|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 15 March 2006
doi: 10.1242/dev.02302
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



1 Genomics, BioInnovationsZentrum, Dresden University of Technology, Am Tatzberg
47, Dresden 01307, Germany.
2 Department of Molecular Biology and Computational Biology Unit at BCCS,
University of Bergen, HiB, Bergen N5020, Norway.
3 National Institute for Medical Research, The Ridgeway Mill Hill, London NW7
1AA, UK.
Author for correspondence (e-mail:
stewart{at}biotec.tu-dresden.de)
Accepted 7 February 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Epigenetics, Histone methylation, SET domain
| INTRODUCTION |
|---|
|
|
|---|
Active chromatin states may also be epigenetically maintained because
alternative histone lysine methylations, mainly at H3 K4, characterize active
chromatin and preclude the lysine methylations that characterize inactive
chromatin (Noma et al., 2001
;
Litt et al., 2001
). The
functional opposition of these two classes of histone lysine methylation was
further supported by linkage to the antagonism between Polycomb- and
trithorax-Group (PcG and trxG) action
(Brock and Fisher, 2005
;
Ringrose and Paro, 2004
). The
association of trxG action with H3 K4 methylation
(Roguev et al., 2001
;
Krogan et al., 2002
;
Milne et al., 2002
;
Nagy et al., 2002
;
Nakamura et al., 2002
;
Beisel et al., 2002
) and PcG
action with H3 K27 methylation (Cao et
al., 2002
; Czermin et al.,
2002
; Kuzmichev et al.,
2002
; Muller et al.,
2002
) provides a molecular explanation for this antagonism.
The silencing methylations at both H3 K9 and H3 K27 are epigenetically maintained via positive-feedback loops. The relevant methyltransferases [SUV39 and E(Z), respectively] associate with a protein (HP1 and Polycomb, respectively) that recognizes the methylated epitope. The enzyme is thereby associated with the chromatin that it has methylated, to methylate it further and propagate the silent state.
Recent evidence indicates that maintenance of active chromatin occurs in
the same way, because a constituent protein of all H3 K4 methyltransferase
complexes, WDR5/SWD3 (Roguev et al.,
2001
; Krogan et al.,
2002
; Nagy et al.,
2002
; Wysocka et al.,
2003
; Hughes et al.,
2004
; Yokoyama et al.,
2004
; Dou et al.,
2005
; Lee and Skalnik,
2005
), binds to methylated H3 K4
(Wysocka et al., 2005
).
These observations support the polarization model, which is based on
opposing positive feedback loops (Jaenisch
and Bird, 2003
). Both active and heterochromatic states involve
several positive feedback loops that reinforce the local status quo. Hence,
each state has an implicit epigenetic status that adds stability and reduces
the chances of inadvertent transitions to the other state.
The polarization model poses questions that can now be addressed. Do
uncommitted neutral chromatin states exist? How are active and silenced states
specified? Are transitions between active and heterochromatic states used to
regulate gene expression and if so, how? These questions are particularly
relevant to the study of development because the transition from the
totipotency of the zygote to differentiated states in the adult is reflected
by changes in the epigenetic status of chromatin
(Jaenisch and Bird, 2003
).
S. pombe has only one enzyme for each of the active and
heterochromatic lysine methylation sites
(Roguev et al., 2003
;
Sanders et al., 2004
;
Cam et al., 2005
). To date, no
evidence for specific gene regulation by histone methylation in either S.
pombe or S. cerevisiae has been observed. Higher eukaryotes have
several enzymes for each site of lysine methylation. SET domain sequence
alignments suggest that the mouse genome encodes at least six H3 K4
methyltransferases and at least seven H3 K9 methyltransferases
(Fig. 1). Because gene-specific
regulation by epigenesis during development has been anticipated but not yet
defined, we decided to look among these SET domain factors in mouse
development.
|
Mammals have a second trithorax homologue, Mll2, as well
as two other similar genes Mll3 and Mll4, and two more
genes, Set1a and Set1b, which contain very similar SET
domains (Fig. 1). Mll
and Mll2 are closely related proteins (see Fig. S1 in the
supplementary material), having arisen from a duplication that includes the
upstream [Plzf (Zbtb16 Mouse Genome Informatics) and
Plzf2] and downstream (U2af1 and U2af1l4) genes
(FitzGerald and Diaz, 1999
).
The functional relationship between Mll and Mll2 is not
known. Both proteins are very large, share the same architecture
(Fig. 2A; see Fig. S1 in the
supplementary material) and are expressed from CpG islands in a nearly, but
not completely, ubiquitous manner, including in ES cells and all major
tissues, as determined by northern analysis
(FitzGerald and Diaz, 1999
)
(data not shown). Partial characterizations of associated proteins indicate
that they both reside in similar complexes
(Hughes et al., 2004
;
Yokoyama et al., 2004
;
Dou et al., 2005
), as do
Set1a/b (Wysocka et al., 2003
;
Lee and Skalnik, 2005
).
