|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online March 23, 2006
doi: 10.1242/10.1242/dev.02309
1 Department of Molecular Genetics, Albert Einstein College of Medicine, 1300
Morris Park Avenue, Bronx, NY 10461, USA.
2 Ophthalmology and Visual Sciences, Cell and Developmental Biology, 350 Kellogg
Eye Center University of Michigan Medical School, 1000 Wall Street, Ann Arbor,
MI 48105, USA.
3 Departments of Medicine and Cell and Developmental Biology, University of
Pennsylvania, 954 Biomedical Research Building (BRB) II/III, 421 Curie
Boulevard, Philadelphia, PA 19104, USA.
4 CNR-Institute of Neurosciences, Department of Biomedical Sciences, University
of Padova, Padova, Italy.
* Authors for correspondence (e-mail: campione{at}bio.unipd.it and morrow{at}aecom.yu.edu)
Accepted 2 February 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Tbx1, Pitx2, Heart, Secondary heart field, Cardiac defects
| INTRODUCTION |
|---|
|
|
|---|
Expression analysis of Tbx1 at stages E8.0-E11.5 in mouse
embryogenesis, showed strong expression in the pharyngeal apparatus. It is
expressed in the core mesenchyme of the pharyngeal arches, in the pharyngeal
endoderm and in the splanchnic and pharyngeal mesoderm
(Chapman et al., 1996
) in areas
of the secondary heart field (SHF) (Xu et
al., 2004
). The SHF is a recently discovered cell population of
cardiac progenitor cells in the pharyngeal/splanchnic mesoderm, which have
been shown to be necessary for the proper development of the heart
(Kelly, 2005
).
The heart develops from a bilaterally symmetric cardiac crescent, the
primary heart field located in the lateral mesoderm. Cells of the cardiac
crescent form a linear heart tube at E8.0, with the inflow tract located
caudally and the outflow tract cranially. Recent studies in the mouse and
chick have shown that, additionally, cells from the pharyngeal mesoderm
contribute to the distal outflow tract for the further growth of the heart
(Mjaatvedt et al., 2001
;
Waldo et al., 2001
;
Kelly et al., 2001
), thus
defining a new secondary cardiogenic region. Further studies have revealed
that cells of the SHF not only contribute to the arterial pole, but also to
the venous pole of the heart (Cai et al.,
2003
, Meilhac et al.,
2004
, Kelly,
2005
). Perturbation of these cardiac precursor cells resulted in
severe cardiac defects (Hu et al.,
2004
; Xu et al.,
2004
; Kelly, 2005
;
Ward et al., 2005
), thereby
proving their importance for proper heart development.
Recently, it has been implicated that Tbx1 plays a major role in
the SHF. Tbx1-null mutants display outflow tract hypoplasia,
suggesting that Tbx1 might regulate cell proliferation necessary for
growth of the developing outflow tract. It has been hypothesized that this
regulation also involves the fibroblast growth factors Fgf10 and
Fgf8 (Vitelli et al.,
2002
; Hu et al.,
2004
; Xu et al.,
2004
). All three genes are co-expressed in the pharyngeal mesoderm
and endoderm. Moreover, in the Tbx1 null mutant, Fgf8 and
Fgf10 are downregulated in the pharyngeal endoderm and the pharyngeal
mesoderm, respectively (Vitelli et al.,
2002
; Xu et al.,
2004
) (S.N. and V. Aggarwal, unpublished).
To further investigate the role of Tbx1 during heart development,
we performed in situ hybridization to identify potential downstream genes. One
gene of particular interest to us was Pitx2, a bicoid-like
homeobox gene. It is expressed, like Tbx1, in the pharyngeal mesoderm
and Pitx2-null mutants have heart defects reminiscent of individuals
with 22q11DS. Hemizygous loss-of-function mutations in human PITX2
are responsible for the etiology of Rieger syndrome (RGS1; MIM 180500), which
is associated with craniofacial, ocular defects, umbilical abnormalities
(Semina et al., 1996
) and,
occasionally, cardiac defects (Mammi et
al., 1998
).
