spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 15 March 2006
doi: 10.1242/dev.02302


Development 133, 1423-1432 (2006)
Published by The Company of Biologists 2006


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.02302v1
133/8/1423    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glaser, S.
Right arrow Articles by Stewart, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glaser, S.
Right arrow Articles by Stewart, A. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

Multiple epigenetic maintenance factors implicated by the loss of Mll2 in mouse development

Stefan Glaser1, Julia Schaft1,*, Sandra Lubitz1, Kristina Vintersten{dagger}, Frank van der Hoeven{ddagger}, Katharina R. Tufteland2, Rein Aasland2, Konstantinos Anastassiadis1, Siew-Lan Ang3 and A. Francis Stewart1,§

1 Genomics, BioInnovationsZentrum, Dresden University of Technology, Am Tatzberg 47, Dresden 01307, Germany.
2 Department of Molecular Biology and Computational Biology Unit at BCCS, University of Bergen, HiB, Bergen N5020, Norway.
3 National Institute for Medical Research, The Ridgeway Mill Hill, London NW7 1AA, UK.

§ Author for correspondence (e-mail: stewart{at}biotec.tu-dresden.de)

Accepted 7 February 2006


    SUMMARY
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Epigenesis is the process whereby the daughters of a dividing cell retain a chromatin state determined before cell division. The best-studied cases involve the inheritance of heterochromatic chromosomal domains, and little is known about specific gene regulation by epigenetic mechanisms. Recent evidence shows that epigenesis pivots on methylation of nucleosomes at histone 3 lysines 4, 9 or 27. Bioinformatics indicates that mammals have several enzymes for each of these methylations, including at least six histone 3 lysine 4 methyltransferases. To look for evidence of gene-specific epigenetic regulation in mammalian development, we examined one of these six, Mll2, using a multipurpose allele in the mouse to ascertain the loss-of-function phenotype. Loss of Mll2 slowed growth, increased apoptosis and retarded development, leading to embryonic failure before E11.5. Using chimera experiments, we demonstrated that Mll2 is cell-autonomously required. Evidence for gene-specific regulation was also observed. Although Mox1 and Hoxb1 expression patterns were correctly established, they were not maintained in the absence of Mll2, whereas Wnt1 and Otx2 were. The Mll2 loss-of-function phenotype is different from that of its sister gene Mll, and they regulate different Hox complex genes during ES cell differentiation. Therefore, these two closely related epigenetic factors play different roles in development and maintain distinct gene expression patterns. This suggests that other epigenetic factors also regulate particular patterns and that development entails networks of epigenetic specificities.

Key words: Epigenetics, Histone methylation, SET domain


    INTRODUCTION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Until recently, epigenetic mechanisms have been equated with the inheritance of heterochromatin, exemplified by DNA methylation in mammals (Wolffe and Matzke, 1999Go; Egger et al., 2004Go). Evidence that transcriptionally active states of chromatin can also be epigenetically maintained is now accumulating (Roguev et al., 2001Go; Noma and Grewal, 2002Go; Jaenisch and Bird, 2003Go; Wysocka et al., 2005Go). This paradigm shift began with the realization that DNA methylation is secondary to a more universal mechanism for epigenetic silencing based on methylation of histone 3 lysine 9 (H3 K9) for constitutive heterochromatin (Rea et al., 2000Go; Lachner et al., 2001Go; Bannister et al., 2001Go) and on H3 K27 for facultative heterochromatin (Cao et al., 2002Go; Czermin et al., 2002Go; Kuzmichev et al., 2002Go; Muller et al., 2002Go).

Active chromatin states may also be epigenetically maintained because alternative histone lysine methylations, mainly at H3 K4, characterize active chromatin and preclude the lysine methylations that characterize inactive chromatin (Noma et al., 2001Go; Litt et al., 2001Go). The functional opposition of these two classes of histone lysine methylation was further supported by linkage to the antagonism between Polycomb- and trithorax-Group (PcG and trxG) action (Brock and Fisher, 2005Go; Ringrose and Paro, 2004Go). The association of trxG action with H3 K4 methylation (Roguev et al., 2001Go; Krogan et al., 2002Go; Milne et al., 2002Go; Nagy et al., 2002Go; Nakamura et al., 2002Go; Beisel et al., 2002Go) and PcG action with H3 K27 methylation (Cao et al., 2002Go; Czermin et al., 2002Go; Kuzmichev et al., 2002Go; Muller et al., 2002Go) provides a molecular explanation for this antagonism.

The silencing methylations at both H3 K9 and H3 K27 are epigenetically maintained via positive-feedback loops. The relevant methyltransferases [SUV39 and E(Z), respectively] associate with a protein (HP1 and Polycomb, respectively) that recognizes the methylated epitope. The enzyme is thereby associated with the chromatin that it has methylated, to methylate it further and propagate the silent state.

Recent evidence indicates that maintenance of active chromatin occurs in the same way, because a constituent protein of all H3 K4 methyltransferase complexes, WDR5/SWD3 (Roguev et al., 2001Go; Krogan et al., 2002Go; Nagy et al., 2002Go; Wysocka et al., 2003Go; Hughes et al., 2004Go; Yokoyama et al., 2004Go; Dou et al., 2005Go; Lee and Skalnik, 2005Go), binds to methylated H3 K4 (Wysocka et al., 2005Go).

These observations support the polarization model, which is based on opposing positive feedback loops (Jaenisch and Bird, 2003Go). Both active and heterochromatic states involve several positive feedback loops that reinforce the local status quo. Hence, each state has an implicit epigenetic status that adds stability and reduces the chances of inadvertent transitions to the other state.

The polarization model poses questions that can now be addressed. Do uncommitted neutral chromatin states exist? How are active and silenced states specified? Are transitions between active and heterochromatic states used to regulate gene expression and if so, how? These questions are particularly relevant to the study of development because the transition from the totipotency of the zygote to differentiated states in the adult is reflected by changes in the epigenetic status of chromatin (Jaenisch and Bird, 2003Go).

S. pombe has only one enzyme for each of the active and heterochromatic lysine methylation sites (Roguev et al., 2003Go; Sanders et al., 2004Go; Cam et al., 2005Go). To date, no evidence for specific gene regulation by histone methylation in either S. pombe or S. cerevisiae has been observed. Higher eukaryotes have several enzymes for each site of lysine methylation. SET domain sequence alignments suggest that the mouse genome encodes at least six H3 K4 methyltransferases and at least seven H3 K9 methyltransferases (Fig. 1). Because gene-specific regulation by epigenesis during development has been anticipated but not yet defined, we decided to look among these SET domain factors in mouse development.


Figure 1
View larger version (40K):
[in this window]
[in a new window]
 
Fig. 1. Classification of murine SET domain proteins. An exhaustive search for SET domains in the mouse genome revealed 50 proteins that were grouped into 11 subclasses using a tree based on a structure-based multiple sequence alignment (see Materials and methods). The tree is shown on the left with protein Accession Number and names. The most likely target specificity for each group is indicated. The most prominent SET domain co-domains are listed in the right-most column. Accession Numbers are for UniProt except those indicated in blue italic, which are from Ensembl (release 30.33f; the full Accession Number is of the form ENSMUSP000000xxxxx, and only the last five digits are shown), and for HYPB, which is a NCBI RefSeq entry. For the PRDM group, the protein names for the human orthologs are given. For the SMYD group, only 3 out of 5 members were included in the alignment, and for the PRDM group, only 7 of 15 members were included. Mll2, which resides on mouse chromosome 7, has also been called MLL4 and Wbp7 (FitzGerald and Diaz, 1999Go; Huntsman et al., 1999Go; Bedford et al., 1997Go).

