|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 1 March 2006
doi: 10.1242/dev.02297
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Center for Translational and Advanced Animal Research on Human Diseases,
Division of Developmental Neuroscience, Graduate School of Medicine, Tohoku
University, Sendai, Miyagi 980-8575, Japan.
2 Department of Developmental Neurobiology, Graduate School of Medicine, Tohoku
University, Sendai, Miyagi 980-8575, Japan.
* Author for correspondence (e-mail: wakasama{at}mail.tains.tohoku.ac.jp)
Accepted 24 January 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Neural crest, Sox9, Slug, Snail2, PKA, BMP, EMT, Quail
| INTRODUCTION |
|---|
|
|
|---|
Bone morphogenetic protein (BMP) signaling is important for the neural
crest induction. For example, BMP2/4/7 can induce neural crest markers, such
as Snail2 (previously known as Slug) and HNK-1 in neural
plate explants (Liem et al.,
1995
; Liem et al.,
1997
; Liu and Jessell,
1998
; Marchant et al.,
1998
; García-Castro et
al., 2002
; Wakamatsu et al.,
2004a
) and the BMP signal is required for the crest induction in
head neural folds of avian embryos (Endo
et al., 2002
). Recently, we showed that Notch signaling regulates
Bmp4 expression and thereby crest formation
(Endo et al., 2002
;
Endo et al., 2003
), but other
signals, such as Wnt, FGF and retinoids also appear to be involved in neural
crest formation in various vertebrate species
(LaBonne and Bronner-Fraser,
1998
; García-Castro et
al., 2002
; Villanueva et al.,
2002
; Monsono-Burq et al.,
2003
; Bastidas et al.,
2004
).
Under the influence of inducing signals, expression of crest-specific
transcription factors will be promoted to regulate the following events in the
crest development. Snail and Snail2 [see Barrallo-Gimeno and
Nieto (Barrallo-Gimeno and Nieto,
2005
) for nomenclature] genes, both of which encode Zn-finger-type
transcription factors, have been shown to be involved in neural crest
formation and subsequent EMT (Nieto et
al., 1994
; LaBonne and
Bronner-Fraser, 2000
; del
Barrio and Nieto, 2002
). Other transcription factor genes, such as
Msx1, Foxd3 and group E Sox genes (Sox8, Sox9 and
Sox10), are also involved in early events of neural crest development
(Kos et al., 2001
;
Sasai et al., 2001
;
Dottori et al., 2001
;
Spokony et al., 2002
;
Cheung and Briscoe, 2003
;
Honore et al., 2003
;
Tribulo et al., 2003
;
Lee et al., 2004
;
Cheung et al., 2005
;
McKeown et al., 2005
). By
contrast, Sox2, a member of the group B1 Sox genes, is
expressed in the neural plate and inhibits neural crest formation and EMT
(Wakamatsu et al., 2004a
).
Among these transcription factor genes, Sox9 appears to have a
central role in neural crest formation and subsequent EMT. In mice carrying a
mutation in Sox9, the number of crest cells is severely decreased
(Cheung et al., 2005
). Both in
Xenopus and chicken embryos, Sox9 overexpression promotes an
increase of crest-like cells (Spokony et
al., 2002
; Cheung and Briscoe,
2003
; McKeown et al.,
2005
).
Despite rapid progress in this field to identify genes involved in neural
crest development, hierarchical relationship of such genes is largely elusive.
In particular, our knowledge on the regulation of crest-specific genes at
transcriptional level is extremely limited. In our previous study, we analyzed
the regulation of the promoter activity of chick Snail2, and revealed
that Snail2 is directly regulated by BMP and Wnt signals
(Sakai et al., 2005
). In this
study, we show: (1) that Sox9 function is required for BMP-mediated
Snail2 induction and EMT; (2) that Sox9 directly activates the
Snail2 promoter in synergy through a physical interaction with Snail2
protein; and (3) that cAMP-dependent protein kinase (PKA) signal facilitates
Snail2 induction and EMT, partly by promoting Sox9 and Snail2
function. Our results provide significant steps forward in understanding the
regulation of early neural crest development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Expression vectors
The coding sequences of quail Snail2, Sox9 and PKIß
were PCR-amplified from oligo (dT)-primed E2 embryo cDNA, and inserted into
pyDF30 for N-terminal FLAG-tagging and expression. Sox9 was also
subcloned into pyDF-HA for N-terminal-HA tagging. The zinc-finger domain of
Snail2 cDNA was further PCR amplified, and fused to the activation
domain of VP16 and repression domain of Engrailed2 (a gift
from Dr H. Nakamura) (Matsunaga et al.,
2000
). To generate a repressor form of Sox9, the
C-terminal sequence downstream of its HMG-domain was removed,
Engrailed2 repression domain was connected (pyDF30
FLAG-Sox9-En), and to facilitate nuclear localization, a nuclear
translocation signal taken from pDsRed2-nuc (Clontech) was inserted between
Sox9 and Engrailed2 sequences
(pyDF30-FLAG-Sox9-En-nuc). Dominant-negative action of this
Sox9 mutant over wild type was confirmed by a Luciferase
assay with Snail2 D0.3 reporter in NIH3T3 cells (not shown).
Expression vectors of chicken Sox10
(Cheng et al., 2000
), chicken
Foxd3 (Kos et al.,
2001
) and mouse Msx1 were kindly provided by Drs P.
Scotting, C. Erickson and K. Tamura, respectively. CA-PKA and
Sox9m1m2 were generous gifts from Dr B. de Crombrugghe
(Huang et al., 2000
). pEGFP-N1
was purchased from Clontech.