Inactivation of Pitx2 in the mouse results in mid-gestational
death because of multiple defects, including failure in body wall closure, eye
defects, craniofacial abnormalities, right lung isomerism and severe cardiac
defects (Gage et al., 1999
;
Lin et al., 1999
;
Lu et al., 1999
;
Kitamura et al., 1999
).
Moreover, studies in the mouse, chick, frog and zebrafish revealed that
Pitx2 mediates signaling for left-right body asymmetry. It is the
only gene known so far that is left-asymmetrically expressed during organ
morphogenesis of the heart, gut and lung
(Meno et al., 1998
;
Piedra et al., 1998
;
Ryan et al., 1998
;
Yoshioka et al., 1998
;
Campione et al., 1999
;
Lu et al., 1999
). In the
mouse, there are three different Pitx2 isoforms: Pitx2a,
Pitx2b and Pitx2c (Kitamura
et al., 1999
). Only Pitx2c is left-asymmetrically
expressed and has been shown to be indispensable for proper asymmetric cardiac
morphogenesis (Kitamura et al.,
1999
; Schweickert et al.,
2000
). Null mutants of Pitx2c died perinatally with
severe heart defects including VSD, ASD and aortic arch patterning defects
(Liu et al., 2002
). In this
study, we present a detailed analysis on Tbx1 and Pitx2
co-expression in wild-type embryos. We found that Pitx2 and
Tbx1 are co-expressed in the left SHF cells of the pharyngeal
mesoderm from E8.0 onwards, as well as in some areas of the venous and
arterial pole of the heart. Surprisingly, we also found that Tbx1 is
asymmetrically expressed. This expression is transient, at E9.0, and is in the
left caudal domain of Tbx1 expression in the pharyngeal mesoderm
within the Pitx2-positive region. Asymmetric Tbx1 expression
was not downregulated in the Pitx2-null mice. By contrast, we
detected downregulation of Pitx2 expression in the cardiac region of
Tbx1-null mutant, pointing to a possible genetic interaction of these
two genes. Indeed, mice double heterozygous for Tbx1 and
Pitx2 died perinatally of severe cardiovascular defects occurring
with varying penetrance, thus proving our hypothesis.
Sequence analysis of the Pitx2 enhancer (Pitx2-ASE) for left-sided expression revealed a putative T-half site close to an Nkx2.5-binding site. Subsequent molecular studies revealed synergistic activation of a Pitx2 reporter construct by Tbx1 and Nkx2.5. In conclusion, in this study we present for the first time in vitro and in vivo evidence for a novel Tbx1-Pitx2 pathway in the left SHF.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Histology
Mouse embryos were treated for histological analysis as described
previously (Liao et al.,
2004
). E18.5 and newborns were fixed in 10% neutral buffered
formalin solution for 3 days.
Whole-mount in situ hybridization and in situ hybridization on sections
Complementary RNA probes to mouse full-length Tbx1, full-length
Pitx2 (Campione et al.,
1999
), Nkx2.5 (Lyons
et al., 1995
), Tbx3
(Hoogaars et al., 2004
),
Tbx2 (Habets et al.,
2002
), Isl1 (Cai et
al., 2003
), Nppa
(Zeller et al., 1987
) and
myosin heavy chain (Mhc) ATP-binding site, which recognizes all
Mhc isoforms (Franco et al.,
2002
) were generated using standard protocols. Embryos and E10.5
hearts were isolated in PBS, fixed in 4% PFA and gradually dehydrated into 75%
methanol/PBS, 0.1% Tween-20. Hybridization protocols for whole-mount in situ
hybridization followed standard procedures with slight modifications. In situ
hybridization on sections was performed on serial 12 µm paraffin wax
embedded sections from E8-E10.5 wild-type embryos. Hybridization was performed
as previously described (Franco et al.,
2001
).