 
Few lysine methyltransferases have been analyzed for their role during metazoan development. Of the H3 K4 methyltransferases (Fig. 1), only Mll (mixed lineage leukaemia; Mll1 – Mouse Genome Informatics), which is the mouse homolog of Drosophila trithorax, has been mutated in the mouse. The gene has been independently mutated in the mouse three times, each different mutation producing a different lethal phenotype when homozygous. Fusion of lacZ into exon 3 caused embryonic lethality after E10.5 when homozygous, with pleiotropic defects in many tissues and disturbed Hox gene expression (Yu et al., 1995Go; Hess et al., 1997Go; Yu et al., 1998Go; Hanson et al., 1999Go). This mutant allele expresses the first 458 amino acids of Mll, including the conserved AT hooks region, both protein phosphatase 2A interaction sites and SNL1 (speckled nuclear localization signal) fused to the tetramerizing protein, ß-galactosidase (see Fig. S1 in the supplementary material). Heterozygotes showed a hypofertile and mildly homeotic phenotype. By contrast, truncation at exon 5, which permits expression of the above regions plus the MT (CxxC methyltransferase homology) domain, was lethal at the two-cell stage in homozygotes, with a mildly homeotic heterozygous phenotype without reported hypofertility (Ayton et al., 2001Go). Replacement of exons 12-14 truncated the transcript in the middle of the conserved PHD finger region and caused embryonic lethality around E13.5, without a reported heterozygous phenotype (Yagi et al., 1998Go). It is not clear whether any of these mutations resulted in a complete loss of function. However, it is clear that Mll is required for definitive hematopoiesis (Ernst et al., 2004aGo) and sustains expression of certain Hox genes, particularly Hoxa7, Hoxa9 and Hoxc8 (Yu et al., 1998Go; Hanson et al., 1999Go; Ernst et al., 2004bGo).

Mammals have a second trithorax homologue, Mll2, as well as two other similar genes Mll3 and Mll4, and two more genes, Set1a and Set1b, which contain very similar SET domains (Fig. 1). Mll and Mll2 are closely related proteins (see Fig. S1 in the supplementary material), having arisen from a duplication that includes the upstream [Plzf (Zbtb16 – Mouse Genome Informatics) and Plzf2] and downstream (U2af1 and U2af1l4) genes (FitzGerald and Diaz, 1999Go). The functional relationship between Mll and Mll2 is not known. Both proteins are very large, share the same architecture (Fig. 2A; see Fig. S1 in the supplementary material) and are expressed from CpG islands in a nearly, but not completely, ubiquitous manner, including in ES cells and all major tissues, as determined by northern analysis (FitzGerald and Diaz, 1999Go) (data not shown). Partial characterizations of associated proteins indicate that they both reside in similar complexes (Hughes et al., 2004Go; Yokoyama et al., 2004Go; Dou et al., 2005Go), as do Set1a/b (Wysocka et al., 2003Go; Lee and Skalnik, 2005Go).

Because Mll and Mll2 are orthologous, a comparison of their functional roles in mouse development represents a good way to look for evidence of epigenetic regulation in specific gene expression. Therefore we created a multipurpose allele for Mll2. By conversion of the allele from one state to another, we established the null phenotype in mouse development and in ES cells.


    MATERIALS AND METHODS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Gene targeting in embryonic stem cells and genotyping.
A 16.4 kb fragment of Mll2 genomic DNA including exon 1 to exon 10 was isolated from a 129Sv ES cell-phage library. The targeting vector was constructed by inserting an FRT flanked cassette including the splice acceptor sequence from the second exon of the engrailed 2 gene, EMCV IRES, a LacZ-neo fusion and SV40 early polyadenylation signal (Testa et al., 2004Go) into intron 1 by recombineering (Angrand et al., 1999Go). The cassette is flanked on the 3' end by a loxP site and a second loxP site replaced an ApaL1 site in intron 2. Two correctly targeted E14 ES cell clones were used to generate chimeric mice that were subsequently bred to C57BL/6 mice. Offspring from Mll2+/– crosses and individual embryos were genotyped by PCR with the following primers that produced a 1.7 kb product from the targeted allele: primer 34, 5'-GGGCTGACCGCTTCCTCGTGCTTTAC-3'; primer 36, 5'-GGAGAACAGTTGTGGGGAGATGGGTC-3'. Homozygote Mll2 embryos were distinguished from heterozygotes with the following primers that produced a 914 bp product from the wild-type allele and no product from the targeted allele: primer 31, 5'-CTCTCTGGTTCTAAGGTAGAGTG-3' and primer 36. To generate Mll2 F/+ mice, we crossed Mll2+/– mice to the hATPC-Flpe line (Rodriguez et al., 2000Go). Subsequent crossing to the PGK-Crem line (Lallemand et al., 1998Go) produced Mll2 FC/+ mice. Mll2 F/+ and Mll2 FC/+ mice were genotyped by PCR with the following primers: primer 145, 5'-CGGAGGAAGAGAGCAGTGACG-3'; primer 147, 5'-GGACAGGAGTCACATCTGCTAGG-3'. The products were 1554 bp, 1448 bp and 737 bp for the Mll2F, Mll2+ and Mll2FC alleles, respectively. For double-targeted ES cells, the targeting construct was changed from a lacZ-neo fusion to a lacZ-hygro (hygromycin resistance) fusion by recombineering (Testa et al., 2004Go). Double-targeted cells were selected for G418 (350 µg/ml) and hygromycin (180 µg/ml) resistance.

Expression analysis by RT-PCR and western blotting
Total RNA from individual embryos or cells was extracted using TriReagent (Sigma) according to the manufacturer's instructions. First-strand cDNA was synthesized from 1 µg of total RNA using M-MLV reverse transcriptase (Promega). The primer pairs that produced a 1228 bp product were: mll2se, 5'-GCAGCAGAGGAGAACCAGACC-3'; mll2as, 5'-GGAGGAACCTCCCCTGCCATC. LacZse (5'-AAGTTCAGATGTGCGGCGAGTT) and LacZas (5'-GGCTTCATCCACCACATACAGG) produced a 511 bp product. Actin primers were described previously (Testa et al., 2004Go). Q-PCR was performed using a Stratagene MX4000 according to the manufacturer's instructions. Cells were homogenized in buffer E (20 mM HEPES, 350 mM NaCl, 10% Glycerol, 0.1% Tween, 1 µg/ml pepstatin A, 0.5 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM PMSF) and snap-frozen three times for protein extraction. Protein extracts were fractionated by 5% SDS-PAGE, transferred to nitrocellulose membranes and revealed with a rabbit IgG polyclonal antibody raised against the Mll2 amino acids between SNL1 and SNL2 (see Fig. S1 in the supplementary material), and a polyclonal CBP antibody (Santa Cruz). The primer pairs for Q-PCR amplification of Hox cluster genes were: Hoxa2, TTCCCAGTTTCGCCTTTAACC and CAGTTCTGGCCCATTGTTGAC; Hoxa3, CCTTTCCCTTTTCTCCTCTGC and ACTGACAGCCTTTCCAGCAAC; Hoxa5, TATAGACGCACAAACGACCGC and CATTTGGATAGCGACCGCA; Hoxb2, CCCGCTGTCTTGGAGACATTT and TTTTGGCTCCCTGGTCTCTGA; Hoxb4, CGGAAACAGGAAAACGAGTCA and TGTGAATACTCCTCGCACGGA; Hoxb5, CCCCAAGTTGCCAGTGTTTCT and AACCTCAACTGCTGCCCCTTA; Pbx1, GCGCCGGGAGCCCATTTCTGC and GGTCCCTCCGGCCCCATCCTG.