In situ hybridization
Whole-mount in situ hybridization was performed as described previously
(Wakamatsu and Weston, 1997
).
Quail Snail2 cDNA for cRNA probe was described previously
(Wakamatsu et al., 2004b
).
Quail Sox9 was PCR-amplified from oligo (dT)-primed E2 embryo cDNA.
Chicken cDNAs of Sox10 (Cheng et
al., 2000
), Foxd3
(Kos et al., 2001
),
Msx1 and Msx2 were kind gift from Drs P. Scotting, C.
Erickson and K. Tamura, respectively.
Luciferase assay
The upstream sequences of Snail2 subcloned into pGL3-basic
(Amersham-Pharmacia) Luciferase assay vector were described
previously (Sakai et al.,
2005
). NIH3T3 cells were transfected with a Luciferase
reporter and effector plasmid DNAs with LipofectAMINE Plus reagent
(Invitrogen). pRL-TK was always co-transfected to normalize for transfection
efficiency (Dual-Luciferase Assay System; Promega). Cell lysates were prepared
for Luciferase activity after 24 hours of culture with PicaGene Dual
kit (Toyo Ink). To activate PKA signal, 1 mM of cAMP analog 8-bromo-cAMP
(Calbiochem) was added in culture. Activation of the signal was confirmed by
the activation of pCRE-luciferase reporter (Clontech).
The Luciferase reporter constructs were also electroporated to
medial neural plate of stage 6 quail embryo and neural plate explants were
taken from embryos as described below. pRL-SV40 (Amersham-Pharmacia) was
co-electroporated to normalize for electroporation efficiency. Neural plate
explants were cultured as described below (see also
Wakamatsu et al., 2004a
).
Cells were collected and Luciferase activity was assayed after 20
hours of culture.
Electro-mobility shift assay (EMSA)
Recombinant GST-Snail2 fusion protein was purified from bacterial lysate
carrying pET11GST-Snail2 expression vector. Sox9 proteins were
produced by an in vitro transcription/translation system using TNT T7 Quick
Master mix (Promega). The DNA-binding mix contained proteins and
32P-labeled double-strand oligonucleotide in a binding buffer [10
mM HEPES (pH 7.9), 100 mM NaCl, 1 mM DTT, 5 mM EDTA, 5% glycerol and 150 ng of
poly (d(I-C))]. The binding reaction was performed with or without unlabeled
competitor DNA, incubated at 30°C for 30 minutes. After incubation,
reaction mixtures were subjected to electrophoresis and signals were detected
by autoradiography. The nucleotide sequence of the probes and competitors were
as follows: E-box2, AACCCCCCTGCACCTGACTTGCG; mE-box2, AACCCCCCTGACCGAGACTTGCG;
mE-box2(1), GAGCAGAAAACCCAACCCCCCTG; mE-box2(2), CACCTGACTTGCGGGTATTTACG;
mE-box2(3), ACAACCCCTGCACCTGACTTGCG; mE-box2(4), AACCAAACTGCACCTGACTTGCG;
mE-box2(5), AACCCCCAGTCACCTGACTTGCG.
Co-immunoprecipitation assay
Sox9 full coding sequence, N-terminal deletion
(Sox9
N, carrying amino acids 253-494) and C-terminal
deletion (Sox9
C, carrying amino acids 1-253) were
subcloned into pyDF-HA for N-terminal HA-tagging
(Fig. 5A). These constructs
were transfected into COS7 cells with LipofectAMINE Plus reagent (Invitrogen).
Snail2 full coding sequence, N-terminal deletion
(Snail2
N, corresponding to amino acids 121-268), and
C-terminal deletion (Snail2
C, corresponding to amino
acids 1-121) were subcloned into pET11-GST for N-terminal GST-tagging, and
transformed E. coli BL21(DE3) strain
(Fig. 5A). Recombinant
GST-Snail2 proteins were purified from whole cell lysates by B-PER GST Fusion
Protein Purification kit (PIERCE).
To detect the interaction of GST-Snail2 fusion proteins and HA-Sox9 proteins, immunoprecipitation was performed using ProFound Mammalian HA-tag IP/Co-IP kit (PIERCE). After 24 hours of culture, COS7 cells transfected with HA-Sox9 constructs were lysed in M-PER buffer (PIERCE) and GST-Snail2 fusion proteins were added into the cell lysate, and incubated for 24 hours at 4°C with gentle agitation. Protein complexes in cell extracts were precipitated with immobilized anti-HA antibody agarose beads (PIERCE). Precipitated complexes were eluted by elution buffer and denatured in SDS sample buffer at 95°C for 5 minutes. Co-precipitated proteins were separated by SDS-PAGE, and detected by western blotting using anti-HA (Roche) and anti-GST (Santa Cruz) antibodies.
Neural plate explant culture
Cultures of neural plate explants were performed as described previously
(Wakamatsu et al., 2004a
;
Sakai et al., 2005
). In brief,
intermediate fragments of the neural plate at the level of fore- and midbrain
were surgically dissected with a tungsten needle along with underlying
mesoderm and endoderm. To remove the mesoderm and the endoderm, the dissected
tissues were treated with Pancreatin (Gibco). The isolated neural plates were
cultured in F12-based medium containing 3% FCS on fibronectin (Sigma)-coated
dishes. N2-supplement (1/100 dilution, Invitrogen) and recombinant human BMP4
(20 ng/ml, R&D systems) were added in culture to induce neural crest
formation. To inhibit PKA signal, 1 or 10 µM of H89 (Biomol) was added in
culture. To obtain consistent results, more than 15 explants were examined in
three independent experiments of each condition.