Because Mll and Mll2 are orthologous, a comparison of their functional roles in mouse development represents a good way to look for evidence of epigenetic regulation in specific gene expression. Therefore we created a multipurpose allele for Mll2. By conversion of the allele from one state to another, we established the null phenotype in mouse development and in ES cells.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Expression analysis by RT-PCR and western blotting
Total RNA from individual embryos or cells was extracted using TriReagent
(Sigma) according to the manufacturer's instructions. First-strand cDNA was
synthesized from 1 µg of total RNA using M-MLV reverse transcriptase
(Promega). The primer pairs that produced a 1228 bp product were: mll2se,
5'-GCAGCAGAGGAGAACCAGACC-3'; mll2as,
5'-GGAGGAACCTCCCCTGCCATC. LacZse (5'-AAGTTCAGATGTGCGGCGAGTT) and
LacZas (5'-GGCTTCATCCACCACATACAGG) produced a 511 bp product. Actin
primers were described previously (Testa
et al., 2004
). Q-PCR was performed using a Stratagene MX4000
according to the manufacturer's instructions. Cells were homogenized in buffer
E (20 mM HEPES, 350 mM NaCl, 10% Glycerol, 0.1% Tween, 1 µg/ml pepstatin A,
0.5 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM PMSF) and snap-frozen three
times for protein extraction. Protein extracts were fractionated by 5%
SDS-PAGE, transferred to nitrocellulose membranes and revealed with a rabbit
IgG polyclonal antibody raised against the Mll2 amino acids between SNL1 and
SNL2 (see Fig. S1 in the supplementary material), and a polyclonal CBP
antibody (Santa Cruz). The primer pairs for Q-PCR amplification of Hox cluster
genes were: Hoxa2, TTCCCAGTTTCGCCTTTAACC and CAGTTCTGGCCCATTGTTGAC; Hoxa3,
CCTTTCCCTTTTCTCCTCTGC and ACTGACAGCCTTTCCAGCAAC; Hoxa5, TATAGACGCACAAACGACCGC
and CATTTGGATAGCGACCGCA; Hoxb2, CCCGCTGTCTTGGAGACATTT and
TTTTGGCTCCCTGGTCTCTGA; Hoxb4, CGGAAACAGGAAAACGAGTCA and TGTGAATACTCCTCGCACGGA;
Hoxb5, CCCCAAGTTGCCAGTGTTTCT and AACCTCAACTGCTGCCCCTTA; Pbx1,
GCGCCGGGAGCCCATTTCTGC and GGTCCCTCCGGCCCCATCCTG.
Whole mount X-gal staining, immunohistochemistry and TUNEL assay
Embryos were dissected in PBS containing 0.4% BSA. Fixation was carried out
at 4°C in 4% PFA for 20 minutes for E7.5 embryos and 1 hour for later
stages. Embryos were washed three times for 5 minutes in PBS and stained
overnight at 37°C in PBS containing 0.8 mg/ml X-Gal, 0.2 mg/ml sodium
deoxycholate, 5 mM K3FE(CN)6, 5 mM
K4Fe(CN)6, 2 mM MgCl2 and 0.02% NP-40.
Stained embryos were washed twice in PBS and fixed for 1 hour at room
temperature in 4% PFA. Embryos were fixed in 4% paraformaldehyde, dehydrated,
embedded in paraffin and sectioned at 6 µm. Sections were processed for
immunohistochemistry using the monoclonal Ki67 antigen antibody (Novo Castra)
and a universal detection kit (Novostain) according to the manufacturer's
instructions. Apoptotic cells on paraffin-embedded sections of three mutant
embryos and three heterozygous littermates were detected by using an in situ
Cell Death Detection Kit (Roche). Total cells numbers were determined on
adjacent sections by DAPI staining. Embryos were collected and fixed in 4% PFA
in PBS for 1 hour on ice. After three washes in PBS plus 0.1% Tween 20,
embryos were stored at 20°C in methanol. Mutant embryos were
identified by yolk-sac PCR. Whole-mount in situ hybridization was performed as
described (Wilkinson and Nieto,
1993
). An Mll2 probe was cloned with the following
primers: 5-TAGAAGCAGCAGAGGAGAACC-3' and
5'-GGAGGAACCTCCCCTGCCATC-3'.
Chimera analysis and ES cell differentiation
Blastocysts were isolated at embryonic day E4.5. After injection of 20-25
targeted ES cells per blastocyst, 14 blastocysts were reintroduced into the
uterus of pseudopregnant foster mothers. Injected
Mll2+/ and Mll2/
cells were detected in embryos by ß-galactosidase staining as whole mount
(E8.5 and E9.5) or in sections (E10.5, E18.5). ES cells were differentiated on
mass by plating onto bacterial plates in the absence of LIF or retinoic
acid.
Database searches and classification of SET domains
The murine SET domain proteins were identified by searching the murine
proteome (ENSEMBL release 30.33f) using a set of 11 profile HMMs
(Eddy, 1998
) based on a
classification of the human SET domain proteins. All proteins included had
E-values lower than 109. Each murine SET protein was
classified by the highest scoring profile. The SET domain profile HMMs are
available at
http://www.uib.no/aasland/chrab/.