Whole mount X-gal staining, immunohistochemistry and TUNEL assay
Embryos were dissected in PBS containing 0.4% BSA. Fixation was carried out at 4°C in 4% PFA for 20 minutes for E7.5 embryos and 1 hour for later stages. Embryos were washed three times for 5 minutes in PBS and stained overnight at 37°C in PBS containing 0.8 mg/ml X-Gal, 0.2 mg/ml sodium deoxycholate, 5 mM K3FE(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2 and 0.02% NP-40. Stained embryos were washed twice in PBS and fixed for 1 hour at room temperature in 4% PFA. Embryos were fixed in 4% paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 µm. Sections were processed for immunohistochemistry using the monoclonal Ki67 antigen antibody (Novo Castra) and a universal detection kit (Novostain) according to the manufacturer's instructions. Apoptotic cells on paraffin-embedded sections of three mutant embryos and three heterozygous littermates were detected by using an in situ Cell Death Detection Kit (Roche). Total cells numbers were determined on adjacent sections by DAPI staining. Embryos were collected and fixed in 4% PFA in PBS for 1 hour on ice. After three washes in PBS plus 0.1% Tween 20, embryos were stored at –20°C in methanol. Mutant embryos were identified by yolk-sac PCR. Whole-mount in situ hybridization was performed as described (Wilkinson and Nieto, 1993Go). An Mll2 probe was cloned with the following primers: 5-TAGAAGCAGCAGAGGAGAACC-3' and 5'-GGAGGAACCTCCCCTGCCATC-3'.

Chimera analysis and ES cell differentiation
Blastocysts were isolated at embryonic day E4.5. After injection of 20-25 targeted ES cells per blastocyst, 14 blastocysts were reintroduced into the uterus of pseudopregnant foster mothers. Injected Mll2+/– and Mll2–/– cells were detected in embryos by ß-galactosidase staining as whole mount (E8.5 and E9.5) or in sections (E10.5, E18.5). ES cells were differentiated on mass by plating onto bacterial plates in the absence of LIF or retinoic acid.

Database searches and classification of SET domains
The murine SET domain proteins were identified by searching the murine proteome (ENSEMBL release 30.33f) using a set of 11 profile HMMs (Eddy, 1998Go) based on a classification of the human SET domain proteins. All proteins included had E-values lower than 10–9. Each murine SET protein was classified by the highest scoring profile. The SET domain profile HMMs are available at http://www.uib.no/aasland/chrab/. In brief, they were obtained as follows: initially, a non-redundant set of human SET proteins was obtained with SMART (http://smart.embl-heidelberg.de/). After alignment and clustering the SET domains using Clustal X (Thomspon et al., 1997), nine groups were identified. Clusters of related sequences for each group were obtained by Blastp searches in all of SwissProt/Trembl. For each group, six to eight of the closest sequences were used to build profile HMMs that were subsequently used in iterative searches in SwissProt/Trembl. During this process, the groups SET7/9 and SET8 were separated from the larger Suv3-9 group, resulting in a total of 11 groups and corresponding profile HMMs. An alignment of SET domain sequences from mouse, human, zebrafish and Drosophila corresponding to the 11 groups described above was obtained by progressive profile-profile alignments using Clustal_X guided by a structure mask based on information from the structures of SET7/9, DIM-5, Clr4 and LSMT (pdb: 1O9S, 1PEG, 1MVH, 1P0Y). The mouse subset of this alignment (available at http://www.uib.no/aasland/chrab/) was used to generate a phylogenetic tree using the MrBayes software (Huelsenbeck and Ronquist, 2001Go).


    RESULTS
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A null allele for Mll2
To explore the function of Mll2, we created a multi-purpose allele (Fig. 2A), which can be converted from one state to another using FLPe and/or Cre recombination (Testa et al., 2004Go). An FRT flanked, genetrap-type, stop cassette (Friedrich and Soriano, 1991Go) was inserted into the first intron. As determined by RT-PCR (Fig. 2B), western blotting using an Mll2 specific antibody (Fig. 2C), in situ hybridization (Fig. 2D) and ß-galactosidase expression (Fig. 3), this cassette captures and truncates the transcript before the second exon. Because the Mll2 initiating methionine is in the first exon, a transcript encoding the first 121 amino acids of Mll2 fused to 40 frameshifted amino acids encoded by the second exon of the engrailed 2 gene could be expressed. The retained first 121 amino acids of Mll2 do not appear to contain any conserved residues or motifs (see Fig. S1 in the supplementary material).

Removal of one or both FRT cassettes either in homozygously mutated ES cells or in the germline fully restored wild-type function (data not shown). The targeted allele also included loxP sites flanking the small 73 bp second exon (Fig. 2A). Removal of exon 2 by Cre recombination invokes a frameshift in the mRNA. Embryos homozygous for deletions of both the FRT cassette and exon 2 displayed a phenotype indistinguishable from embryos homozygous for the targeted allele (Fig. 2E, Table 1). This phenotype was also observed in embryos homozygous for the removal of the second exon while leaving the FRT cassette in the gene (data not shown). Therefore we conclude that the mutant alleles are most probably nulls. For clarity we term the targeted allele `-', the FLP recombined allele `F', and the FLP and Cre recombined allele `FC' (Fig. 2A). As determined by ß-galactosidase expression, Mll2 is expressed widely from both alleles, except in the extra-embryonic tissues (Fig. 3).


View this table:
[in this window]
[in a new window]
 
Table 1. Embryonic lethality of MII2–/– and MII2 FC/FC embryos

 


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
Fig. 2. Targeted disruption of the mouse Mll2 gene. (A) The mouse Mll2 cDNA sequence is illustrated at the top to indicate the positions of domains and motifs (see Fig. S1 in the supplementary material for more details). Below is a diagram of the gene with exons shown as numbered boxes connected by known splicing events. The exact start site of transcription is not known but arises in the indicated CpG island. Polyadenylation signals are indicated by red circles. The RT-PCR primers and in situ probe are indicated below, as are the alleles after targeting, FLPe and Cre recombination. (B) RT-PCR analysis of E8.5 embryos. An Mll2-specific primer pair amplified a reaction product from Mll2+/– and Mll2+/+ embryos, but not from a Mll2–/– embryo. (C) Western blot analysis of wild-type and Mll2–/– ES cells probed with an antibody raised against Mll2 amino acids 864-980. The strong band detected in wild-type extract probably corresponds to the predicted proteolytic 225 kDa Mll2 fragment processed by Taspase. The weaker band in wild-type extract could correspond to the 284 kDa full-length protein. No bands were detected in extracts from Mll2–/– cells and the blot was controlled using antibodies against CBP, which is also very large. (D) Expression of Mll2 at E8.5. The expression is ubiquitous in the wild-type embryo and absent in the homozygous embryo. (E,F) Mll2–/– embryos and Mll2FC/FC embryos have an identical embryonic lethal phenotype, as illustrated here for E9.5.

 


Figure 3
View larger version (88K):
[in this window]
[in a new window]
 
Fig. 3. Phenotype of Mll2–/– embryos up to the last observable stage. Litters were taken from E6.5 to E11.5, as indicated, and stained (A-D) or not (E,F) for ß-galactosidase (E6.5-E9.5). Intensely staining embryos were homozygous and lighter staining embryos were heterozygous for the null allele. Staining seems absent from the extra-embryonic tissues (A,B).

 
Loss of Mll2 causes severe growth retardation and is cell autonomous
Mll2–/– and FC/FC embryos die before E11.5 (Table 1). The Mll2–/– mutation was originally created on a mixed 129Sv/C57BL/6 background. Careful inspections, particularly of skeletal preparations, failed to identify any heterozygous phenotype on this background. Increasing the C57BL/6 content resulted in a slight reduction in the severity of the homozygous phenotype (data not shown). We were unable to identify any cell-type specific defect in mutant embryos before E9.5. Mutant embryos developed all structures and cell types that we looked for. On the mixed 129Sv/C57BL/6 background, most embryos, but not all, showed incomplete closure of the neural tube. This phenotype diminished with increasing C57BL/6 content. Regardless of background, growth was increasingly slowed in all embryos from E6.5 (Fig. 3) and development was retarded from E7.5, as assessed later by counting somite numbers (Table 2) and observing other morphological markers, such as embryo turning.