Quantitative RT-PCR
Whole hearts from E10.5 embryos were dissected and stored in
RNAlater RNA stabilization reagent (QIAGEN) at 4°C. Total RNA was
extracted using RNeasy Protect Mini Kit (QIAGEN) and cDNA was synthesized
using SuperScript First-Strand Synthesis System (Invitrogen). The PCR
reactions were performed with a LightCycler (Roche) and FastStart DNA Master
SYBR Green I (Roche). All values were normalized to the level of
Gapdh, which was used as an internal control in each sample. Primers
specific for Pitx2 were 5'-GTCTCTTCTCCAAAGACTCC-3' and
5'-CGGCGATTCTTGAACCAAAC-3'. Primers specific for Gapdh
were 5'-TTCACCACCATGGAGAAGGC-3' and
5'-GGCATGGACTGTGGTCATGA-3'. Six wild-type and 11
Tbx1-/- embryos were tested and statistical significance
was calculated by both unpaired Student's t-test and one-sided
Wilcoxon rank-sum test.
Electromobility shift assay
Sequences of oligonucleotides containing the T-half site of the
Pitx2-ASE (wild type), mutated (M1, M2) or the consensus (Cons)
T-half site are as follows: wild type, CAATCAGGTGTAAAGAGGAA; M1,
CAATCAGATTTGAAGAGGAA; M2, CAATCAAATTTGAAGAGGAA; Cons, CAATCAGGTGTGAAAAGGAA. A
total of 100 pmol of each 5'- and 3'-oligonucleotide were added to
5 µl annealing buffer (100 mM Tris pH 8, 500 mM NaCl, 10 mM EDTA pH 8) and
43 µl H2O. The reaction was boiled for 15 minutes and slowly
annealed by cooling down to room temperature. A total of 20 pmol of annealed
oligonucleotides were radiolabeled with [
-32P]dATP using
T4-Kinase (NEB) and purified using Sephadex G-50 spin columns (Amersham).
Full-length cDNA of Tbx1 was cloned into pcDNA3.1 (Invitrogen) and
transfected into 293T cells. Cell lysate was used for the DNA-binding assay
and incubated for 30 minutes on ice in a reaction containing 5% glycerol, 10
mM HEPES pH 7.5, 25 mM KCl, 1 mM DTT, 1 mM EDTA and 5 mM MgCl2
(DNA-Binding buffer), 1 µg dIdC and 0.1 pmol radiolabeled probe (wild-type,
M1, M2 or Cons) was added. When using unlabeled wild-type competitor
oligonucleotides in a 100-fold molar excess and Tbx1 antibody for the
supershift, samples were preincubated for 20 minutes on ice before adding
radiolabeled probe. DNA-protein complexes were resolved on a 6% non-denaturing
polyacrylamide gel in 0.5xTBE. Gels were exposed to Kodak film (Biomax
MS).
Transfection and luciferase assays
The 900 bp enhancer element of the Pitx2c isoform
(Pitx2-ASE) (Shiratori et al.,
2001
) was cloned into pGl3 SV40 luciferase vector (Promega).
Plasmid transfections were performed in six-well plates using Polyfect Reagent
(QIAGEN) according to the manufacturer's protocol. Cos7 cells were transfected
with 0.15 µg of the Pitx2-ASE luciferase construct and with 0.3
µg of the expression constructs Tbx1 in pcDNA3.1,
Flag-Nkx2.5 in pCI, respectively. The empty vectors pcDNA3.1 and pCI
were used as controls. A total of 0.03 µg of CMV-ßGal construct was
co-transfected to normalize transfection efficiency. Luciferase and
ß-galactosidase activity were assayed 48 hours after transfection using
Luciferase assay system (Promega) in a TD -20/20 luminometer and
ß-galactosidase reporter gene activity detection Kit (Sigma)
respectively. The mutagenized reporter (Pitx2-Mut) was generated
using the Quick change site-directed mutagenesis kit (Stratagene). The T-half
site in the Pitx2-ASE was mutated to 5'-AAATTTGAAG-3'.