In brief, they were obtained as follows: initially, a non-redundant set of
human SET proteins was obtained with SMART
(http://smart.embl-heidelberg.de/).
After alignment and clustering the SET domains using Clustal X (Thomspon et
al., 1997), nine groups were identified. Clusters of related sequences for
each group were obtained by Blastp searches in all of SwissProt/Trembl. For
each group, six to eight of the closest sequences were used to build profile
HMMs that were subsequently used in iterative searches in SwissProt/Trembl.
During this process, the groups SET7/9 and SET8 were separated from the larger
Suv3-9 group, resulting in a total of 11 groups and corresponding profile
HMMs. An alignment of SET domain sequences from mouse, human, zebrafish and
Drosophila corresponding to the 11 groups described above was
obtained by progressive profile-profile alignments using Clustal_X guided by a
structure mask based on information from the structures of SET7/9, DIM-5, Clr4
and LSMT (pdb: 1O9S, 1PEG, 1MVH, 1P0Y). The mouse subset of this alignment
(available at
http://www.uib.no/aasland/chrab/)
was used to generate a phylogenetic tree using the MrBayes software
(Huelsenbeck and Ronquist,
2001
).
| RESULTS |
|---|
|
|
|---|
Removal of one or both FRT cassettes either in homozygously mutated ES cells or in the germline fully restored wild-type function (data not shown). The targeted allele also included loxP sites flanking the small 73 bp second exon (Fig. 2A). Removal of exon 2 by Cre recombination invokes a frameshift in the mRNA. Embryos homozygous for deletions of both the FRT cassette and exon 2 displayed a phenotype indistinguishable from embryos homozygous for the targeted allele (Fig. 2E, Table 1). This phenotype was also observed in embryos homozygous for the removal of the second exon while leaving the FRT cassette in the gene (data not shown). Therefore we conclude that the mutant alleles are most probably nulls. For clarity we term the targeted allele `-', the FLP recombined allele `F', and the FLP and Cre recombined allele `FC' (Fig. 2A). As determined by ß-galactosidase expression, Mll2 is expressed widely from both alleles, except in the extra-embryonic tissues (Fig. 3).
|
|
|
|
|
|
|
|
By E9.5, Mll2/ embryos are moribund, so the loss of Mox1 expression could be due to a generalized catastrophe rather than to a cell type-specific effect. Evidence in favor of cell type specificity was found because of the persistence of Wnt1 expression along the neural tube (Fig. 7B). As can be seen from this staining, the neural tube becomes highly buckled after the disappearance of the somites.
Trithorax in flies is a known regulator of HOM-C expression, and Mll regulates at least several Hox genes in mouse. Therefore, we looked at Hox complex gene expression. The developmental retardation and embryonic lethality prevented any meaningful analysis of middle to late Hox complex genes. However, a collapse of expression of Hoxb1 occurred sufficiently early in the mutant embryos to permit some confidence (Fig. 8). The correct expression domains of Hoxb1 were established in mutant embryos; however, expression decayed after establishment. Notably, expression decayed at the same time in all three main expression areas. By contrast, expression of Otx2, brachyury (Fig. 7C-E) and Hoxa1 (not shown) appeared normal.
Using Mll/ ES cells in embryoid body
differentiation experiments, Ernst et al.
(Ernst et al., 2004b
) showed
that the induction of several Hoxa genes was severely impaired; however, Hoxb
gene induction was not. Therefore, we performed similar experiments with
Mll2/ ES cells, using parental E14 cells and
the doubly targeted Mll2/ cells rescued by
FLPe transfection to restore Mll2 expression, as controls
(Fig. 8). Loss of Mll2 had no
significant effect on expression of several Hoxa genes; however it did have a
strong effect on expression of Hoxb2 and Hoxb5. These data
strengthen the conclusion that Mll and Mll2 regulate different target
genes.
|
| DISCUSSION |
|---|
|
|
|---|
|
According to several criteria, the Mll2 alleles studied here show
complete loss of function and we report the following observations. Mll2 is
expressed in ES cells but is not required for ES cell viability.
Mll2/ ES cells or embryos show no detectable
decrease in global H3 K4 dimethylation level, indicating that Mll2 is not a
major source of this modification (data not shown). The first manifestation of
loss of Mll2 in development is widespread growth retardation apparent by E7.5.
The growth retarded embryos display widespread apoptosis and an increasing
delay of developmental progress. By E9.5 the developmental delay is
1
day. At this time, the first evidence for cell type specificity, involving
specific loss of expression of Mox1 and Hoxb1, was
observed.
Previous studies with H3 K4 methyltransferases in development have focused
upon gene-specific regulation, including regulation of HOM-C and Hox complex
genes, as well as other transcription factors such as the ecdysone receptor
(Breen, 1999
;
Yu et al., 1998
;
Sedkov et al., 2003
). Although
we uncovered evidence for gene specificity, the loss of expression of
Hoxb1 and Mox1 occurred well after other, widespread,
cell-autonomous aspects of the phenotype. Growth retardation, apoptosis and
developmental retardation all preceded noticeable cell type-specific effects.