View this table:
[in this window]
[in a new window]
 
Table 2. Retardation of MII2–/– embryos

 


Figure 4
View larger version (88K):
[in this window]
[in a new window]
 
Fig. 4. Mll2 is cell autonomously required. Chimeras made with wild type +/+ (A,E,I), Mll2+/– (B,F,J) or Mll2–/– (C,D,G,H,K,L) ES cells were harvested at the times indicated and stained for ß-galactosidase expression after sectioning (E18.5) or not (E8.5, E9.5). Embryos with Mll2–/– cells were divided into low (<50%) or high (>50%) percentage according to the intensity of staining. Blue stained cells were broadly distributed in all Mll2+/– and low percentage Mll2–/– embryos, except for E18.5–/– (K), where only a few blue staining cells could be observed in the condensing oral cartilage (L, a magnification of the boxed region in K), as well as the endogenous ß-galactosidase activity in the gut (I,J,K).

 
The lack of specificity in the phenotype suggested that a general explanation, like a nutritional problem caused by a placental defect, could be involved (Guillemot et al., 1994Go; Nagy and Rossant, 2001Go). Therefore we used Mll2–/– ES cells in chimera experiments. The Mll2–/– cells were made by exchanging the selectable gene in the targeting construct from neomycin resistance to hygromycin resistance by recombineering (Testa et al., 2004Go), followed by targeting in the Mll2+/– ES cells and double selection for G418 and hygromycin resistance. Targeting of the second allele occurred at a frequency compatible with the first targeting frequency (3% versus 8%, respectively), hence Mll2 is not required for ES cell survival.


Figure 5
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 5. Widespread apoptosis in E9.5 Mll2–/– embryos. Paraffin sections were taken from an Mll2–/– embryo (A) and a Mll2+/+ littermate (B), stained with TUNEL and then with Hematoxylin and Eosin. For greater contrast, A shows a section after TUNEL but before Hematoxylin and Eosin staining. (C) The average ratio of apoptotic cells to total cells from three embryos each yields the apoptotic index.

 
Chimeric embryos were analyzed at E8.5, E9.5, E10.5 and E18.5 (Fig. 4, Table 3). As determined by staining for ß-galactosidase, highly (>50%) chimeric Mll2–/– embryos recapitulated the Mll2–/– phenotype up to E10.5. No heavily blue stained embryos were found at E18.5. Therefore, in concordance with the observed lack of Mll2 expression in extra-embryonic cells (Fig. 3), placental defects do not explain the Mll2–/– phenotype. Embryos that had a low percentage (<50%) null cells developed normally. However Mll2-null cells were steadily eliminated from these chimeras with increasing developmental age. By E18.5, only a very few Mll2–/– cells, which appeared to be macrophages or chondrocytes, were found in any embryo (Fig. 4K,L; Table 3). Therefore, Mll2 is cell-autonomously required.


View this table:
[in this window]
[in a new window]
 
Table 3. Blastocyst-derived chimeras from ES cell injection

 
Widespread apoptosis in Mll2–/– embryos
We looked for other causes of the general catastrophe in embryogenesis that were consistent with a cell-autonomous requirement. Embryos were examined for the proliferation marker Ki-67 but showed no significant difference between mutant and wild type (data not shown), as well as for apoptosis by TUNEL staining. Widespread apoptosis was obvious (Fig. 5). Consequently, the simplest explanation for the phenotype is an increased rate of apoptosis, which slows growth and in turn retards development.


Figure 6
View larger version (113K):
[in this window]
[in a new window]
 
Fig. 6. In situ hybridization analysis of the paraxial mesoderm marker Mox1 indicates a defect in expression maintenance in Mll2–/– mutant embryos. Whole-mount embryos (A-D) and transverse sections (E-G) are depicted. (A) Expression of Mox1 in the presomitic mesoderm and somites of an E8.4 wild-type embryo (eight somites). (B) Expression of Mox1 in an E9.0 Mll2–/– embryo with eight somites. (C) In an E9.5 Mll2–/– embryo with 10 somites, Mox1 expression was lost in the anterior somites. (D) In an E9.75 Mll2–/– embryo, almost no Mox1 expression was detected. Defective longitudinal extension of paraxial mesoderm is the most likely cause of the uneven and compressed shape of the neural tube in mutant embryos at this stage. (E) Transverse section of the E8.4 wild-type embryo displayed in A shows mox1 expression in paraxial mesoderm. (F) TUNEL stained transverse section of the E9.5 Trx2–/– embryo displayed in C. Only a few apoptotic nuclei appear throughout the section; therefore, the Mox1 signal (arrow) is not decreasing because of apoptosis of the entire paraxial mesoderm at this stage. (G) TUNEL-stained transverse section of an E10.5 Mll–/– embryo. At this stage, the entire embryo section is positively stained, with the highest amount of apoptotic cells in the paraxial mesoderm (arrow).

 
Specificity in gene expression
A sign of cell type specificity was observed in the Mll2–/– embryos after E9.5 because the neural tube became kinky. In situ hybridization to Mox1, a marker for the somites (Candia et al., 1992Go), was used to examine this issue more closely (Fig. 6). Up to about the eight-somite stage, which is E9.5 for the mutant embryos (Table 2), Mox1 expression was initiated normally. Thereafter it was lost from the anteriormost somites (Fig. 6B,C) before decaying entirely (Fig. 6D). Loss of Mox1 expression appears to precede the disappearance of the somites for two reasons. First, the observed generalized apoptosis does not explain why Mox1 expression is lost first from the anteriormost somites. Second, inspection of sections showed that Mox1 expression is lost even though some somitic cells remain (Fig. 6F). Later, cells in this region show intense apoptosis (Fig. 6G).

By E9.5, Mll2–/– embryos are moribund, so the loss of Mox1 expression could be due to a generalized catastrophe rather than to a cell type-specific effect. Evidence in favor of cell type specificity was found because of the persistence of Wnt1 expression along the neural tube (Fig. 7B). As can be seen from this staining, the neural tube becomes highly buckled after the disappearance of the somites.

Trithorax in flies is a known regulator of HOM-C expression, and Mll regulates at least several Hox genes in mouse. Therefore, we looked at Hox complex gene expression. The developmental retardation and embryonic lethality prevented any meaningful analysis of middle to late Hox complex genes. However, a collapse of expression of Hoxb1 occurred sufficiently early in the mutant embryos to permit some confidence (Fig. 8). The correct expression domains of Hoxb1 were established in mutant embryos; however, expression decayed after establishment. Notably, expression decayed at the same time in all three main expression areas. By contrast, expression of Otx2, brachyury (Fig. 7C-E) and Hoxa1 (not shown) appeared normal.

Using Mll–/– ES cells in embryoid body differentiation experiments, Ernst et al. (Ernst et al., 2004bGo) showed that the induction of several Hoxa genes was severely impaired; however, Hoxb gene induction was not. Therefore, we performed similar experiments with Mll2–/– ES cells, using parental E14 cells and the doubly targeted Mll2–/– cells rescued by FLPe transfection to restore Mll2 expression, as controls (Fig. 8). Loss of Mll2 had no significant effect on expression of several Hoxa genes; however it did have a strong effect on expression of Hoxb2 and Hoxb5. These data strengthen the conclusion that Mll and Mll2 regulate different target genes.


