in wild-type 30 hpf fli1:GFP embryos
(arrow). (B) The region of this condensation superior to the stomodeum
is absent in smo-;fli1:GFP embryos, although
GFP-positive sclera is present surrounding the eye (arrowhead). (C,D) 30 hpf
embryos following transplantation between wild-type and
smo- embryos. (C) smo- neural
crest cells readily condense on the stomodeal roof in wild-type embryos
(arrow, n=12). (D) Crest cells from wild-type donors fail to
condense on the stomodeal roof in smo- embryos, even
though they can populate the region occupied by palatoquadrate and Meckel's
cartilage precursors (n=18). (E-H) Images taken from a
time-lapse recording (n=2) of wild-type crest in a
smo- host. Wild-type neural crest cells are capable of
initially populating the region superior to the stomodeum (E-H, arrow);
however, these cells are not stabilized in this position and eventually
migrate posterior to the eye. Wild-type cells in the Meckel's cartilage domain
condense normally (E-G, arrowhead). Lateral views, dorsal is upwards. nc,
neural crest; WT, wild type. Scale bar: 50 µm.
|
|
These experiments show that Smo function is not directly required in neural
crest cells for condensation. Hence, we used mosaic analysis to examine the
other possibility, that the stomodeum itself is the target of Hh signaling. By
transplanting the rudiment of the stomodeum, we generated mosaic embryos in
which wild-type donor cells contributed to the stomodeum in
smo- hosts. In these mosaics, the smo-
crest cells condensed on the transplanted wild-type stomodeum normally, and
also correctly expressed the chondrogenic marker sox9a
(Fig. 8C,D). Rescue of both the
condensation and sox9a expression was unilateral in the mosaics,
corresponding to the side that received the wild-type stomodeal transplant
(Fig. 8D,E). Sometimes the
transplants included non-stomodeal facial ectoderm. However, stomodeal
ectoderm was the only tissue that always correlated with rescue, suggesting
that the response to Hh signaling is required directly within the stomodeal
precursors. A robust condensation on the stomodeal roof persists for at least
1 day in the mosaics (through at least 48 hpf; see Fig. S4 in the
supplementary material). However, no cartilage develops, which is consistent,
as argued above, with a later direct requirement for Smo function in the
crest-derived skeletogenic cells. Again, the result indicates the occurrence
of a later Hh-signaling event required for skeletogenesis, one separate from
the early signaling for condensation.

View larger version (83K):
[in this window]
[in a new window]
|
Fig. 8. Wild-type stomodeum rescues the condensation of anterior craniofacial
neural crest cells in smo- embryos. (A,C) Lateral
views of fli1:GFP (A) or smo-;fli1:GFP (C)
embryos at 30 hpf following transplantation of wild-type stomodeum. (A)
Neural crest cells condense on the stomodeal roof following control
transplants (arrow). (C) Following transplantation of wild-type
stomodeum into smo-, crest cells condense on the roof of
the stomodeum, in a manner similar to that seen in wild type (arrow,
n=9). (B,D,E) Lateral views of the same embryos in A,C labeled with
RNA probe to sox9a. (B) sox9a-positive cells (arrow) are
clearly visible above the stomodeum (*) in control transplanted
embryos. (D) sox9a-expressing neural crest cells (arrow) are
readily apparent superior to the stomodeum (*) on the side of the
embryo receiving the stomodeal transplant. (E) Control,
non-transplanted, side of the same embryo as B (image flipped to be the same
orientation as that in D). No sox9a-positive cells are observed above the
stomodeum (*). Anterior is leftwards. st, stomodeum; WT, wild type.
Scale bar: 50 µm.
|
|
Hh signaling for anterior craniofacial crest cell condensation is required at the end of gastrulation from the rudiment of the ventral brain
Our mosaic analyses provide direct evidence that the reception of Hh
signaling is required in the stomodeal ectoderm for the condensation of crest
cells upon its roof. When does signaling to the stomodeum occur and what is
the signaling source? To address the first part of this question, we used
timed treatments with cyclopamine to disrupt the Hh pathway at specific stages
and assayed the effects. We found that 4 hours of cyclopamine exposure, if
initiated at 8-12 hpf or earlier, completely eliminated both stomodeal
pitx2 expression and crest cell condensation on the stomodeal roof
(Fig. 9A,C). Later treatments,
even if longer in duration, were less effective by these assays (e.g. an 8
hour treatment from 14-22 hpf; Fig.