These defects were not due to inadequate function of extra-embryonic cells.
Because both Hoxb1 and Mox1 expression patterns are
established properly in the absence of Mll2, and then decay shortly before
death, it is possible that the collapse of expression is due to secondary
effects in the dying embryo. However, we found that expression of
Wnt1 in cells neighboring those affected by the loss of Mll2 is
maintained well after the loss of Mox1 expression. This observation
lends some reason to conclude that Mll2 is a specific maintenance factor for
Mox1 expression. It is also concordant with the existing propositions
regarding its homolog in flies, Trithorax, and sister, Mll, which are both
believed to act as maintenance factors for specific gene expression
(Sedkov et al., 1994
;
Yu et al., 1998
;
Klymenko and Muller,
2004
).
The roles for H3 K4 methyltransferases in gene expression remain enigmatic.
In yeast, there is no evidence so far that the H3 K4 methyltransferase Set1
regulates specific gene expression
(Santos-Rosa et al., 2002
).
Rather, Set1 and H3 K4 methylation play general roles in the maintenance of
chromatin status, which includes an association with transcriptional activity
(Ng et al., 2003
;
Krogan et al., 2003
) and an
opposition to H3 K9 methylation (Noma and
Grewal, 2002
). In development, the action of H3 K4
methyltransferases as maintenance factors is related to the opposition of PcG
repression. That is, specific genes require trxG factors to maintain
expression because otherwise PcG action will extinguish expression
(Klymenko and Muller, 2004
).
This opposition may be due to the control of opposing nucleosomal methylations
at H3 K4 and H3 K27. However, Trithorax and homologs appear to be
transcriptional co-factors, both biochemically, because of associations with
CBP (Ernst et al., 2001
;
Petruk et al., 2001
) and the
elongating RNAP II (Ng et al.,
2003
; Krogan et al.,
2003
; Smith et al.,
2004
; Guenther et al.,
2005
), and functionally (Milne
et al., 2002
; Sedkov et al.,
2003
; Smith et al.,
2004
; Milne et al.,
2005
). Because Trithorax and homologs are invariably large
multi-domain proteins, it is likely that they act in both roles: as epigenetic
factors to maintain active chromatin and as transcriptional co-factors that
interact with the transcriptional machinery.
The Mll2/ phenotype displays
characteristics consistent with a general role implicit to all cells of the
embryo, as well as gene-specific regulation in some cell types. The general
role becomes evident after gastrulation and relates to widespread growth
retardation, which is probably due to elevated apoptosis. If so, Mll2 may
regulate an apoptotic component. Alternatively, increased apoptosis may be a
consequence of complications caused by disorganized gene expression resulting
from the loss of Mll2. If so, this may reflect a general role for
Mll2 in gene expression, such as an association with RNA polymerase, as has
been suggested for Mll (Guenther et al.,
2005
).
|
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Supplementary material for this article is available at http://dev.biologists.org/cgi/content/full/133/8/1423/DC1
* Present address: Sydney IVF, 4 O'Connell Street, Sydney 2000, Australia ![]()
Present address: Samuel Lunenfeld Research Institute, 600 University
Avenue, Toronto, Ontario M5G 1X5, Canada ![]()
Present address: German Cancer Research Centre, Im Neuenheimer Feld 280,
Heidelberg, Germany ![]()
| REFERENCES |
|---|
|
|
|---|
Angrand, P. O., Daigle, N., van der Hoeven, F., Scholer, H. R.
and Stewart, A. F. (1999). Simplified generation of targeting
constructs using ET recombination. Nucleic Acids Res.
27, e16.
Ayton, P., Sneddon, S. F., Palmer, D. B., Rosewell, I. R., Owen, M. J., Young, B., Presley, R. and Subramanian, V. (2001). Truncation of the Mll gene in exon 5 by gene targeting leads to early preimplantation lethality of homozygous embryos. Genesis 30,201 -212.[CrossRef][Medline]
Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O., Allshire, R. C. and Kouzarides, T. (2001). Selective recognition of methylated lysine 9 on histone H3 by the HP1 chromo domain. Nature 410,120 -124.[CrossRef][Medline]
Bedford, M. T., Chan, D. C. and Leder, P. (1997). FBP WW domains and the Abl SH3 domain bind to a specific class of proline-rich ligands. EMBO J. 16,2376 -2383.[CrossRef][Medline]
Beisel, C., Imhof, A., Greene, J., Kremmer, E. and Sauer, F. (2002). Histone methylation by the Drosophila epigenetic transcriptional regulator Ash1. Nature 419,857 -862.[CrossRef][Medline]
Breen, T. R. (1999). Mutant alleles of the
Drosophila trithorax gene produce common and unusual homeotic and other
developmental phenotypes. Genetics
152,319
-344.