Figure 7
View larger version (85K):
[in this window]
[in a new window]
 
Fig. 7. In situ hybridization analysis of Wnt1, Otx2 and T. The expression of these markers was relatively unaffected in Mll–/– embryos (B,D-F). Expression of Wnt1 in wild-type E9.5 embryo (A) compared with Mll–/– E10.5 (B). Buckling of the neural tube is caused by the loss of somites. Expression of Otx2 in wild-type E9.5 embryo (C) compared with Mll–/– E10.5 embryo (D). Expression of brachyury (T) in Mll–/– embryos at E8.5 (E) and E9.5 (F) shows that it was correctly established and maintained.

 

    DISCUSSION
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The trxG was originally identified in flies as supressors of PcG mutations. Recent evidence demonstrates that the PcG has biochemical coherence and is linked to histone lysine methylation at H3 K27 and possibly H3 K9 (Cao et al., 2002Go; Czermin et al., 2002Go; Kuzmichev et al., 2002Go; Muller et al., 2002Go; Levine et al., 2004Go). Whether the trxG has biochemical coherence is not clear. Based on finding a linkage between the yeast homolog of trxG member Ash2 and the first identified H3 K4 methyltransferase Set1, we proposed that a part of trxG action is linked to histone lysine methylation at H3 K4 (Roguev et al., 2001Go). Because active chromatin is characterized by methylation at H3 K4, and inactive chromatin by methylations at H3 K9 and/or H3 K27, the opposition between PcG and trxG lies, in part, at the level of histone methylation.


Figure 8
View larger version (91K):
[in this window]
[in a new window]
 
Fig. 8 In situ hybridization analysis of Hoxb1 indicates a defect in expression maintenance in Mll2–/– mutant embryos. Wild-type embryos from E8.75 (A) and E9.5 (B), and Mll2–/– embryos representing approximately E7.75 (C), E8.25 (D), E8.5 (E) and E8.75 (F) were hybridized with a Hoxb1 probe.

 
Mammals appear to have at least two, and up to seven or more, enzymes for each of the histone lysine methylation sites (Fig. 1). The yeast S. pombe has only one enzyme per site and these enzymes appear to play general roles in chromatin status, rather than specific roles in gene regulation. The added histone methyltransferase capacity in mammals suggests that gene-specific regulation in development, based upon epigenetic mechanisms of histone lysine methylation, is possible. To explore this possibility, the function of candidate histone lysine methyltransferases in development must be established. To date, Mll is the only H3 K4 methyltransferase to be analyzed in mouse development. Here, we have analyzed the roles of its sister gene, Mll2.

According to several criteria, the Mll2 alleles studied here show complete loss of function and we report the following observations. Mll2 is expressed in ES cells but is not required for ES cell viability. Mll2–/– ES cells or embryos show no detectable decrease in global H3 K4 dimethylation level, indicating that Mll2 is not a major source of this modification (data not shown). The first manifestation of loss of Mll2 in development is widespread growth retardation apparent by E7.5. The growth retarded embryos display widespread apoptosis and an increasing delay of developmental progress. By E9.5 the developmental delay is ~1 day. At this time, the first evidence for cell type specificity, involving specific loss of expression of Mox1 and Hoxb1, was observed.

Previous studies with H3 K4 methyltransferases in development have focused upon gene-specific regulation, including regulation of HOM-C and Hox complex genes, as well as other transcription factors such as the ecdysone receptor (Breen, 1999Go; Yu et al., 1998Go; Sedkov et al., 2003Go). Although we uncovered evidence for gene specificity, the loss of expression of Hoxb1 and Mox1 occurred well after other, widespread, cell-autonomous aspects of the phenotype. Growth retardation, apoptosis and developmental retardation all preceded noticeable cell type-specific effects. These defects were not due to inadequate function of extra-embryonic cells. Because both Hoxb1 and Mox1 expression patterns are established properly in the absence of Mll2, and then decay shortly before death, it is possible that the collapse of expression is due to secondary effects in the dying embryo. However, we found that expression of Wnt1 in cells neighboring those affected by the loss of Mll2 is maintained well after the loss of Mox1 expression. This observation lends some reason to conclude that Mll2 is a specific maintenance factor for Mox1 expression. It is also concordant with the existing propositions regarding its homolog in flies, Trithorax, and sister, Mll, which are both believed to act as maintenance factors for specific gene expression (Sedkov et al., 1994Go; Yu et al., 1998Go; Klymenko and Muller, 2004Go).

The roles for H3 K4 methyltransferases in gene expression remain enigmatic. In yeast, there is no evidence so far that the H3 K4 methyltransferase Set1 regulates specific gene expression (Santos-Rosa et al., 2002Go). Rather, Set1 and H3 K4 methylation play general roles in the maintenance of chromatin status, which includes an association with transcriptional activity (Ng et al., 2003Go; Krogan et al., 2003Go) and an opposition to H3 K9 methylation (Noma and Grewal, 2002Go). In development, the action of H3 K4 methyltransferases as maintenance factors is related to the opposition of PcG repression. That is, specific genes require trxG factors to maintain expression because otherwise PcG action will extinguish expression (Klymenko and Muller, 2004Go). This opposition may be due to the control of opposing nucleosomal methylations at H3 K4 and H3 K27. However, Trithorax and homologs appear to be transcriptional co-factors, both biochemically, because of associations with CBP (Ernst et al., 2001Go; Petruk et al., 2001Go) and the elongating RNAP II (Ng et al., 2003Go; Krogan et al., 2003Go; Smith et al., 2004Go; Guenther et al., 2005Go), and functionally (Milne et al., 2002Go; Sedkov et al., 2003Go; Smith et al., 2004Go; Milne et al., 2005Go). Because Trithorax and homologs are invariably large multi-domain proteins, it is likely that they act in both roles: as epigenetic factors to maintain active chromatin and as transcriptional co-factors that interact with the transcriptional machinery.

The Mll2–/– phenotype displays characteristics consistent with a general role implicit to all cells of the embryo, as well as gene-specific regulation in some cell types. The general role becomes evident after gastrulation and relates to widespread growth retardation, which is probably due to elevated apoptosis. If so, Mll2 may regulate an apoptotic component. Alternatively, increased apoptosis may be a consequence of complications caused by disorganized gene expression resulting from the loss of Mll2. If so, this may reflect a general role for Mll2 in gene expression, such as an association with RNA polymerase, as has been suggested for Mll (Guenther et al., 2005Go).


Figure 9
View larger version (50K):
[in this window]
[in a new window]
 
Fig. 9. Quantitative PCR analysis of Hox complex genes during embryoid body differentiation. The E14 cells used for targeting (wild type), the double-targeted Mll–/– cells and their FLPe rescued derivatives were differentiated in suspension in the absence of LIF or retinoic acid and harvested for RT-PCR analysis every second day. Each data point is the average from three parallel experiments. That is, three culture plates were differentiated, mRNA was harvested, cDNA was produced and Q-PCR analysis took place for each data point in parallel. Results are plotted as Ct values (one Ct value corresponds to a doubling of signal and all values less than 31 were assumed to be zero, i.e. 31). Pbx1 served as a control for RNA input. In our experience, the earlier activation of Hoxb2 and Hoxb5 seen in the rescued cells compared with wild type represents an implicit degree of variability involved in ES cell differentiation experiments, owing to either clone-to-clone or slight onset of differentiation differences.