9A,D). Consistent with previous findings
(Hirsinger et al., 2004
), we
found ptc1 levels to be highly disrupted 1 hour after cyclopamine
treatment begins (data not shown). Therefore, the crucial time for Hh
signaling to correctly specify marker expression in the stomodeum is about 10
hpf, shortly after gastrulation. Continued Hh signaling after 10 hpf is also
likely to be important (Fig.
9A). Regardless of timing, all cyclopamine treatments resulted in
severe pharyngeal cartilage loss that included first arch palatoquadrate and
Meckel's cartilages (data not shown). Additionally, all cyclopamine treated
embryos lacked the anterior neurocranium
(Fig. 9E,F). However, as crest
cells condense on the stomodeal roof in later treated embryos, the subsequent
loss of the anterior neurocranium is probably due to the cell-autonomous
requirement for Hh signaling as described for the mosaic analyses. Indeed,
ptc1, a Hh signaling readout gene, is not expressed by neural crest
cells at 14 hpf, but can be detected in neural crest cells adjacent to the eye
at 22 hpf (data not shown).

View larger version (82K):
[in this window]
[in a new window]
|
Fig. 9. Hh signaling is required at the end of gastrulation for stomodeum
expression of pitx2 and proper crest cell
condensation. (A) No embryos treated with cyclopamine from 6-10 hpf
or 8-12 hpf express stomodeal pitx2 (blue bars) or condense crest on
the stomodeal roof (red bars). A small number of embryos treated with
cyclopamine from 10-14 hpf express pitx2 in the stomodeum and exhibit
condensation of anterior craniofacial crest cells, whereas the majority of
embryos treated between 14-22 hpf do express pitx2 in the stomodeum
and condense crest cells on the roof of the stomodeum. Control DMSO-treated
embryos all expressed pitx2 and undergo crest cell condensation
normally. (B-D) Effects of cyclopamine treatment on the condensation of
neural crest cells. Anterior craniofacial crest cells condense on the
stomodeal roof in control embryos (B) and embryos treated from 14-22 hpf (D);
however, this crest cell subpopulation fails to condense in embryos treated
from 6-10 hpf (C). (E,F) The anterior neurocranium is deleted in all
cyclopamine-treated embryos. n=10 in each treatment group for
pitx2 expression. Crest cell condensation and neurocranial cartilage
analysis: 6-10 hpf, n=25; 8-12 hpf, n=16; 10-14 hpf,
n=20; 14-22 hpf, n=21; control, n=14. Scale bars:
50 µm.
|
|

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 10. Hh secreted from the ventral presumptive brain, and not the axial
mesoderm, is required for condensation of crest cells on the roof of the
stomodeum and the subsequent formation of the anterior craniofacial
skeleton. (A-C) Lateral views of 30 hpf fli1:GFP embryos
co-injected with shh and twhh morpholinos (Hh MO).
(D-G) Dorsal views of Alcian stained 4 dpf neurocrania and
palatoquadrates from control transplanted embryos (D) or embryos co-injected
with Hh MO (E-G). (A,E) Co-injection of Hh MO causes failure of crest cells to
condense on the stomodeal roof (A, arrowhead) and the development of the
derivatives from this region, the anterior neurocranium and pterygoid process
(E, arrowhead; skeletal index=0.1, n=57). (B,F) Transplantation of
wild-type brain into Hh MO-injected embryos is capable of rescuing the
condensation of neural crest cells (B, arrow) and the skeletal derivatives
almost to wild-type morphology (F, arrow, skeletal index=2.2, n=40,
ANOVA F ratio=64.481, P<0.0001, Tukey-Kramer shows significance is
only attributable to wild-type brain transplant). (C,G) Transplantation of
axial mesoderm, including prechordal plate (C, inset), into Hh MO injected
embryos has no effect on crest cell condensation (C, arrowhead) or on anterior
neurocranium and upper jaw cartilage morphology (G, arrowhead, skeletal
index=0.2, n=14). Anterior is leftwards. am, axial mesoderm; br,
brain; WT, wild type. Scale bar: 50 µm.