Brock, H. W. and Fisher, C. L. (2005). Maintenance of gene expression patterns. Dev. Dyn. 232,633 -655.[CrossRef][Medline]
Cam, H. P., Sugiyama, T., Chen, E. S., Chen, X., FitzGerald, P. C. and Grewal, S. I. (2005). Comprehensive analysis of heterochromatin- and RNAi-mediated epigenetic control of the fission yeast genome. Nat. Genet. 37,809 -819.[CrossRef][Medline]
Candia, A. F., Hu, J., Crosby, J., Lalley, P. A., Noden, D., Nadeau, J. H. and Wright, C. V. (1992). Mox-1 and Mox-2 define a novel homeobox gene subfamily and are differentially expressed during early mesodermal patterning in mouse embryos. Development 116,1123 -1136.[Abstract]
Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H.,
Tempst, P., Jones, R. S. and Zhang, Y. (2002). Role of
histone H3 lysine 27 methylation in Polycomb-group silencing.
Science 298,1039
-1043.
Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002). Drosophila enhancer of Zeste/ESC complexes have a histone H3 methyltransferase activity that marks chromosomal Polycomb sites. Cell 111,185 -196.[CrossRef][Medline]
Dou, Y., Milne, T. A., Tackett, A. J., Smith, E. R., Fukuda, A., Wysocka, J., Allis, C. D., Chait, B. T., Hess, J. L. and Roeder, R. G. (2005). Physical association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF. Cell 121,873 -885.[CrossRef][Medline]
Eddy, S. R. (1998). Profile hidden Markov
models. BioInformatics
14,755
-763.
Egger, G., Liang, G., Aparicio, A. and Jones, P. A. (2004). Epigenetics in human disease and prospects for epigenetic therapy. Nature 429,457 -463.[CrossRef][Medline]
Ernst, P., Wang, J., Huang, M., Goodman, R. H. and Korsmeyer, S.
J. (2001). MLL and CREB bind cooperatively to the nuclear
coactivator CREB-binding protein. Mol. Cell. Biol.
21,2249
-2258.
Ernst, P., Fisher, J. K., Avery, W., Wade, S., Foy, D. and Korsmeyer, S. J. (2004a). Definitive hematopoiesis requires the mixed-lineage leukemia gene. Dev. Cell 6, 437-443.[CrossRef][Medline]
Ernst, P., Mabon, M., Davidson, A. J., Zon, L. I. and Korsmeyer, S. J. (2004b). An Mll-dependent Hox program drives hematopoietic progenitor expansion. Curr. Biol. 14,2063 -2069.[CrossRef][Medline]
FitzGerald, K. T. and Diaz, M. O. (1999). MLL2: A new mammalian member of the trx/MLL family of genes. Genomics 59,187 -192.[CrossRef][Medline]
Friedrich, G. and Soriano, P. (1991). Promoter
traps in embryonic stem cells: a genetic screen to identify and mutate
developmental genes in mice. Genes Dev.
5,1513
-1523.
Guenther, M. G., Jenner, R. G., Chevalier, B., Nakamura, T.,
Croce, C. M., Canaani, E. and Young, R. A. (2005). Global and
Hox-specific roles for the MLL1 methyltransferase. Proc. Natl.
Acad. Sci. USA 102,8603
-8608.
Guillemot, F., Nagy, A., Auerbach, A., Rossant, J. and Joyner, A. L. (1994). Essential role of Mash-2 in extraembryonic development. Nature 371,333 -336.[CrossRef][Medline]
Hanson, R. D., Hess, J. L., Yu, B. D., Ernst, P., van Lohuizen,
M., Berns, A., van der Lugt, N. M., Shashikant, C. S., Ruddle, F. H., Seto, M.
et al. (1999). Mammalian Trithorax and polycomb-group
homologues are antagonistic regulators of homeotic development.
Proc. Natl. Acad. Sci. USA
96,14372
-14377.
Hess, J. L., Yu, B. D., Li, B., Hanson, R. and Korsmeyer, S.
J. (1997). Defects in yolk sac hematopoiesis in Mll-null
embryos. Blood 90,1799
-1806.
Huelsenbeck, J. P. and Ronquist, F. (2001).
MRBAYES: Bayesian inference of phylogenetic trees.
BioInformatics 17,754
-755.
Hughes, C. M., Rozenblatt-Rosen, O., Milne, T. A., Copeland, T. D., Levine, S. S., Lee, J. C., Hayes, D. N., Shanmugam, K. S., Bhattacharjee, A., Biondi, C. A. et al. (2004). Menin associates with a trithorax family histone methyltransferase complex and with the hoxc8 locus. Mol. Cell 13,587 -597.[CrossRef][Medline]
Huntsman, D. G., Chin, S. F., Muleris, M., Batley, S. J., Collins, V. P., Wiedemann, L. M., Aparicio, S. and Caldas, C. (1999). MLL2, the second human homolog of the Drosophila trithorax gene, maps to 19q13.1 and is amplified in solid tumor cell lines. Oncogene 18,7975 -7984.[CrossRef][Medline]
Jaenisch, R. and Bird, A. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat. Genet. Suppl. 33,245 -254.[CrossRef]
Klymenko, T. and Muller, J. (2004). The histone methyltransferases Trithorax and Ash1 prevent transcriptional silencing by Polycomb group proteins. EMBO Rep. 5, 373-377.[CrossRef][Medline]
Krogan, N. J., Dover, J., Khorrami, S., Greenblatt, J. F.,
Schneider, J., Johnston, M. and Shilatifard, A. (2002).