 
Some doubt exists as to the exact nature of the Mll loss-of-function phenotype in development because the three published alleles differ and each could express a part of the protein containing highly conserved regions. Nevertheless, both the Yu (Yu et al., 1995Go) and Yagi (Yagi et al., 1998Go) alleles share specific homozygous phenotypic features that are distinct from those reported here for Mll2. When homozygous, neither of those alleles provokes obvious growth and developmental retardation, and somitic development appears to proceed normally at least until E10.5. Thereafter, apoptosis in the somites, but not the neural tube, was observed (Yu et al., 1998Go). Similarly we observed apoptosis confined to the somites (Fig. 6), but at an earlier developmental stage (Table 2). This represents another difference between the developmental roles of these sister genes. Furthermore, we suggest that the Yagi allele is the null phenotype because of the lack of polyadenylation, nuclear export of truncated Mll transcripts and protein expression. By contrast, it is known that a conserved part of Mll is expressed as a fusion protein with ß-galactosidase in the more aggressive Yu allele, which also shows a heterozygous phenotype as expected for a dominant-negative effect. If this suggestion is correct, then the differences between the Mll and Mll2 loss-of-function phenotypes in mouse development are considerable. The conclusion that Mll and Mll2 regulate different processes in development, including differences in Hox gene regulation, is strengthened by the observation that Mll2–/– ES cells show severely impaired Hoxb gene inductions (Fig. 9), whereas Mll–/– ES cells do not (Ernst et al., 2004bGo). Whether similar conclusions regarding specificities will also apply to the other four members of the H3 K4 methyltransferase group, or indeed to the other classes of epigenetic maintenance or silencing factors (Fig. 1), remains to be determined. Our findings indicate that mammalian development not only relies on networks of transcriptional regulation mediated by sequence specific transcription factors, but also on networks of epigenetic specificities.


    ACKNOWLEDGMENTS
 
We thank Giuseppe Testa and Michelle Meredyth for discussions, Matthew Betts (CBU, Bergen) for advice on using the MrBayes software, and Jussi Helppi for services at the animal facility of the Max-Planck-Institute for Cell Biology and Genetics, Dresden. K.R.T. held a fellowship from Research Council of Norway (146652/431). This work was supported by funding from the VW Foundation, Program on Conditional Mutagenesis and the Sixth Research Framework Programme of the European Union, Project FunGenES (LSHG-CT-2003-503494).


    Footnotes
 
Supplementary material

Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/8/1423/DC1

* Present address: Sydney IVF, 4 O'Connell Street, Sydney 2000, Australia Back

{dagger} Present address: Samuel Lunenfeld Research Institute, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada Back

{ddagger} Present address: German Cancer Research Centre, Im Neuenheimer Feld 280, Heidelberg, Germany Back