|
|
At 10 hpf, the crucial time when the stomodeum must receive Hh signaling,
the only Hh sources present in the head rudiment are Shh and its co-ortholog
Twhh. Specifically, both are expressed in the midline by the ventral neural
keel and the prechordal plate (Ekker et
al., 1995
; Krauss et al.,
1993
). Here, we use Hh-deficient mosaics to test which tissue is
the crucial source of the Hh signal. To create animals deficient for both Shh
and Twhh, we co-injected two morpholinos that individually block translation
of shh or twhh (shh-MO; twhh-MO). The
double morpholino treatment consistently resulted in the loss of crest cell
condensation on the stomodeal roof (Fig.
10A) and a resulting loss of the anterior craniofacial skeleton,
similar to the most severe shh hypomorphic mutants
(Fig. 10; compare D and E with
Fig. 1A and B, see legend for
quantification). The stomodeal expression of pitx2, shh and
fgf8 in shh-MO; twhh-MO embryos was greatly
diminished (data not shown), although less consistently than in smo
mutants. Transplantation of wild-type presumptive ventral midbrain into
shh-MO; twhh-MO hosts was able to significantly rescue both
condensation and skeletal phenotypes (Fig.
10B,F), and the level of rescue positively correlated with the
number of donor cells populating the ventral brain (data not shown). By
contrast, even in instances when donor cells extensively populated the
prechordal plate and notochord, the embryos still developed virtually no
anterior craniofacial skeleton (Fig.
10C,G). Therefore, only the ventral brain is a significant Hh
source for promoting condensation of crest cells on the stomodeal roof.
 |
DISCUSSION
|
|---|
At the end of gastrulation, Hh secreted from the ventral brain primordium
signals to ectodermal precursors of the stomodeum
(Fig. 11A). Hh signaling
specifies a relay, the ability of the stomodeum to interact with cranial
neural crest cells that arrive in the vicinity some 8 to 10 hours later
(Fig. 11B). The relaying
signal from the stomodeum clearly does not involve Hh, probably occurs at
close range, and is required for the condensation of neural crest cells upon
the stomodeal roof. These condensed cells will generate the anterior
craniofacial skeleton - the pterygoid process of the palatoquadrate in the
upper jaw and the anterior neurocranium.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 11. Hh signaling specifies the ability of the stomodeum to condense neural
crest cells on its roof. (A) Schematic of a 10 hpf embryo. Shh
(yellow) secreted from the ventral presumptive brain signals to stomodeum
precursors (red) in the anterior ectoderm. Premigratory neural crest cells
(green) are distant from the Hh source. (B) Later in development,
starting at 21 hpf, the stomodeum signals to neural crest cells through an
unknown mechanism, causing anterior craniofacial neural crest cells to
condense.
|
|
Furthermore, it is clear that for proper craniofacial development multiple
reciprocal signaling interactions must continue after this early Hh-mediated
signal and its relay, that we characterize in this paper. The recent work of
Wada et al. (Wada et al.,
2005
), supported by our own study, clarifies that in zebrafish
there occurs another, later signaling interaction that redeploys Hh, probably
now secreted by oral ectoderm and acting directly on the neural crest. The
second Hh signal requires the first (Fig.
6). Furthermore, specifying the expression of Shh in the stomodeum
appears to require signaling to the ectoderm from the neural crest
(Marcucio et al., 2005
).
An early role for Hh signaling in development of the anterior craniofacial skeleton
The hypothesis just described, particularly the understanding that Hh
functions in two separate interactions, can resolve seemingly contradictory
findings in zebrafish, chicken and mouse. Defects in the distribution of
neural crest cells have been demonstrated in Shh-null mice
(Washington et al., 2005
),
suggesting that the early role of Hh in organizing the condensation of crest
cells on the stomodeal roof may be conserved between zebrafish and mice. In
mouse mosaics, Smo mutant crest cells can form facial prominences in
a wild-type host (Jeong et al.,
2004
), just as we observe smo mutant crest cells can
develop condensations in zebrafish. Furthermore, in both species the mosaics
reveal a crest-autonomous requirement for Smo in the formation of
skeletal elements that stem from these prominences or condensations. In the
chicken, early disruption of Hh signaling causes loss of expression of
Shh and Fgf in facial ectoderm
(Marcucio et al., 2005
),
matching our findings in the zebrafish, even though Marcucio et al. provide an
alternative interpretation to ours, namely that the neural crest relays a Shh
signal to the facial epithelium. Although our hypothesis fully explains their
findings, their model could not work for zebrafish because it requires an
early smo function in the neural crest, and we show this function is
dispensable. We propose that the same early signaling cascade underlying
anterior craniofacial development is widely shared among vertebrates.