COMPASS, a histone H3 (Lysine 4) methyltransferase required for telomeric
silencing of gene expression. J. Biol. Chem.
277,10753
-10755.
Krogan, N. J., Dover, J., Wood, A., Schneider, J., Heidt, J., Boateng, M. A., Dean, K., Ryan, O. W., Golshani, A., Johnston, M. et al. (2003). The Paf1 complex is required for histone H3 methylation by COMPASS and Dot1p: linking transcriptional elongation to histone methylation. Mol. Cell 11,721 -729.[CrossRef][Medline]
Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P.
and Reinberg, D. (2002). Histone methyltransferase activity
associated with a human multiprotein complex containing the Enhancer of Zeste
protein. Genes Dev. 16,2893
-2905.
Lachner, M., O'Carroll, D., Rea, S., Mechtler, K. and Jenuwein, T. (2001). Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410,116 -120.[CrossRef][Medline]
Lallemand, Y., Luria, V., Haffner-Krausz, R. and Lonai, P. (1998). Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res. 7,105 -112.[CrossRef][Medline]
Lee, J. H. and Skalnik, D. G. (2005).
CpG-binding protein (CXXC finger protein 1) is a component of the mammalian
Set1 histone H3-Lys4 methyltransferase complex, the analogue of the yeast
Set1/COMPASS complex. J. Biol. Chem.
280,41725
-41731.
Levine, S. S., King, I. F. and Kingston, R. E. (2004). Division of labor in polycomb group repression. Trends Biochem. Sci. 29,478 -485.[CrossRef][Medline]
Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D. and
Felsenfeld, G. (2001). Correlation between histone lysine
methylation and developmental changes at the chicken beta-globin locus.
Science 293,2453
-2455.
Milne, T. A., Briggs, S. D., Brock, H. W., Martin, M. E., Gibbs, D., Allis, C. D. and Hess, J. L. (2002). MLL targets SET domain methyltransferase activity to Hox gene promoters. Mol. Cell 10,1107 -1117.[CrossRef][Medline]
Milne, T. A., Hughes, C. M., Lloyd, R., Yang, Z.,
Rozenblatt-Rosen, O., Dou, Y., Schnepp, R. W., Krankel, C., Livolsi, V. A.,
Gibbs, D. et al. (2005). Menin and MLL cooperatively regulate
expression of cyclin-dependent kinase inhibitors. Proc. Natl. Acad.
Sci. USA 102,749
-754.
Muller, J., Hart, C. M., Francis, N. J., Vargas, M. L., Sengupta, A., Wild, B., Miller, E. L., O'Connor, M. B., Kingston, R. E. and Simon, J. A. (2002). Histone methyltransferase activity of a Drosophila Polycomb group repressor complex. Cell 111,197 -208.[CrossRef][Medline]
Nagy, A. and Rossant, J. (2001). Chimaeras and mosaics for dissecting complex mutant phenotypes. Int. J. Dev. Biol. 45,577 -582.[Medline]
Nagy, P. L., Griesenbeck, J., Kornberg, R. D. and Cleary, M.
L. (2002). A trithorax-group complex purified from
Saccharomyces cerevisiae is required for methylation of histone H3.
Proc. Natl. Acad. Sci. USA
99, 90-94.
Nakamura, T., Mori, T., Tada, S., Krajewski, W., Rozovskaia, T., Wassell, R., Dubois, G., Mazo, A., Croce, C. M. and Canaani, E. (2002). ALL-1 is a histone methyltransferase that assembles a supercomplex of proteins involved in transcriptional regulation. Mol. Cell 10,1119 -1128.[CrossRef][Medline]
Ng, H. H., Robert, F., Young, R. A. and Struhl, K. (2003). Targeted recruitment of Set1 histone methylase by elongating Pol II provides a localized mark and memory of recent transcriptional activity. Mol. Cell 11,709 -719.[CrossRef][Medline]
Noma, K. and Grewal, S. I. (2002). Histone H3
lysine 4 methylation is mediated by Set1 and promotes maintenance of active
chromatin states in fission yeast. Proc. Natl. Acad. Sci.
USA Suppl. 4 99,16438
-16445.
Noma, K., Allis, C. D. and Grewal, S. I.
(2001). Transitions in distinct histone H3 methylation patterns
at the heterochromatin domain boundaries. Science
293,1150
-1155.
Petruk, S., Sedkov, Y., Smith, S., Tillib, S., Kraevski, V.,
Nakamura, T., Canaani, E., Croce, C. M. and Mazo, A. (2001).
Trithorax and dCBP acting in a complex to maintain expression of a homeotic
gene. Science 294,1331
-1334.