    REFERENCES
 TOP
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Angrand, P. O., Daigle, N., van der Hoeven, F., Scholer, H. R. and Stewart, A. F. (1999). Simplified generation of targeting constructs using ET recombination. Nucleic Acids Res. 27, e16.[Abstract/Free Full Text]
Ayton, P., Sneddon, S. F., Palmer, D. B., Rosewell, I. R., Owen, M. J., Young, B., Presley, R. and Subramanian, V. (2001). Truncation of the Mll gene in exon 5 by gene targeting leads to early preimplantation lethality of homozygous embryos. Genesis 30,201 -212.[CrossRef][Medline]
Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O., Allshire, R. C. and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410,120 -124.[CrossRef][Medline]
Bedford, M. T., Chan, D. C. and Leder, P. (1997). FBP WW domains and the Abl SH3 domain bind to a specific class of proline-rich ligands. EMBO J. 16,2376 -2383.[CrossRef][Medline]
Beisel, C., Imhof, A., Greene, J., Kremmer, E. and Sauer, F. (2002). Histone methylation by the Drosophila epigenetic transcriptional regulator Ash1. Nature 419,857 -862.[CrossRef][Medline]
Breen, T. R. (1999). Mutant alleles of the Drosophila trithorax gene produce common and unusual homeotic and other developmental phenotypes. Genetics 152,319 -344.[Abstract/Free Full Text]
Brock, H. W. and Fisher, C. L. (2005). Maintenance of gene expression patterns. Dev. Dyn. 232,633 -655.[CrossRef][Medline]
Cam, H. P., Sugiyama, T., Chen, E. S., Chen, X., FitzGerald, P. C. and Grewal, S. I. (2005). Comprehensive analysis of heterochromatin- and RNAi-mediated epigenetic control of the fission yeast genome. Nat. Genet. 37,809 -819.[CrossRef][Medline]
Candia, A. F., Hu, J., Crosby, J., Lalley, P. A., Noden, D., Nadeau, J. H. and Wright, C. V. (1992). Mox-1 and Mox-2 define a novel homeobox gene subfamily and are differentially expressed during early mesodermal patterning in mouse embryos. Development 116,1123 -1136.[Abstract]
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P., Jones, R. S. and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 298,1039 -1043.[Abstract/Free Full Text]
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002). Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111,185 -196.[CrossRef][Medline]
Dou, Y., Milne, T. A., Tackett, A. J., Smith, E. R., Fukuda, A., Wysocka, J., Allis, C. D., Chait, B. T., Hess, J. L. and Roeder, R. G. (2005). Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF. Cell 121,873 -885.[CrossRef][Medline]
Eddy, S. R. (1998). Profile hidden Markov models. BioInformatics 14,755 -763.[Abstract/Free Full Text]
Egger, G., Liang, G., Aparicio, A. and Jones, P. A. (2004). Epigenetics in human disease and prospects for epigenetic therapy. Nature 429,457 -463.[CrossRef][Medline]
Ernst, P., Wang, J., Huang, M., Goodman, R. H. and Korsmeyer, S. J. (2001). MLL and CREB bind cooperatively to the nuclear coactivator CREB-binding protein. Mol. Cell. Biol. 21,2249 -2258.[Abstract/Free Full Text]
Ernst, P., Fisher, J. K., Avery, W., Wade, S., Foy, D. and Korsmeyer, S. J. (2004a). Definitive hematopoiesis requires the mixed-lineage leukemia gene. Dev. Cell 6, 437-443.[CrossRef][Medline]
Ernst, P., Mabon, M., Davidson, A. J., Zon, L. I. and Korsmeyer, S. J. (2004b). An Mll-dependent Hox program drives hematopoietic progenitor expansion. Curr. Biol. 14,2063 -2069.[CrossRef][Medline]
FitzGerald, K. T. and Diaz, M. O. (1999). MLL2: A new mammalian member of the trx/MLL family of genes. Genomics 59,187 -192.[CrossRef][Medline]
Friedrich, G. and Soriano, P. (1991). Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev. 5,1513 -1523.[Abstract/Free Full Text]
Guenther, M. G., Jenner, R. G., Chevalier, B., Nakamura, T., Croce, C. M., Canaani, E. and Young, R. A. (2005). Global and Hox-specific roles for the MLL1 methyltransferase. Proc. Natl. Acad. Sci. USA 102,8603 -8608.[Abstract/Free Full Text]
Guillemot, F., Nagy, A., Auerbach, A., Rossant, J. and Joyner, A. L. (1994). Essential role of Mash-2 in extraembryonic development. Nature 371,333 -336.[CrossRef][Medline]
Hanson, R. D., Hess, J. L., Yu, B. D., Ernst, P., van Lohuizen, M., Berns, A., van der Lugt, N. M., Shashikant, C. S., Ruddle, F. H., Seto, M. et al. (1999). Mammalian Trithorax and polycomb-group homologues are antagonistic regulators of homeotic development. Proc. Natl. Acad. Sci. USA 96,14372 -14377.[Abstract/Free Full Text]
Hess, J. L., Yu, B. D., Li, B., Hanson, R. and Korsmeyer, S. J. (1997). Defects in yolk sac hematopoiesis in Mll-null embryos. Blood 90,1799 -1806.[Abstract/Free Full Text]
Huelsenbeck, J. P. and Ronquist, F. (2001). MRBAYES: Bayesian inference of phylogenetic trees. BioInformatics 17,754 -755.[Abstract/Free Full Text]
Hughes, C. M., Rozenblatt-Rosen, O., Milne, T. A., Copeland, T. D., Levine, S. S., Lee, J. C., Hayes, D. N., Shanmugam, K. S., Bhattacharjee, A., Biondi, C. A. et al. (2004). Menin associates with a trithorax family histone methyltransferase complex and with the hoxc8 locus. Mol. Cell 13,587 -597.[CrossRef][Medline]
Huntsman, D. G., Chin, S. F., Muleris, M., Batley, S. J., Collins, V. P., Wiedemann, L. M., Aparicio, S. and Caldas, C. (1999). MLL2, the second human homolog of the Drosophila trithorax gene, maps to 19q13.1 and is amplified in solid tumor cell lines. Oncogene 18,7975 -7984.[CrossRef][Medline]
Jaenisch, R. and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. Suppl. 33,245 -254.[CrossRef]
Klymenko, T. and Muller, J. (2004). The histone methyltransferases Trithorax and Ash1 prevent transcriptional silencing by Polycomb group proteins. EMBO Rep. 5, 373-377.[CrossRef][Medline]
Krogan, N. J., Dover, J., Khorrami, S., Greenblatt, J. F., Schneider, J., Johnston, M. and Shilatifard, A. (2002). COMPASS, a histone H3 (Lysine 4) methyltransferase required for telomeric silencing of gene expression. J. Biol. Chem. 277,10753 -10755.[Abstract/Free Full Text]
Krogan, N. J., Dover, J., Wood, A., Schneider, J., Heidt, J., Boateng, M. A., Dean, K., Ryan, O. W., Golshani, A., Johnston, M. et al. (2003). The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol. Cell 11,721 -729.[CrossRef][Medline]
Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P. and Reinberg, D. (2002). Histone methyltransferase activity associated with a human multiprotein complex containing the Enhancer of Zeste protein. Genes Dev. 16,2893 -2905.[Abstract/Free Full Text]
Lachner, M., O'Carroll, D., Rea, S., Mechtler, K. and Jenuwein, T. (2001). Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410,116 -120.[CrossRef][Medline]
Lallemand, Y., Luria, V., Haffner-Krausz, R. and Lonai, P. (1998). Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res. 7,105 -112.[CrossRef][Medline]
Lee, J. H. and Skalnik, D. G. (2005). CpG-binding protein (CXXC finger protein 1) is a component of the mammalian Set1 histone H3-Lys4 methyltransferase complex, the analogue of the yeast Set1/COMPASS complex. J. Biol. Chem. 280,41725 -41731.[Abstract/Free Full Text]
Levine, S. S., King, I. F. and Kingston, R. E. (2004). Division of labor in polycomb group repression. Trends Biochem. Sci. 29,478 -485.[CrossRef][Medline]
Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D. and Felsenfeld, G. (2001). Correlation between histone lysine methylation and developmental changes at the chicken beta-globin locus. Science 293,2453 -2455.[Abstract/Free Full Text]
Milne, T. A., Briggs, S. D., Brock, H. W., Martin, M. E., Gibbs, D., Allis, C. D. and Hess, J. L. (2002). MLL targets SET domain methyltransferase activity to Hox gene promoters. Mol. Cell 10,1107 -1117.[CrossRef][Medline]
Milne, T. A., Hughes, C. M., Lloyd, R., Yang, Z., Rozenblatt-Rosen, O., Dou, Y., Schnepp, R. W., Krankel, C., Livolsi, V. A., Gibbs, D. et al. (2005). Menin and MLL cooperatively regulate expression of cyclin-dependent kinase inhibitors. Proc. Natl. Acad. Sci. USA 102,749 -754.[Abstract/Free Full Text]
Muller, J., Hart, C. M., Francis, N. J., Vargas, M. L., Sengupta, A., Wild, B., Miller, E. L., O'Connor, M. B., Kingston, R. E. and Simon, J. A. (2002). Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111,197 -208.[CrossRef][Medline]
Nagy, A. and Rossant, J. (2001). Chimaeras and mosaics for dissecting complex mutant phenotypes. Int. J. Dev. Biol. 45,577 -582.[Medline]
Nagy, P. L., Griesenbeck, J., Kornberg, R. D. and Cleary, M. L. (2002). A trithorax-group complex purified from Saccharomyces cerevisiae is required for methylation of histone H3. Proc. Natl. Acad. Sci. USA 99, 90-94.[Abstract/Free Full Text]
Nakamura, T., Mori, T., Tada, S., Krajewski, W., Rozovskaia, T., Wassell, R., Dubois, G., Mazo, A., Croce, C. M. and Canaani, E. (2002). ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional regulation. Mol. Cell 10,1119 -1128.[CrossRef][Medline]
Ng, H. H., Robert, F., Young, R. A. and Struhl, K. (2003). Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol. Cell 11,709 -719.[CrossRef][Medline]
Noma, K. and Grewal, S. I. (2002). Histone H3 lysine 4 methylation is mediated by Set1 and promotes maintenance of active chromatin states in fission yeast. Proc. Natl. Acad. Sci. USA Suppl. 4 99,16438 -16445.[Abstract/Free Full Text]
Noma, K., Allis, C. D. and Grewal, S. I. (2001). Transitions in distinct histone H3 methylation patterns at the heterochromatin domain boundaries. Science 293,1150 -1155.[Abstract/Free Full Text]
Petruk, S., Sedkov, Y., Smith, S., Tillib, S., Kraevski, V., Nakamura, T., Canaani, E., Croce, C. M. and Mazo, A. (2001). Trithorax and dCBP acting in a complex to maintain expression of a homeotic gene. Science 294,1331 -1334.[Abstract/Free Full Text]
Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B. D., Sun, Z. W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D. et al. (2000). Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406,593 -599.[CrossRef][Medline]
Ringrose, L. and Paro, R. (2004). Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu. Rev. Genet. 38,413 -443.[CrossRef][Medline]
Rodriguez, C. I., Buchholz, F., Galloway, J., Sequerra, R., Kasper, J., Ayala, R., Stewart, A. F. and Dymecki, S. M. (2000). High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat. Genet. 25,139 -140.[CrossRef][Medline]
Roguev, A., Schaft, D., Shevchenko, A., Pijnappel, W. W., Wilm, M., Aasland, R. and Stewart, A. F. (2001). The Saccharomyces cerevisiae Set1 complex includes an Ash2 homologue and methylates histone 3 lysine 4. EMBO J. 20,7137 -7148.[CrossRef][Medline]
Roguev, A., Schaft, D., Shevchenko, A., Aasland, R. and Stewart, A. F. (2003). High conservation of the Set1/Rad6 axis of histone 3 lysine 4 methylation in budding and fission yeasts. J. Biol. Chem. 278,8487 -8493.[Abstract/Free Full Text]
Sanders, S. L., Portoso, M., Mata, J., Bahler, J., Allshire, R. C. and Kouzarides, T. (2004). Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage. Cell 119,603 -614.[CrossRef][Medline]
Santos-Rosa, H., Schneider, R., Bannister, A. J., Sherriff, J., Bernstein, B. E., Emre, N. C., Schreiber, S. L., Mellor, J. and Kouzarides, T. (2002). Active genes are tri-methylated at K4 of histone H3. Nature 419,407 -411.[CrossRef][Medline]
Sedkov, Y., Tillib, S., Mizrokhi, L. and Mazo, A. (1994). The bithorax complex is regulated by trithorax earlier during Drosophila embryogenesis than is the Antennapedia complex, correlating with a bithorax-like expression pattern of distinct early trithorax transcripts. Development 120,1907 -1917.[Abstract]
Sedkov, Y., Cho, E., Petruk, S., Cherbas, L., Smith, S. T., Jones, R. S., Cherbas, P., Canaani, E., Jaynes, J. B. and Mazo, A. (2003). Methylation at lysine 4 of histone H3 in ecdysone-dependent development of Drosophila. Nature 426, 78-83.[CrossRef][Medline]
Smith, S. T., Petruk, S., Sedkov, Y., Cho, E., Tillib, S., Canaani, E. and Mazo, A. (2004). Modulation of heat shock gene expression by the TAC1 chromatin-modifying complex. Nat. Cell Biol. 6,162 -167.[CrossRef][Medline]
Testa, G., Schaft, J., van der Hoeven, F., Glaser, S., Anastassiadis, K., Zhang, Y., Hermann, T., Stremmel, W. and Stewart, A. F. (2004). A reliable lacZ expression reporter cassette for multipurpose, knockout-first alleles. Genesis 38,151 -158.[CrossRef][Medline]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucl. Acids Res. 25,4876 -4882.[Abstract/Free Full Text]
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 225,361 -373.[Medline]
Wolffe, A. P. and Matzke, M. A. (1999). Epigenetics: regulation through repression. Science 286,481 -486.[Abstract/Free Full Text]
Wysocka, J., Myers, M. P., Laherty, C. D., Eisenman, R. N. and Herr, W. (2003). Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3-K4 methyltransferase are tethered together selectively by the cell-proliferation factor HCF-1. Genes Dev. 17,896 -911.[Abstract/Free Full Text]
Wysocka, J., Swigut, T., Milne, T. A., Dou, Y., Zhang, X., Burlingame, A. L., Roeder, R. G., Brivanlou, A. H. and Allis, C. D. (2005). WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development. Cell 121,859 -872.[CrossRef][Medline]
Yagi, H., Deguchi, K., Aono, A., Tani, Y., Kishimoto, T. and Komori, T. (1998). Growth disturbance in fetal liver hematopoiesis of Mll-mutant mice. Blood 92,108 -117.[Abstract/Free Full Text]
Yokoyama, A., Wang, Z., Wysocka, J., Sanyal, M., Aufiero, D. J., Kitabayashi, I., Herr, W. and Cleary, M. L. (2004). Leukemia proto-oncoprotein MLL forms a SET1-like histone methyltransferase complex with menin to regulate Hox gene expression. Mol. Cell. Biol. 24,5639 -5649.[Abstract/Free Full Text]
Yu, B. D., Hess, J. L., Horning, S. E., Brown, G. A. and Korsmeyer, S. J. (1995). Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378,505 -508.[CrossRef][Medline]
Yu, B. D., Hanson, R. D., Hess, J. L., Horning, S. E. and Korsmeyer, S. J. (1998). MLL, a mammalian trithorax-group gene, functions as a transcriptional maintenance factor in morphogenesis. Proc. Natl. Acad. Sci. USA 95,10632 -10636.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
P. Wang, C. Lin, E. R. Smith, H. Guo, B. W. Sanderson, M. Wu, M. Gogol, T. Alexander, C. Seidel, L. M. Wiedemann, et al.
Global Analysis of H3K4 Methylation Defines MLL Family Member Targets and Points to a Role for MLL1-Mediated H3K4 Methylation in the Regulation of Transcriptional Initiation by RNA Polymerase II
Mol. Cell. Biol., November 15, 2009; 29(22): 6074 - 6085.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. M. Tate, J.-H. Lee, and D. G. Skalnik
CXXC Finger Protein 1 Contains Redundant Functional Domains That Support Embryonic Stem Cell Cytosine Methylation, Histone Methylation, and Differentiation
Mol. Cell. Biol., July 15, 2009; 29(14): 3817 - 3831.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Liu, T. D. Westergard, and J. J.-D. Hsieh
MLL5 governs hematopoiesis: a step closer
Blood, February 12, 2009; 113(7): 1395 - 1396.
[Full Text] [PDF]