The stomodeum as an organizing center for a subset of first arch crest cells
How does the stomodeum organize the condensation and later development of
neural crest cells? Facial ectoderm has been shown to be important for the
proper outgrowth of anterior craniofacial skeletal elements
(Hu et al., 2003
;
MacDonald et al., 2004
), and
here we present data that the oral ectoderm is essential for the initial
condensation of neural crest cells that contribute to these skeletal elements.
The same kinds of ectomesenchymal-epithelial interactions are crucial for
skeletal development in the second arch as well as the first
(Crump et al., 2004a
;
Crump et al., 2004b
). In both
arches, crest cells condense on an epithelium and later chondrogenesis is
strictly correlated with, and presumably dependent upon, condensation.
However, in the second arch, the crucial epithelium revealed in our studies is
the first pharyngeal pouch, derived from endoderm. Furthermore, we find that
Hox gene expression appears to specify the ability of second arch crest cells
to interact with the pouch endoderm (J.G.C., M.E.S., J.K.E. and C.B.K.,
unpublished). First arch crest cells lack Hox gene expression and this
difference could, in part, underlie whether crest cells interact with endoderm
as in the second arch, or with stomodeal ectoderm as in the first arch.
The transcription factor pitx2 is an excellent candidate for a
gene responding to Hh that regulates the role the stomodeum plays in crest
cell condensation. Pitx2 mutations in mouse and human are known to
cause craniofacial defects (Lu et al.,
1999
; Saadi et al.,
2003
; Saadi et al.,
2001
), but it is unclear if these defects are due to the loss of
Pitx2 specifically in the stomodeum. Earlier requirements for
pitx2 in zebrafish (Essner et
al., 2000
) have obscured potential anterior craniofacial defects
in loss-of-function analyses (J.K.E., unpublished). Conditional expression of
dominant-negative Pitx2 (Saadi et
al., 2003
; Saadi et al.,
2001
) within stomodeal ectoderm may be useful for determining the
role of Pitx2 in craniofacial development in the future.
Secreted signaling factors might be involved in the stomodeal-crest cell
interaction. Along with pitx2, both fgf8 and shh
are expressed by the zebrafish stomodeum
(Miller et al., 2004
;
Miller et al., 2000
) and are
lost in smo mutants (this study). We observed little or no overlap of
shh and fgf8 in the wild type, and this apparent restriction
may be functionally relevant because interfaces of shh and
fgf expression are known to direct craniofacial outgrowth in avian
embryos (Abzhanov and Tabin,
2004
; Hu et al.,
2003
; MacDonald et al.,
2004
). We only detect stomodeal shh and fgf8
expression after the time of crest cell condensation, arguing that their role
is indeed in promoting outgrowth, rather than signaling the crest cells to
condense. Although a recent study in zebrafish has reported that the stomodeum
can partially rescue midline ethmoid plate defects in more mildly affected Hh
mutants and shh-MO animals (Wada
et al., 2005
), we find no ability of the stomodeum to rescue the
condensation and development of anterior craniofacial precursors in more
severely affected shh-MO; twhh-MO embryos (data not
shown).