To knockdown Sox9 expression in the explants, double-strand RNAs (dsRNA) for quail Sox9 (sense strand: GGAAAGCGACGAGGACAAA) as well as a mutated control dsRNA (GGATAGCCACGTGCAGAAA) were generated (Takara) and the dsRNAs (10 pM/PBS) were electroporated to stage 6-7 quail embryos, as indicated below.
To compare the level of Snail2 mRNA expression in the neural plate explants, total RNA was prepared by RNeasy kit (Qiagen) and cDNA was generated with SuperscriptII (Invitrogen). The number of PCR cycles required for a linear amplification of Snail2 cDNA was determined, and amplified bands of Snail2 were normalized with those of GAPDH and were semi-quantified with NIHimage software. The primers used were: Snail2-F, CTCCTTCCTGGTCAAGAAAC; Snail2-R, CTTTCTGAACCGCTGTGATC; GAPDH-F, GTGAAAGTCGGAGTCAACGG; GAPDH-R, AGTTGGTGGTGCACGATGCA.
Whole embryo culture and gene transfer
The whole-embryo culture in combination with electroporation was described
previously (Endo et al., 2002
;
Sakai et al., 2005
). In brief,
before electroporation, the embryos adhering to collagen-coated membranes were
set on a chamber with a 2 mm2 positive electrode (Unique Medical
Imada). A tungsten needle was used as the negative electrode. DNA solution
(1.2 µl of 5 µg/µl in PBS containing 0.025% Fast Green) was placed on
the right ectoderm of the embryo. The condition of electroporation was
3x7V for 25 ms at 200 ms interval. For misexpression studies, pEGFP-N1
and another expression vector were mixed at 1:1.
Antibodies and immunological staining
62.1E6 anti-Snail2 (mouse IgG1; DSHB)
(Liem et al., 1995
) antibody
was used as described previously
(Wakamatsu et al., 2004a
;
Sakai et al., 2005
). M2
anti-FLAG (mouse IgG1, Sigma), anti-ß-galactosidase (rabbit polyclonal,
Cappel), anti-HA (rabbit IgG, Roche), anti-phospho-CREB (rabbit IgG, Cell
Signaling) and anti-phospho-Sox9 (rabbit IgG, Abcam) antibodies were
commercially obtained. Anti-chicken Sox9 was a kind gift from Dr R.
Lovell-Badge (Morais da Silva et al.,
1996
). Fluorochrome-conjugated secondary antibodies were purchased
from Jackson. Phalloidin conjugated with Texas Red-X or Oregon Green were
obtained from Molecular Probes.
Immunological staining on sections and cultured cells was performed as
described previously (Wakamatsu et al.,
1993
; Wakamatsu et al.,
1997
). Sections treated with antibodies were also exposed to DAPI
(Sigma) to visualize nuclei. Whole-mount detection of phospho-CREB was
performed essentially as described (Endo
et al., 2002
).
| RESULTS |
|---|
|
|
|---|
|
|
First, we examined Sox9 protein expression in cultured neural plate
explants taken from the fore and midbrain levels. In previous studies, we have
shown that a treatment of the explants with BMP4 can effectively induce
expression of Snail2 and subsequent EMT (see Materials and methods,
see also Fig. 2A,
Fig. 6A)
(Wakamatsu et al., 2004a
;
Sakai et al., 2005
). Under
these conditions, Sox9 expression was also induced effectively
(Fig. 2A), although no Sox9
immunoreactivity was detected in cultures without BMP4 in the medium
(Fig. 2A). Next, expression
vectors of either Snail2 or Sox9 were co-transfected with a
GFP expression vector into the neural plate explants, and the
transfected explants were cultured in the absence of BMP4
(Fig. 2B,C). Although
Snail2 misexpression induced neither Sox9 expression nor EMT
(Fig. 2B), strong expression of
endogenous Snail2 was induced by the transfection of Sox9
(Fig. 2C).
Sox9-transfected cells dispersed on culture dishes and fibroblastic
appearance of actin stress fibers lacking junctional actin bundles indicated a
promotion of EMT (Fig. 2C). To
study Sox9 function in vivo, an expression vector of
En-fusion of Sox9 (Sox9-En-nuc, constitutive
repressor form) was co-transfected with GFP into the ectoderm of
cultured quail embryos (see Materials and methods) (see also
Endo et al., 2002
;
Endo et al., 2003
;
Wakamatsu et al., 2004a
;
Sakai et al., 2005
). Compared
with the untransfected side of the neural fold, a clear reduction of
Snail2 mRNA expression was observed (5/6 cases,
Fig. 2D). Such downregulation
of Snail2 was never observed when GFP was transfected alone
(6/6 cases, Fig. 2D). As other
group E Sox genes, such as Sox8 and Sox10, were
expressed in neural crest cells at later stages
(Fig. 1) (see also
Cheng et al., 2000
;
Cheung and Briscoe, 2003
),
transfected Sox9-En-nuc might have interfered with the function of
Sox8 and Sox10 as well. In order to repress the expression
of Sox9 specifically, we performed RNAi-mediated knockdown of Sox9 by
transfecting double-strand RNA (dsRNA, see Materials and methods), which was
specific for Sox9, into neural plate explants cultured in the
presence of BMP4. The transfection of Sox9 dsRNA inhibited both
Snail2 induction and EMT, otherwise promoted by BMP4
(Fig. 2E). The specificity of
the effect of Sox9 dsRNA was confirmed by the fact that the
transfection of mutated dsRNA did not interfere with the promotion of Snail2
expression and EMT by BMP4, and that co-transfection of the Sox9
dsRNA and the Sox9 expression vector could cancel the effect of the
Sox9 dsRNA (Fig. 2E).