Rea, S., Eisenhaber, F., O'Carroll, D., Strahl, B. D., Sun, Z. W., Schmid, M., Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D. et al. (2000). Regulation of chromatin structure by site-specific histone H3 methyltransferases. Nature 406,593 -599.[CrossRef][Medline]
Ringrose, L. and Paro, R. (2004). Epigenetic regulation of cellular memory by the Polycomb and Trithorax group proteins. Annu. Rev. Genet. 38,413 -443.[CrossRef][Medline]
Rodriguez, C. I., Buchholz, F., Galloway, J., Sequerra, R., Kasper, J., Ayala, R., Stewart, A. F. and Dymecki, S. M. (2000). High-efficiency deleter mice show that FLPe is an alternative to Cre-loxP. Nat. Genet. 25,139 -140.[CrossRef][Medline]
Roguev, A., Schaft, D., Shevchenko, A., Pijnappel, W. W., Wilm, M., Aasland, R. and Stewart, A. F. (2001). The Saccharomyces cerevisiae Set1 complex includes an Ash2 homologue and methylates histone 3 lysine 4. EMBO J. 20,7137 -7148.[CrossRef][Medline]
Roguev, A., Schaft, D., Shevchenko, A., Aasland, R. and Stewart,
A. F. (2003). High conservation of the Set1/Rad6 axis of
histone 3 lysine 4 methylation in budding and fission yeasts. J.
Biol. Chem. 278,8487
-8493.
Sanders, S. L., Portoso, M., Mata, J., Bahler, J., Allshire, R. C. and Kouzarides, T. (2004). Methylation of histone H4 lysine 20 controls recruitment of Crb2 to sites of DNA damage. Cell 119,603 -614.[CrossRef][Medline]
Santos-Rosa, H., Schneider, R., Bannister, A. J., Sherriff, J., Bernstein, B. E., Emre, N. C., Schreiber, S. L., Mellor, J. and Kouzarides, T. (2002). Active genes are tri-methylated at K4 of histone H3. Nature 419,407 -411.[CrossRef][Medline]
Sedkov, Y., Tillib, S., Mizrokhi, L. and Mazo, A. (1994). The bithorax complex is regulated by trithorax earlier during Drosophila embryogenesis than is the Antennapedia complex, correlating with a bithorax-like expression pattern of distinct early trithorax transcripts. Development 120,1907 -1917.[Abstract]
Sedkov, Y., Cho, E., Petruk, S., Cherbas, L., Smith, S. T., Jones, R. S., Cherbas, P., Canaani, E., Jaynes, J. B. and Mazo, A. (2003). Methylation at lysine 4 of histone H3 in ecdysone-dependent development of Drosophila. Nature 426, 78-83.[CrossRef][Medline]
Smith, S. T., Petruk, S., Sedkov, Y., Cho, E., Tillib, S., Canaani, E. and Mazo, A. (2004). Modulation of heat shock gene expression by the TAC1 chromatin-modifying complex. Nat. Cell Biol. 6,162 -167.[CrossRef][Medline]
Testa, G., Schaft, J., van der Hoeven, F., Glaser, S., Anastassiadis, K., Zhang, Y., Hermann, T., Stremmel, W. and Stewart, A. F. (2004). A reliable lacZ expression reporter cassette for multipurpose, knockout-first alleles. Genesis 38,151 -158.[CrossRef][Medline]
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and
Higgins, D. G. (1997). The CLUSTAL_X windows interface:
flexible strategies for multiple sequence alignment aided by quality analysis
tools. Nucl. Acids Res.
25,4876
-4882.
Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods Enzymol. 225,361 -373.[Medline]
Wolffe, A. P. and Matzke, M. A. (1999).
Epigenetics: regulation through repression. Science
286,481
-486.
Wysocka, J., Myers, M. P., Laherty, C. D., Eisenman, R. N. and
Herr, W. (2003). Human Sin3 deacetylase and trithorax-related
Set1/Ash2 histone H3-K4 methyltransferase are tethered together selectively by
the cell-proliferation factor HCF-1. Genes Dev.
17,896
-911.
Wysocka, J., Swigut, T., Milne, T. A., Dou, Y., Zhang, X., Burlingame, A. L., Roeder, R. G., Brivanlou, A. H. and Allis, C. D. (2005). WDR5 associates with histone H3 methylated at K4 and is essential for H3 K4 methylation and vertebrate development. Cell 121,859 -872.[CrossRef][Medline]
Yagi, H., Deguchi, K., Aono, A., Tani, Y., Kishimoto, T. and
Komori, T. (1998). Growth disturbance in fetal liver
hematopoiesis of Mll-mutant mice. Blood
92,108
-117.
Yokoyama, A., Wang, Z., Wysocka, J., Sanyal, M., Aufiero, D. J.,
Kitabayashi, I., Herr, W. and Cleary, M. L. (2004). Leukemia
proto-oncoprotein MLL forms a SET1-like histone methyltransferase complex with
menin to regulate Hox gene expression. Mol. Cell.
Biol. 24,5639
-5649.