We show that normally first arch crest cells closely adhere to both the
roof and floor of the stomodeal epithelium. Our time-lapse analyses with
mosaics show that wild-type crest cells in the smo mutant environment
contact but fail to condense on the roof of the stomodeum, whereas crest cells
condense normally on the mutant stomodeal floor. A clear inference is that the
stomodeum provides differential adhesive substrates on the roof and floor and
that Hh signaling selectively patterns the roof. Cell-ECM and cell-cell
adhesion, implicated in condensing craniofacial neural crest cells
(McKeown et al., 2005
), may
provide a mechanism for Hh mediated stabilization of anterior craniofacial
neural crest cells. It will be of great interest to discover if any adhesion
molecules are differentially expressed on stomodeal roof versus floor and if
the expression of adhesion molecules on the roof is Hh dependent.
 |
ACKNOWLEDGMENTS
|
|---|
We greatly appreciate comments on the manuscript provided by R. Marcucio,
C. T. Miller and T. Piotrowski. We also to thank W. A. Cresko for his
statistical expertise. We are deeply indebted to J. Dowd, J. Wofford and
Bonnie Ullmann for their expert fish care and technical help. We thank T. F.
Schilling, N. Wada and Y. Javidan for sharing unpublished data. This work was
supported by NIH grants HD22486 and DE13834 to C.B.K.; NIH Ruth L. Kirschstein
NRSA HD043584 to J.K.E.; and an O'Donnell Fellowship of the Life Sciences
Research Foundation to J.G.C.
 |
Footnotes
|
|---|
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/132/6/1069/DC1
 |
REFERENCES
|
|---|
Abzhanov, A. and Tabin, C. J. (2004). Shh and
Fgf8 act synergistically to drive cartilage outgrowth during cranial
development. Dev. Biol.
273,134
-148.[CrossRef][Medline]
Ando, R., Hama, H., Yamamoto-Hino, M., Mizuno, H. and Miyawaki,
A. (2002). An optical marker based on the UV-induced
green-to-red photoconversion of a fluorescent protein. Proc. Natl.
Acad. Sci. USA 99,12651
-12656.[Abstract/Free Full Text]
Brand, M., Heisenberg, C.-P., Warga, R. M., Pelegri, F.,
Karlstrom, R. O., Beuchle, D., Picker, A., Jiang, Y.-J., Furutani-Seiki, M.,
van Eeden, F. J. M. et al. (1996). Mutations affecting
development of the midline and general body shape during zebrafish
embryogenesis. Development
123,129
-142.[Abstract]
Chen, W., Burgess, S. and Hopkins, N. (2001).
Analysis of the zebrafish smoothened mutant reveals conserved and
divergent functions of hedgehog activity. Development
128,2385
-2396.
Chiang, C., Litingtun, Y., Lee, E., Young, K. E., Corden, J. L.,
Westphal, H. and Beachy, P. A. (1996). Cyclopia and defective
axial patterning in mice lacking Sonic hedgehog gene function.
Nature 383,407
-413.[CrossRef][Medline]
Cordero, D., Marcucio, R., Hu, B., Gaffield, W., Tapadia, M. and
Helms, J. A. (2004). Temporal perturbations in sonic hedgehog
signaling elicit the spectrum of holoprosencephaly phenotypes. J.
Clin. Invest. 114,485
-494.[CrossRef][Medline]
Couly, G. F., Coltey, P. M. and LeDouarin, N. M.
(1993). The triple origin of skull in higher vertebrates: a study
in quail-chick chimeras. Development
117,409
-429.[Abstract]
Cresko, W. A., Yan, Y. L., Baltrus, D. A., Amores, A., Singer,
A., Rodriguez-Mari, A. and Postlethwait, J. H. (2003). Genome
duplication, subfunction partitioning, and lineage divergence: Sox9 in
stickleback and zebrafish. Dev. Dyn.
228,480
-489.[CrossRef][Medline]
Crump, J. G., Maves, L., Lawson, N. D., Weinstein, B. M. and
Kimmel, C. B. (2004a). An essential role for Fgfs in
endodermal pouch formation influences later craniofacial skeletal patterning.
Development 131,5703
-5716.[Abstract/Free Full Text]
Crump, J. G., Swartz, M. E. and Kimmel, C. B.
(2004b). An integrin-dependent role of pouch endoderm in hyoid
cartilage development. PLoS Biol.
2,1432
-1445.
Cubbage, C. C. and Mabee, P. M. (1996).
Development of the cranium and paired fins in the zebrafish Danio
rerio (Ostariophysi, Cyprinidae). J. Morphol.