Sox10 co-transfection failed to cancel the effect of Sox9
dsRNA, further showing the specificity of the Sox9 RNAi
(Fig. 2E). These results
indicated the requirement of Sox9 activity in Snail2
expression and EMT. We thus conclude that Sox9 is likely to
contribute to the expression of Snail2 and subsequent EMT in the
neural crest cells by mediating BMP signal.
Snail2 auto-activation
In a previous study, we have isolated a promoter sequence of chicken
Snail2 (Sakai et al.,
2005
). Whereas Smad1, a BMP signal transducer, could directly bind
to the Snail2 promoter sequence and activate the promoter, the
promoter lacking Smad-binding sites still responded to the BMP signal to some
extent (Sakai et al., 2005
).
This suggested that BMP signal could also indirectly activate the
Snail2 promoter via other transcription factor(s). In
Xenopus, exogenous Snail2 has been shown to induce
endogenous Snail2 expression
(LaBonne and Bronner-Fraser,
2000
). We thus tested auto-regulation by Snail2 in the
NIH3T3 mouse fibroblast cell line. Transfection of Snail2 stimulated
the Snail2 promoter-Luciferase reporter (D0.1), which
contains a conserved E-box motif (see
Sakai et al., 2005
), in a
dose-dependent fashion (Fig.
3A), suggesting that Snail2 activated its own promoter either
directly or indirectly.
As previous studies (Inukai et al.,
1999
; Hemavathy et al.,
2000
) have shown that Snail2 preferentially binds to an E-box-like
sequence, and as two E-box have been found in the Snail2 promoter
(Sakai et al., 2005
), we
reasoned that Snail2 might directly bind to one of the E-box sequences to
activate the promoter. Since D0.1 reporter lacked the E-box1, which was
recognized by MyoD (Zhao et al.,
2002
), we focused on E-box2, which is conserved between
Snail2 orthologs of several species
(Sakai et al., 2005
). As we
anticipated, a direct binding of Snail2 to the E-box2 was detected by EMSA
(Fig. 3B). Consistently, a
reporter carrying a mutation in the E-box2 (Em2) showed little response to
Snail2 expression in a Luciferase assay
(Fig. 3C).
As Snail family proteins have been considered to be repressors (for a
review, see Nieto, 2002
), and
because in Xenopus, Snail2 appears to function as a repressor in
crest development (LaBonne and
Bronner-Fraser, 2000
), our observation that Snail2 directly
activated the Snail2 promoter appeared paradoxical. However, when 3T3
cells were transfected with an activator form of Snail2, VP16-Snail2,
the D0.1 reporter was strongly activated, while transfection of a repressor
form, En-Snail2, showed little activation
(Fig. 3D). Taken together,
these results confirmed the idea that Snail2 can directly activate
its own promoter. This auto-activation alone seemed supportive only for the
expression of Snail2, as Snail2 transfection into the neural
plate explants increased the expression of endogenous Snail2 mRNA
weakly and transiently (Fig.
3E).
Next, we performed En-Snail2 transfection into the ectoderm of cultured quail embryo, and this also reduced the expression of endogenous Snail2 (6/6 cases, Fig. 3F), indicating the requirement of Snail2 as an activator. It should be emphasized, however, that transfection of VP16-Snail2 into cultured embryos decreased the endogenous Snail2 expression (6/6 cases, Fig. 3G), suggesting the requirement of Snail2 as a repressor. Similarly, transfection of VP16-Snail2 into neural plate explants inhibited the induction of endogenous Snail2 expression and EMT by BMP4 added in the culture medium (Fig. 3G). Therefore, Snail2 could act both as an activator and a repressor, probably dependent on the target genes, and both activator and repressor functions of Snail2 seemed to be required for neural crest formation and subsequent EMT in avian ectoderm.
Sox9 synergistically activates the Snail2 promoter
We considered the possible involvement of other transcription factors for
Snail2 activation. As mentioned in the Introduction, both
Foxd3 and Sox9 have been shown to be involved in neural
crest formation both in Xenopus and chick
(Kos et al., 2001
;
Sasai et al., 2001
;
Dottori et al., 2001
;
Spokony et al., 2002
;
Cheung and Briscoe, 2003
;
Cheung et al., 2005
;
McKeown et al., 2005
). In
Xenopus, Msx1 and Sox10 have also been shown to be involved
in this process (Tribulo et al.,
2003
; Honore et al.,
2003
), and overexpression of Sox10 induced ectopic EMT in
the chick neural tube (McKeown et al.,
2005
).
Thus, we used the Luciferase assay in neural plate explants to
test the ability of transcription factors (Msx1, Foxd3, Sox9, and Sox10) to
activate the D1.2 Snail2 reporter construct, which contains all the
cis-regulatory elements required for the expression in the neural crest
(Sakai et al., 2005
). We found
that only Sox9 could activate the reporter
(Fig. 4A).
To determine if Sox9 directly bound to the Snail2 promoter, EMSA was performed (Fig. 4B). A clear binding of Sox9 was observed when a probe, including the flanking sequence of the E-box2 was used. Competitions with mutated sequences indicated that the C-rich sequence adjacent to the E-box2 was important for the Sox9 binding (Fig. 4B). Accordingly, a Snail2 promoter-Luciferase reporter containing a mutation in this sequence (Em3) showed little response to Sox9 expression (Fig. 4C).