Home page
BloodHome page
Y. Zhang, J. Wong, M. Klinger, M. T. Tran, K. M. Shannon, and N. Killeen
Mll5 contributes to hematopoietic stem cell fitness and homeostasis
Blood, February 12, 2009; 113(7): 1455 - 1463.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Heuser, D. B. Yap, M. Leung, T. R. de Algara, A. Tafech, S. McKinney, J. Dixon, R. Thresher, B. Colledge, M. Carlton, et al.
Loss of Mll5 results in pleiotropic hematopoietic defects, reduced neutrophil immune function, and extreme sensitivity to DNA demethylation
Blood, February 12, 2009; 113(7): 1432 - 1443.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V. Madan, B. Madan, U. Brykczynska, F. Zilbermann, K. Hogeveen, K. Dohner, H. Dohner, O. Weber, C. Blum, H.-R. Rodewald, et al.
Impaired function of primitive hematopoietic cells in mice lacking the Mixed-Lineage-Leukemia homolog Mll5
Blood, February 12, 2009; 113(7): 1444 - 1454.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Wu, P. F. Wang, J. S. Lee, S. Martin-Brown, L. Florens, M. Washburn, and A. Shilatifard
Molecular Regulation of H3K4 Trimethylation by Wdr82, a Component of Human Set1/COMPASS
Mol. Cell. Biol., December 15, 2008; 28(24): 7337 - 7344.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Patel, V. E. Vought, V. Dharmarajan, and M. S. Cosgrove
A Conserved Arginine-containing Motif Crucial for the Assembly and Enzymatic Activity of the Mixed Lineage Leukemia Protein-1 Core Complex
J. Biol. Chem., November 21, 2008; 283(47): 32162 - 32175.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Schotta, R. Sengupta, S. Kubicek, S. Malin, M. Kauer, E. Callen, A. Celeste, M. Pagani, S. Opravil, I. A. De La Rosa-Velazquez, et al.
A chromatin-wide transition to H4K20 monomethylation impairs genome integrity and programmed DNA rearrangements in the mouse
Genes & Dev., August 1, 2008; 22(15): 2048 - 2061.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J.-H. Lee and D. G. Skalnik
Wdr82 Is a C-Terminal Domain-Binding Protein That Recruits the Setd1A Histone H3-Lys4 Methyltransferase Complex to Transcription Start Sites of Transcribed Human Genes
Mol. Cell. Biol., January 15, 2008; 28(2): 609 - 618.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. D. Gregory, C. R. Vakoc, T. Rozovskaia, X. Zheng, S. Patel, T. Nakamura, E. Canaani, and G. A. Blobel
Mammalian ASH1L Is a Histone Methyltransferase That Occupies the Transcribed Region of Active Genes
Mol. Cell. Biol., December 15, 2007; 27(24): 8466 - 8479.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
H. Niwa
Open conformation chromatin and pluripotency
Genes & Dev., November 1, 2007; 21(21): 2671 - 2676.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-W. Cho, T. Hong, S. Hong, H. Guo, H. Yu, D. Kim, T. Guszczynski, G. R. Dressler, T. D. Copeland, M. Kalkum, et al.
PTIP Associates with MLL3- and MLL4-containing Histone H3 Lysine 4 Methyltransferase Complex
J. Biol. Chem., July 13, 2007; 282(28): 20395 - 20406.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Lubitz, S. Glaser, J. Schaft, A. F. Stewart, and K. Anastassiadis
Increased Apoptosis and Skewed Differentiation in Mouse Embryonic Stem Cells Lacking the Histone Methyltransferase Mll2
Mol. Biol. Cell, June 1, 2007; 18(6): 2356 - 2366.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-H. Lee, C. M. Tate, J.-S. You, and D. G. Skalnik
Identification and Characterization of the Human Set1B Histone H3-Lys4 Methyltransferase Complex
J. Biol. Chem., May 4, 2007; 282(18): 13419 - 13428.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Lee, D.-K. Lee, Y. Dou, J. Lee, B. Lee, E. Kwak, Y.-Y. Kong, S.-K. Lee, R. G. Roeder, and J. W. Lee
Coactivator as a target gene specificity determinant for histone H3 lysine 4 methyltransferases
PNAS, October 17, 2006; 103(42): 15392 - 15397.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Supplementary Material
Right arrow All Versions of this Article:
dev.02302v1
133/8/1423    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Glaser, S.
Right arrow Articles by Stewart, A. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Glaser, S.
Right arrow Articles by Stewart, A. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?