229,121
-160.[CrossRef]
DeBeer, G. R. (1937). The
Development of the Vertebrate Skull. Oxford, UK: Oxford
University Press.
Ekker, S. C., Ungar, A. R., Greenstein, P., Kessler, D. P.,
Porter, J. A., Moon, R. T. and Beachy, P. A. (1995).
Patterning activities of vertebrate hedgehog proteins in the developing eye
and brain. Curr. Biol.
5, 944-955.[CrossRef][Medline]
Essner, J. J., Branford, W. W., Zhang, J. and Yost, H. J.
(2000). Mesendoderm and left-right brain, heart and gut
development are differentially regulated by pitx2 isoforms.
Development 127,1081
-1093.[Abstract]
Hall, B. K. (1992). Tissue interactions in the
development and evolution of the vertebrate head. In Evolutionary
Developmental Biology (ed. B. K. Hall), pp.275
. London, UK: Kluwer Academic.
Hirsinger, E., Stellabotte, F., Devoto, S. H. and Westerfield,
M. (2004). Hedgehog signaling is required for commitment but
not initial induction of slow muscle precursors. Dev.
Biol. 275,143
-157.[CrossRef][Medline]
Hu, D. and Helms, J. A. (1999). The role of
sonic hedgehog in normal and abnormal craniofacial morphogenesis.
Development 126,4873
-4884.[Abstract]
Hu, D., Marcucuio, R. S. and Helms, J. A.
(2003). A zone of frontonasal ectoderm regulates patterning and
growth in the face. Development
130,1749
-1758.[Abstract/Free Full Text]
Huang, R., Zhi, Q., Ordahl, C. P. and Christ, B.
(1997). The fate of the first avian somite. Anat.
Embryol. 195,435
-449.[CrossRef][Medline]
Jeong, J., Mao, J., Tenzen, T., Kottmann, A. H. and McMahon, A.
P. (2004). Hedgehog signaling in the neural crest cells
regulates the patterning and growth of facial primordia. Genes
Dev. 18,937
-951.[Abstract/Free Full Text]
Karlstrom, R. O., Talbot, W. S. and Schief, A. F.
(1999). Comparative synteny cloning of zebrafish
you-too: mutations in the Hedgehog target gli2 affect
ventral forebrain patterning. Genes Dev.
13,388
-393.[Abstract/Free Full Text]
Kimmel, C. B., Miller, C. T., Kruze, G., Ullmann, B., BreMiller,
R. A., Larison, K. D. and Snyder, H. C. (1998). The shaping
of pharyngeal cartilages during early development of the zebrafish.
Dev. Biol. 203,245
-263.[CrossRef][Medline]
Kimmel, C. B., Miller, C. T. and Moens, C. B.
(2001). Specification and morphogenesis of the zebrafish larval
head skeleton. Dev. Biol.
233,239
-257.[CrossRef][Medline]
Köntges, G. and Lumsden, A. (1996).
Rhombencephalic neural crest segmentation is preserved throughout craniofacial
ontogeny. Development
122,3229
-3242.[Abstract]
Krauss, S., Concordet, J. P. and Ingham, P. W.
(1993). A functionally conserved homolog of the
drosophila segment polarity gene hh is expressed in tissues
with polarizing activity in zebrafish embryos. Cell
75,1431
-1444.[CrossRef][Medline]
Langille, R. M. and Hall, B. K. (1988). Role of
the neural crest in development of the cartilaginous cranial and visceral
skeleton of the medaka, Oryzias latipes (Teleostei). Anat.
Embryol. 177,297
-305.[CrossRef][Medline]
Lawson, N. and Weinstein, B. M. (2002). In vivo
imiagining of embryonic vascular development using transgenic zebrafish.
Dev. Biol. 248,307
-318.[CrossRef][Medline]
Long, F., Zhang, X. M., Karp, S., Yang, Y. and McMahon, A.
P. (2001). Genetic manipulation of hedgehog signaling in the
endochondral skeleton reveals a direct role in the regulation of chondrocyte
proliferation. Development
128,5099
-5108.
Long, F., Chung, U.-I., Ohba, S., McMahon, J., Kronenberg, H. M.
and McMahon, A. P. (2003). Ihh signaling is directly required
for the osteoblast lineage in the endochondral skeleton.