Interestingly, although Sox9 alone could activate the Snail2 promoter only moderately, co-transfection of Sox9 and Snail2 synergistically activated the D0.1 reporter to higher levels (Fig. 4D). The synergistic activation of the Snail2 promoter by Sox9 and Snail2, and closely located binding sites of these factors in the promoter sequence is consistent with a physical interaction of these proteins. Co-immunoprecipitation analysis revealed a clear association of Sox9 and Snail2 (Fig. 5). Deletion mutagenesis of both Sox9 and Snail2 showed that their interaction was mediated through the N-terminal Sox9 sequence, including the HMG-box, and the C-terminal Snail2, containing the Zn fingers (Fig. 5).
Protein kinase A signal enhances Sox9 and Snail2 activity
Although Sox9 expression could be detected strongly in the
premigratory neural crest cells both at the cranial and the trunk levels (see
also Cheung and Briscoe, 2003
),
Sox9 expression was also detected in more ventral neural tissues of
brain and neural tube (see Fig.
1; data not shown). In previous studies, in ovo electroporation of
Sox9 expression vector into the ventral neural tube did not
effectively induce EMT, while co-transfection of Sox9 and
Snail2 promoted ectopic EMT more efficiently
(Cheung and Briscoe, 2003
;
Cheung et al., 2005
) (but see
McKeown et al., 2005
). We also
observed that misexpression of Bmp4 in vivo expanded Snail2
expression in the neural fold, but more ventral neural plate cells rarely
expressed Snail2 (Endo et al.,
2002
). These observations suggested that the activities of these
crest factors were spatially modulated by other signals, possibly provided by
surrounding tissues in vivo.
|
|
As described above, some aspect of Sox9 function could depend on the PKA signal, but the induction of endogenous Snail2 expression did not appear to rely on the signal (see above). Thus, we tested whether PKA activation could affect the transcriptional activation of the Snail2 promoter (Fig. 9). Neither addition of cAMP analog in the culture medium nor co-transfection of constitutively-active PKA (CA-PKA) significantly increased the Sox9-mediated activation of the Snail2 promoter. Consistently, mutations in the PKA-phosphorylation sites in Sox9 did not affect the transcriptional activation of the promoter (Fig. 9). Interestingly, the transcriptional activation of the Snail2 reporter by Snail2 protein was enhanced both by an addition of cAMP analog and by co-transfection of CA-PKA (Fig. 9), although the mechanisms by which PKA signal activates Snail2 function remain to be studied, further suggesting the importance of PKA signal in the early neural crest development.
|
| DISCUSSION |
|---|
|
|
|---|
|
|
|
Snail2 as a transcriptional activator
In this study, we show that Snail2 activates its own promoter by a direct
binding to E-box2. To our knowledge, this is the first case of activation of a
target gene by Snail family proteins, although a potential transcriptional
activation domain has been suggested in artificial assay system
(Hemavathy et al., 2000
). This
inference appears superficially to conflict with previous reports, showing
that Snail2 is involved in a neural crest formation as a
transcriptional repressor (LaBonne and
Bronner-Fraser, 2000
; del
Barrio and Nieto, 2002
). However, misexpression of
VP16-Snail2 in neural plate explants also activated endogenous
Snail2. Moreover, consistent with previous reports,
VP16-Snail2 strongly inhibited BMP-induced Snail2 expression
and EMT. Thus, Snail2 may act as an activator on its own promoter,
but it must also act on other target genes as a repressor. The function of
Snail2 as an activator probably depends on a partner protein(s), as mutations
in the Sox9 binding sequence in the Snail2 promoter decreased Snail2 mediated
activation of the promoter in 3T3 cells even when Sox9 was not co-transfected
(D.S. and Y.W., unpublished). In any case, the next challenge will be to
identify target genes and partner proteins of Snail2 and to study the
mechanism by which Snail2 is converted from a repressor to an activator, or
vice versa.
|
Modulator of neural crest-inducing signals
Although many inducing signals such as BMP and Wnt for neural crest
formation have been suggested, there are few reports for inhibitory signals
and factors. However, as the initial patterning of the embryonic ectoderm is
mediated not only by the inducing signals such as BMP, Wnt and FGF proteins,
but also by inhibitory factors such as Noggin, it is likely that similar
mechanisms may be involved in the spatially restricted formation of the neural
crest. In fact, emerging evidences indicate relatively broad tissue
distribution of inducing signal inputs, such as the localization of
phospho-Smad1 for BMP signal (Faure et
al., 2000
; Faure et al.,
2002
; Sakai et al.,
2005
), and expression of reporter gene containing Lef/Tcf binding
sites for canonical Wnt signal (Sakai et
al., 2005
), compared with the relatively narrow domain of neural
crest marker expression. This can be explained by the level of signal inputs,
but such pattern can also be established by the opposing effects of
facilitating and inhibitory signals.
|
|
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Barrallo-Gimeno, A. and Nieto, M. A. (2005).
The Snail genes as inducers of cell movement and survival: implications in
development and cancer. Development
132,3151
-3161.
Bastidas, F., De Calisto, J. and Mayor, R. (2004). Identification of neural crest competence territory: role of Wnt signaling. Dev. Dyn. 229,109 -117.[CrossRef][Medline]
Burstyn-Cohen, T., Stanleigh, J., Sela-Donenfeld, D. and
Kalcheim, C. (2004). Canonical Wnt activity regulates neural
crest delamination linking BMP/Noggin signalling with G1/S transition.
Development 131,5327
-5339.