Yu, B. D., Hess, J. L., Horning, S. E., Brown, G. A. and Korsmeyer, S. J. (1995). Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378,505 -508.[CrossRef][Medline]
Yu, B. D., Hanson, R. D., Hess, J. L., Horning, S. E. and
Korsmeyer, S. J. (1998). MLL, a mammalian trithorax-group
gene, functions as a transcriptional maintenance factor in morphogenesis.
Proc. Natl. Acad. Sci. USA
95,10632
-10636.
This article has been cited by other articles:
![]() |
C. M. Tate, J.-H. Lee, and D. G. Skalnik CXXC Finger Protein 1 Contains Redundant Functional Domains That Support Embryonic Stem Cell Cytosine Methylation, Histone Methylation, and Differentiation Mol. Cell. Biol., July 15, 2009; 29(14): 3817 - 3831. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, T. D. Westergard, and J. J.-D. Hsieh MLL5 governs hematopoiesis: a step closer Blood, February 12, 2009; 113(7): 1395 - 1396. [Full Text] [PDF] |
||||
![]() |
Y. Zhang, J. Wong, M. Klinger, M. T. Tran, K. M. Shannon, and N. Killeen Mll5 contributes to hematopoietic stem cell fitness and homeostasis Blood, February 12, 2009; 113(7): 1455 - 1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Heuser, D. B. Yap, M. Leung, T. R. de Algara, A. Tafech, S. McKinney, J. Dixon, R. Thresher, B. Colledge, M. Carlton, et al. Loss of Mll5 results in pleiotropic hematopoietic defects, reduced neutrophil immune function, and extreme sensitivity to DNA demethylation Blood, February 12, 2009; 113(7): 1432 - 1443. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Madan, B. Madan, U. Brykczynska, F. Zilbermann, K. Hogeveen, K. Dohner, H. Dohner, O. Weber, C. Blum, H.-R. Rodewald, et al. Impaired function of primitive hematopoietic cells in mice lacking the Mixed-Lineage-Leukemia homolog Mll5 Blood, February 12, 2009; 113(7): 1444 - 1454. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Wu, P. F. Wang, J. S. Lee, S. Martin-Brown, L. Florens, M. Washburn, and A. Shilatifard Molecular Regulation of H3K4 Trimethylation by Wdr82, a Component of Human Set1/COMPASS Mol. Cell. Biol., December 15, 2008; 28(24): 7337 - 7344. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Patel, V. E. Vought, V. Dharmarajan, and M. S. Cosgrove A Conserved Arginine-containing Motif Crucial for the Assembly and Enzymatic Activity of the Mixed Lineage Leukemia Protein-1 Core Complex J. Biol. Chem., November 21, 2008; 283(47): 32162 - 32175. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Schotta, R. Sengupta, S. Kubicek, S. Malin, M. Kauer, E. Callen, A. Celeste, M. Pagani, S. Opravil, I. A. De La Rosa-Velazquez, et al. A chromatin-wide transition to H4K20 monomethylation impairs genome integrity and programmed DNA rearrangements in the mouse Genes & Dev., August 1, 2008; 22(15): 2048 - 2061. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Lee and D. G. Skalnik Wdr82 Is a C-Terminal Domain-Binding Protein That Recruits the Setd1A Histone H3-Lys4 Methyltransferase Complex to Transcription Start Sites of Transcribed Human Genes Mol. Cell. Biol., January 15, 2008; 28(2): 609 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Gregory, C. R. Vakoc, T. Rozovskaia, X. Zheng, S. Patel, T. Nakamura, E. Canaani, and G. A. Blobel Mammalian ASH1L Is a Histone Methyltransferase That Occupies the Transcribed Region of Active Genes Mol. Cell. Biol., December 15, 2007; 27(24): 8466 - 8479. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Niwa Open conformation chromatin and pluripotency Genes & Dev., November 1, 2007; 21(21): 2671 - 2676. [Full Text] [PDF] |
||||
![]() |
Y.-W. Cho, T. Hong, S. Hong, H. Guo, H. Yu, D. Kim, T. Guszczynski, G. R. Dressler, T. D. Copeland, M. Kalkum, et al. PTIP Associates with MLL3- and MLL4-containing Histone H3 Lysine 4 Methyltransferase Complex J. Biol. Chem., July 13, 2007; 282(28): 20395 - 20406. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lubitz, S. Glaser, J. Schaft, A. F. Stewart, and K. Anastassiadis Increased Apoptosis and Skewed Differentiation in Mouse Embryonic Stem Cells Lacking the Histone Methyltransferase Mll2 Mol. Biol. Cell, June 1, 2007; 18(6): 2356 - 2366. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Lee, C. M. Tate, J.-S. You, and D. G. Skalnik Identification and Characterization of the Human Set1B Histone H3-Lys4 Methyltransferase Complex J. Biol. Chem., May 4, 2007; 282(18): 13419 - 13428. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lee, D.-K. Lee, Y. Dou, J. Lee, B. Lee, E. Kwak, Y.-Y. Kong, S.-K. Lee, R. G. Roeder, and J. W. Lee Coactivator as a target gene specificity determinant for histone H3 lysine 4 methyltransferases PNAS, October 17, 2006; 103(42): 15392 - 15397. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||