Development 131,1309
-1318.
Lu, M.-F., Pressman, C., Dyer, R., Johnson, R. L. and Martin, J.
F. (1999). Function of Rieger syndrom gene in left-right
asymmetry and craniofacial development. Nature
401,276
-278.[CrossRef][Medline]
MacDonald, M. E., Abbott, U. K. and Richman, J. M.
(2004). Upper beak truncation in chicken embryos with the Cleft
primary palate mutation is due to an epithelial defect in the frontonasal
mass. Dev. Dyn. 230,335
-349.[CrossRef][Medline]
Marcucio, R. S., Cordero, D. R., Hu, D. and Helms, J. A.
(2005). Molecular interactions coordinating the development of
the forebrain and face. Dev. Biol.
284, 48-61.[CrossRef][Medline]
Maves, L., Jackman, W. and Kimmel, C. B.
(2002). FGF3 and FGF8 mediate a rhombomere 4 signaling activity
in the zebrafish hindbrain. Development
129,3825
-3837.
McKeown, S. J., Newgreen, D. F. and Farlie, P. G.
(2005). Dlx2 over-expression regulates cell adhesion and
mesenchymal condensation in ectomesenchyme. Dev. Biol.
281, 22-37.[CrossRef][Medline]
Miller, C. T., Schilling, T. F., Lee, K.-H., Parker, J. and
Kimmel, C. B. (2000). sucker encodes a zebrafish endothelin-1
required for ventral pharyngeal arch development.
Development 127,3815
-3828.[Abstract]
Miller, C. T., Maves, L. and Kimmel, C. B.
(2004). moz regulates Hox expression and pharyngeal segment
identity in zebrafish. Development
131,2443
-2461.[Abstract/Free Full Text]
Nasevicius, A. and Ekker, S. C. (2000).
Effective targeted gene `knockdown' in zebrafish. Nat.
Genet. 26,216
-220.[CrossRef][Medline]
Reifers, F., Bohli, H., Walsh, E. C., Crossley, P. H., Stainier,
D. Y. R. and Brand, M. (1998). Fgf8 is mutated in zebrafish
acerebellar (ace) mutants and is required for maintenance of
midbrain-hindbrain boundary development and somitogenesis.
Development 125,2381
-2395.[Abstract]
Roessler, E., Belloni, E., Gaudenz, K., Jay, P., Berta, P.,
Scherer, S. W., Tsui, L. C. and Muenke, M. (1996). Mutations
in the human sonic hedgehog gene cause holoprosencephaly. Nat.
Genet. 14,357
-360.[CrossRef][Medline]
Saadi, I., Semina, E. V., Amendt, B. A., Harris, D. J., Murphy,
K. P., Murray, J. C. and Russo, A. F. (2001). Identification
of a dominant negative homeodomain mutation in Rieger syndrom. J.
Biol. Chem. 276,23034
-23041.[Abstract/Free Full Text]
Saadi, I., Kuburas, A., Engle, J. J. and Russo, A. F.
(2003). Dominant negative dimerization of a mutant homeodomain
protein in Axenfeld-Rieger Syndrome. Mol. Cell. Biol.
23,1968
-1982.[Abstract/Free Full Text]
Sadaghiani, B. and Thiebaud, C. H. (1987).
Neural crest development in the Xenopus laevis embryo, studied by
interspecific transplantation and scanning electron microscopy.
Dev. Biol. 124,91
-110.[CrossRef][Medline]
Schilling, T. F. and Kimmel, C. B. (1994).
Segment and cell type lineage restrictions during pharyngeal arch development
in the zebrafish embryo. Development
120,483
-494.[Abstract]
Schilling, T. F. and Kimmel, C. B. (1997).
Musculoskeletal patterning in the pharyngeal segments of the zebrafish embryo.
Development 124,2945
-2960.[Abstract]
Schneider, R. A. and Helms, J. A. (2003). The
cellular and molecular origins of beak morphology.
Science 299,565
-568.[Abstract/Free Full Text]
Tan, S. S. and Morriss-Kay, G. (1986). Analysis
of cranial neural crest cell migration and early fates in postimplantation rat
chimaeras. J. Embryol. Exp. Morphol.