Chen, A. E., Ginty, D. D. and Fan, C.-M. (2005). Protein kinase A signalling via CREB controls myogenesis induced by Wnt proteins. Nature 433,317 -322.[CrossRef][Medline]
Cheng, U., Cheung, M., Abu-Elmagd, M. M., Orme, A. and Scotting, P. J. (2000). Chick sox10, a transcription factor expressed in both early neural crest cells and central nervous system. Brain Res. Dev. Brain Res. 121,233 -241.[Medline]
Cheung, M. and Briscoe, J. (2003). Neural crest
development is regulated by the transcription factor Sox9.
Development 130,5681
-5693.
Cheung, M., Chaboissier, M. C., Mynett, A., Hirst, E., Schedl, A. and Briscoe, J. (2005). The transcriptional control of trunk neural crest induction, survival, and delamination. Dev. Cell 8,179 -192.[CrossRef][Medline]
Chijiwa, T., Mishima, A., Hagiwara, M., Sano, M., Hayashi, K.,
Inoue, T., Naito, K., Toshioka, T. and Hidaka, H. (1990).
Inhibition of forskolin-induced neurite outgrowth and protein phosphorylation
by a newly synthesized selective inhibitor of cyclic AMP-dependent protein
kinase, N-[2-(p-bromocinnamylamino)ethyl]-5-isoquinolinesulfonamide (H-89), of
PC12D pheochromocytoma cells. J. Biol. Chem.
265,5267
-5272.
del Barrio, M. G. and Nieto, M. A. (2002).
Overexpression of Snail family members highlights their ability to promote
chick neural crest formation. Development
129,1583
-1593.
Dottori, M., Gross, M. K., Labosky, P. and Goulding, M.
(2001). The winged-helix transcription factor Foxd3 suppresses
interneuron differentiation and promotes neural crest cell fate.
Development 128,4127
-4138.
Endo, Y., Osumi, N. and Wakamatsu, Y. (2002). Bimodal functions of Notch-mediated signaling are involved in neural crest formation during avian ectoderm development. Development 129,863 -873.
Endo, Y., Osumi, N. and Wakamatsu, Y. (2003). Deltex/Dtx mediates NOTCH signaling in regulating Bmp4 expression for cranial neural crest formation during avian development. Dev. Growth Diff. 45,241 -248.[CrossRef][Medline]
Faure, S., Lee, M. A., Keller, T., ten Dijke, P. and Whitman, M. (2000). Endogenous patterns of TGFß superfamily signaling during Xenopus development. Development 127,2917 -2931.[Abstract]
Faure, S., de Santa Barbara, P., Roberts, D. J. and Whitman, M. (2002). Endogenous patterns of BMP signaling during early chick development. Dev. Biol. 244, 44-65.[CrossRef][Medline]
García-Castro, M., Marcelle, C. and Bronner-Fraser,
M. (2002). Ectodermal Wnt function as a neural crest inducer.
Science 297,848
-851.
Hamburger, V. and Hamilton, H. L. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88,49 -92.[CrossRef]
Hemavathy, K., Guru, S. C., Harris, J., Chen, J. D. and Tony, I. P. Y. (2000). Human Slug is a repressor that localizes to sites of active transcription. Mol. Cell. Biol. 26,5087 -5095.
Honore, S. M., Aybar, M. J. and Mayor, R. (2003). Sox10 is required for the early development of the prospective neural crest in Xenopus embryos. Dev. Biol. 260,76 -96.[CrossRef]
Huang, W., Zhou, X., Lefebvre, V. and de Crombrugghe, B.
(2000). Phosphorylation of SOX9 by cyclic AMP-dependent protein
kinase A enhances SOX9's ability to transactivate a Col2a1
chondrocyte-specific enhancer. Mol. Cell. Biol.
20,4149
-4158.
Inukai, T., Inoue, A., Kurosawa, H., Goi, K., Shinjyo, T., Ozawa, K., Mao, M., Inaba, T. and Look, A. T. (1999). SLUG, a ces-1-related zinc finger transcription fator gene with antiapoptotic activity, is a downstream target of the E2A-HLF oncoprotein. Mol. Cell 4,343 -352.[CrossRef][Medline]
Kalcheim, C. and Burstyn-Cohen, T. (2005). Early stages of neural crest ontogeny: formation and regulation of cell delamination. Int. J. Dev. Biol. 49,105 -116.[CrossRef][Medline]
Kamachi, Y., Cheah, K. S. E. and Kondoh, H.
(1999). Mechanism of regulatory target selection by the SOX
high-mobility-group domain proteins as revealed by comparison of SOX1/2/3 and
SOX9. Mol. Cell. Biol.
19,107
-120.
Kondoh, H., Uchikawa, M. and Kamachi, Y. (2004). Interplay of Pax6 and SOX2 in lens development as a paradigm of genetic switch mechanisms for cell differentiation. Int. J. Dev. Biol. 48,819 -827.[CrossRef][Medline]
Kos, R., Reedy, M. V., Johnson, R. L. and Erickson, C. A. (2001). The winged-helix transcription factor FoxD3 is important for establishing the neural crest lineage and repressing melanogenesis in avian embryos. Development 128,1467 -1479.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a two-signal model. Development 125,2403 -2414.[Abstract]
LaBonne, C. and Bronner-Fraser, M. (2000). Snail-related transcriptional repressors are required in Xenopus for both the induction of the neural crest and its subsequent migration. Dev. Biol. 221,195 -205.[CrossRef][Medline]
Le Douarin, N. M. and Kalcheim, C. (1999).The Neural Crest (2nd edn) . Cambridge: Cambridge University Press.
Lee, Y. H., Aoki, Y., Hong, C. S., Saint-Germain, N., Credidio, C. and Saint-Jeannet, J. P. (2004). Early requirement of the transcriptional activator Sox9 for neural crest specification in Xenopus. Dev. Biol. 275,93 -103.[CrossRef][Medline]
Lefebvre, V., Huang, W., Harley, V. R., Goodfellow, P. N. and de
Crombrugghe, B. (1997). SOX9 is a potent activator of the
chondrocyte-specific enhancer of the pro
1(II) collagen gene.