98, 21-58.[Medline]
Wada, N., Javidan, Y., Nelson, S., Carney, T. J., Kelsh, R. N.
and Schilling, T. F. (2005). Hedgehog signaling is required
for cranial neural crest morphogenesis and chondrogenesis at the midline in
the zebrafish skull. Development
132,3977
-3988.[Abstract/Free Full Text]
Walshe, J. and Mason, I. (2003). Fgf signalling
is required for formation of cartilage in the head. Dev.
Biol. 264,522
-536.[CrossRef][Medline]
Washington, S. I., Byrd, N. A., Abu-Issa, R., Goddeeris, M. M.,
Anderson, R., Morris, J., Yamamura, K., Klingensmith, J. and Meyers, E. N.
(2005). Sonic hedgehog is required for cardiac outflow tract and
neural crest cell development. Dev. Biol.
283,357
-372.[CrossRef][Medline]
Westerfield, M. (1993). The
Zebrafish Book: A Guide for the Laboratory use of Zebrafish (Brachydanio
rerio). Eugene, OR: University of Oregon.
Wolff, C., Roy, S., Lewis, K. E., Schauerte, H., Joerg-Rauch,
G., Kirn, A., Weiler, C., Geisler, R., Haffter, P. and Ingham, P. W.
(2004). iguana encodes a novel zinc-finger protein with
coiled-coil domains essential for Hedgehog signal transduction in the
zebrafish embryo. Genes Dev.
18,1565
-1576.[Abstract/Free Full Text]
Yan, Y. L., Hatta, K., Riggleman, B. and Postlethwait, J. H.
(1995). Expression of a type II collagen gene in the zebrafish
embryonic axis. Dev. Dyn.
203,363
-376.[Medline]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. M. Drerup, H. M. Wiora, J. Topczewski, and J. A. Morris
Disc1 regulates foxd3 and sox10 expression, affecting neural crest migration and differentiation
Development,
August 1, 2009;
136(15):
2623 - 2632.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. M Smith, M. Okabe, and J. Joss
Spatial and temporal pattern for the dentition in the Australian lungfish revealed with sonic hedgehog expression profile
Proc R Soc B,
February 22, 2009;
276(1657):
623 - 631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Hu and R. S. Marcucio
A SHH-responsive signaling center in the forebrain regulates craniofacial morphogenesis via the facial ectoderm
Development,
January 1, 2009;
136(1):
107 - 116.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. A. Thomas, M. Koudijs, F. J. M. van Eeden, A. L. Joyner, and D. Yelon
Hedgehog signaling plays a cell-autonomous role in maximizing cardiac developmental potential
Development,
November 15, 2008;
135(22):
3789 - 3799.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Laue, M. Janicke, N. Plaster, C. Sonntag, and M. Hammerschmidt
Restriction of retinoic acid activity by Cyp26b1 is required for proper timing and patterning of osteogenesis during zebrafish development
Development,
November 15, 2008;
135(22):
3775 - 3787.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. B. Kimmel and J. K. Eberhart
The midline, oral ectoderm, and the arch-0 problem
Integr. Comp. Biol.,
November 1, 2008;
48(5):
668 - 680.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Nair, W. Li, R. Cornell, and T. F. Schilling
Requirements for Endothelin type-A receptors and Endothelin-1 signaling in the facial ectoderm for the patterning of skeletogenic neural crest cells in zebrafish
Development,
January 15, 2007;
134(2):
335 - 345.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. W. Stock, W. R. Jackman, and J. Trapani
Developmental genetic mechanisms of evolutionary tooth loss in cypriniform fishes
Development,
August 15, 2006;
133(16):
3127 - 3137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. M. Brito, M.-A. Teillet, and N. M. Le Douarin
An early role for Sonic hedgehog from foregut endoderm in jaw development: Ensuring neural crest cell survival
PNAS,
August 1, 2006;
103(31):
11607 - 11612.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. G. Crump, M. E. Swartz, J. K. Eberhart, and C. B. Kimmel
Moz-dependent Hox expression controls segment-specific fate maps of skeletal precursors in the face
Development,
July 15, 2006;
133(14):
2661 - 2669.
[Abstract]
[Full Text]
[PDF]
|
 |
|