Mol. Cell. Biol. 17,2336
-2346.[Abstract]
Liem, K. F., Jr, Tremmi, G., Roelink, H. and Jessell, T. M. (1995). Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm. Cell 82,969 -979.[CrossRef][Medline]
Liem, K. F., Jr, Tremml, G. and Jessell, T. M. (1997). A role for the roof plate and its resident TGF-ß related proteins in neuronal patterning in the dorsal spinal cord. Cell 91,127 -138.[CrossRef][Medline]
Liu, J.-P. and Jessell, T. M. (1998). A role for rhoB in the delamination of neural crest cells from the dorsal neural tube. Development 125,5055 -5067.[Abstract]
Marchant, L., Linker, C., Ruiz, P., Guerrero, N. and Mayor, R. (1998). The inductive properties of mesoderm suggest that the neural crest cells are specified by a BMP gradient. Dev. Biol. 198,319 -329.[Medline]
Matsunaga, E., Araki, I. and Nakamura, H. (2000). Pax6 defines the di-mesencephalic boundary by repressing En1 and Pax2. Development 127,2357 -2365.[Abstract]
McKeown, S. J., Lee, V. M., Bronner-Fraser, M., Newgreen, D. F. and Farlie, P. G. (2005). Sox10 overexpression induces neural crest-like cells from all dorsoventral levels of the neural tube but inhibits differentiation. Dev. Dyn. 233,430 -444.[CrossRef][Medline]
Meulemans, D. and Bronner-Fraser, M. (2004). Gene-regulatory interactions in neural crest evolution and development. Dev. Cell 7,291 -299.[CrossRef][Medline]
Minichiello, J., Ben-Ya'acov, A., Hearn, C. J., Needham, B. and Newgreen, D. F. (1999). Induction of epithelio-mesenchymal transformation of quail embryonic neural cells by inhibition of atypical protein kinase-C. Cell Tissue Res. 295,195 -206.[CrossRef][Medline]
Monsono-Burq, A. H., Fletcher, R. B. and Harland, R. M.
(2003). Neural crest induction by paraxial mesoderm in
Xenopus embryos requires FGF signals.
Development 130,3111
-3124.
Morais da Silva, S., Hacker, A., Harley, V., Goodfellow, P., Swain, A. and Lovell-Badge, R. (1996). Sox9 expression during gonadal development implies a conserved role for the gene intestis differentiation in mammals and birds. Nat. Genet. 14,62 -68.[CrossRef][Medline]
Nieto, M. A. (2002). The Snail superfamily of Zinc-finger transcription factors. Nat. Rev. Mol. Cell. Biol. 3,155 -166.[CrossRef][Medline]
Nieto, M. A., Sargent, M. G., Wilkinson, D. G. and Cooke, J.
(1994). Control of cell behavior during vertebrate development by
Slug, a zinc finger gene. Science
264,835
-839.
Sakai, D. and Wakamatsu, Y. (2005). Regulatory mechanisms for neural crest formation. Cells Tissues Organs 179,24 -35.[CrossRef][Medline]
Sakai, D., Tanaka, Y., Endo, Y., Osumi, N., Okamoto, H. and Wakamatsu, Y. (2005). Regulation of Slug transcription in embryonic ectoderm by beta-catenin-Lef/Tcf and BMP-Smad signaling. Dev. Growth Differ. 47,471 -482.[CrossRef][Medline]
Sasai, N., Mizuseki, K. and Sasai, Y. (2001).
Requirement of FoxD3-class signaling for neural crest determination in
Xenopus. Development
128,2525
-2536.
Scarpetta, M. A. and Uhler, M. D. (1993).
Evidence for two additional isoforms of the endogenous protein kinase
inhibitor of cAMP-dependent protein kinase in mouse. J. Biol.
Chem. 268,10927
-10931.
Sefton, M., Sanchez, S. and Nieto, M. A. (1998). Conserved and divergent roles for members of the Snail family of transcription factors in the chick and mouse embryo. Development 125,3111 -3121.[Abstract]
Shaywitz, A. and Greenberg, M. (1999). CREB: a stimulus-induced transcription factor activated by a diverse array of extracellular signals. Annu. Rev. Biochem. 68,821 -861.[CrossRef][Medline]
Spokony, R. F., Aoki, Y., Saint-Germain, N., Magner-Fink, E. and Saint-Jeannet, J. P. (2002). The transcription factor Sox9 is required for cranial neural crest development in Xenopus.Development 129,421 -432.
Tribulo, C., Aybar, M. J., Nguyen, W., Mullins, M. C. and Mayor,
R. (2003). Regulation of Msx genes by a Bmp gradient is
essential for neural crest specification. Development
130,6441
-6452.
Van Patten, S. M., Howard, P., Walsh, D. A. and Maurer, R.
A. (1992). The alpha- and beta-isoforms of the inhibitor
protein of the 3',5'-cyclic adenosine monophosphate-dependent
protein kinase: characteristics and tissue- and developmental-specific
expression. Mol. Endocrinol.
6,2114
-2122.
Villanueva, S., Galvic, A., Ruiz, P. and Mayor, R. (2002). Posteriorization by FGF, Wnt, and retinoic acid is required for neural crest induction. Dev. Biol. 241,289 -301.[CrossRef][Medline]
Wakamatsu, Y. and Weston, J. A. (1997). Sequential expression and role of Hu RNA-binding proteins during neurogenesis. Development 124,3449 -3460.[Abstract]
Wakamatsu, Y., Watanabe, Y., Shimono, A. and Kondoh, H. (1993). Transition of localization of the N-myc protein from nucleus to cytoplasm in differentiating neurons. Neuron 10,1 -9.[CrossRef][Medline]
Wakamatsu, Y., Watanabe, Y., Nakamura, H. and Kondoh, H. (1997). Regulation of the neural crest cell fate by N-myc: promotion of ventral migration and neuronal differentiation. Development 124,1953 -1962.[Abstract]
Wakamatsu, Y., Endo, Y., Osumi, N. and Weston, J. A. (2004a). Multiple roles of SOX2, a HMG-box transcription factor in avian development. Dev. Dyn. 229, 74-86.[CrossRef][Medline]
Wakamatsu, Y., Osumi, N. and Weston, J. A. (2004b). Expression of a novel secreted factor, Seraf indicates an early segregation of Schwann cell precursors from neural crest duringavian development. Dev. Biol. 268,162 -173.[CrossRef][Medline]
Wu, J., Saint-Jeanett, J. and Klein, P. (2003). Wnt-frizzled signaling in neural crest formation. Trends Neurosci. 26,40 -45.[CrossRef][Medline]
Zhao, P., Iezzi, S., Carver, E., Dressman, D., Gridley, T.,
Sartorelli, V. and Hoffman, E. P. (2002). Slug is a novel
downstream target of MyoD. Temporal profiling in muscle regeneration.
J. Biol. Chem. 277,30091
-30101.
This article has been cited by other articles:
![]() |
B. L. Arduini, K. M. Bosse, and P. D. Henion Genetic ablation of neural crest cell diversification Development, June 15, 2009; 136(12): 1987 - 1994. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Watanabe, Y. Sato, D. Saito, R. Tadokoro, and Y. Takahashi EphrinB2 coordinates the formation of a morphological boundary and cell epithelialization during somite segmentation PNAS, May 5, 2009; 106(18): 7467 - 7472. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Darido, M. Buchert, J. Pannequin, P. Bastide, H. Zalzali, T. Mantamadiotis, J.-F. Bourgaux, V. Garambois, P. Jay, P. Blache, et al. Defective Claudin-7 Regulation by Tcf-4 and Sox-9 Disrupts the Polarity and Increases the Tumorigenicity of Colorectal Cancer Cells Cancer Res., June 1, 2008; 68(11): 4258 - 4268. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Sauka-Spengler and M. Bronner-Fraser Insights From a Sea Lamprey Into the Evolution of Neural Crest Gene Regulatory Network Biol. Bull., June 1, 2008; 214(3): 303 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-S. Huang, J.-Y. Hsieh, Y.-H. Wu, C.-H. Jen, Y.-H. Tsuang, S.-H. Chiou, J. Partanen, H. Anderson, T. Jaatinen, Y.-H. Yu, et al. Functional Network Reconstruction Reveals Somatic Stemness Genetic Maps and Dedifferentiation-Like Transcriptome Reprogramming Induced by GATA2 Stem Cells, May 1, 2008; 26(5): 1186 - 1201. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Nadella, G. N. Jones, A. Trimboli, C. A. Stratakis, G. Leone, and L. S. Kirschner Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase A in Mesenchymal-to-Epithelial Transition Cancer Res., April 15, 2008; 68(8): 2671 - 2677. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Taneyhill, E. G. Coles, and M. Bronner-Fraser Snail2 directly represses cadherin6B during epithelial-to-mesenchymal transitions of the neural crest Development, April 15, 2007; 134(8): 1481 - 1490. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, N. C. McKnight, T. Zhang, M. L. Lu, S. P. Balk, and X. Yuan SOX9 Is Expressed in Normal Prostate Basal Cells and Regulates Androgen Receptor Expression in Prostate Cancer Cells Cancer Res., January 15, 2007; 67(2): 528 - 536. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-L. Chen and D. M. Panchision Concise Review: Bone Morphogenetic Protein Pleiotropism in Neural Stem Cells and Their Derivatives--Alternative Pathways, Convergent Signals Stem Cells, January 1, 2007; 25(1): 63 - 68. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Busch, M. Oppitz, M. H. Sailer, L. Just, M. Metzger, and U. Drews BMP-2-dependent integration of adult mouse subventricular stem cells into the neural crest of chick and quail embryos J. Cell Sci., November 1, 2006; 119(21): 4467 - 4474. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. Huang, D. Wu, Z. Xie, H. E. Zhau, T. Nomura, M. Zayzafoon, J. Pohl, C.-L. Hsieh, M. N. Weitzmann, M. C. Farach-Carson, et al. {beta}2-Microglobulin Is a Signaling and Growth-Promoting Factor for Human Prostate Cancer Bone Metastasis. Cancer Res., September 15, 2006; 66(18): 9108 - 9116. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, X. Pan, W. Lei, J. Wang, J. Shi, F. Li, and J. Song Regulation of Transforming Growth Factor-{beta}1-Induced Apoptosis and Epithelial-to-Mesenchymal Transition by Protein Kinase A and Signal Transducers and Activators of Transcription 3. Cancer Res., September 1, 2006; 66(17): 8617 - 8624. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Peiro, M. Escriva, I. Puig, M. J. Barbera, N. Dave, N. Herranz, M. J. Larriba, M. Takkunen, C. Franci, A. Munoz, et al. Snail1 transcriptional repressor binds to its own promoter and controls its expression. Nucleic Acids Res., January 1, 2006; 34(7): 2077 - 2084. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||