Transfections with Pitx2-Mut were carried out as mentioned above.
Co-immunoprecipitation (Co-Ip)
293T cells were transfected with a Tbx1-GFP construct in pEGFP-N1
(Clontech) and a Flag-Nkx2.5 construct in pCI (Promega) using
Polyfect Reagent (QIAGEN) and lysed after 48 hours in RIPA-buffer (50 mM Tris
pH 7.5, 200 mM NaCl, 1% Triton X-100, 0.25% DOC, 1 mM EDTA). The Co-Ip was
performed with Anti-Flag M2 affinity gel (Sigma) according to the
manufacturer's protocol. Immunoblotting was performed using Anti-Flag M2
(Sigma) and Anti-Tbx1 antibodies (Zymed). Blots were exposed to Kodak film
(Biomax MS).
| RESULTS |
|---|
|
|
|---|
|
|
|
|
Activation of the Pitx2 enhancer by Tbx1 through interaction with Nkx2.5
Pitx2c is the isoform that is left-asymmetrically expressed. Its
expression is regulated by a 900 bp enhancer (Pitx2-ASE) that is
located between exons 4 and 5 (Shiratori
et al., 2001
). T-box-containing genes frequently require
co-factors for transcriptional regulation. There is an Nkx2.5-binding site in
the Pitx2-ASE, required to maintain asymmetric Pitx2c
expression (Shiratori et al.,
2001
). We detected a putative T-half site
(5'-AGGTGTAAAG-3') in the enhancer, 26 bp downstream of the
Nkx2.5-binding site. Thus, we hypothesized that Pitx2c might be a
direct downstream target of Tbx1, and we tested this hypothesis by performing
in vitro assays in cell culture. We co-transfected Cos7 cells with a
Pitx2-ASE luciferase reporter and either Tbx1 or
Nkx2.5 expression vectors. In both cases, this resulted in only weak
activation of the Pitx2c enhancer
(Fig. 5A). It has previously
been shown that Nkx2.5 acts in combination with other T-box proteins, such as
Tbx2 during development of the chamber myocardium. Tbx2 and Nkx2.5 form a
complex on the atrial natriuretic factor (Anf) promoter to repress
its activity (Habets et al.,
2002
). Therefore, we co-transfected both expression constructs
with the Pitx2-ASE reporter, which resulted in a strong activation
(12-fold) of the Pitx2-ASE (Fig.
5A). Indeed, transactivation did not occur when the T-half site in
the Pitx2-ASE plasmid (Pitx2-Mut) was mutated
(Fig. 5B). These results show
that Tbx1 and Nkx2.5 can synergistically activate the enhancer and that this
requires functional integrity of the Tbx1-binding site.
Specific binding of Tbx1 to the T-half site of the Pitx2-ASE was
assayed with electromobility shift experiments
(Fig. 5C). Whole-cell extracts
of 293T cells transfected with Tbx1 expression vector and
oligonucleotides containing either the T-half site of the Pitx2-ASE
(Wt-oligo), mutated T-half sites (M1, M2) or a consensus T-half site were used
in the DNA-binding assay. Lysates transfected with the Tbx1
expression vector resulted in the formation of a Tbx1-DNA complex in the
presence of wild-type oligo. To prove the specificity of the binding, 100-fold
excess of non-labeled wild-type oligo was added, resulting in loss of the
signal. Addition of a Tbx1 antibody, which recognizes a peptide in the
C-terminal third of the Tbx1 protein, outside the conserved T-box, resulted in
a supershift of the Tbx1-DNA complex, whereas addition of pre-immune serum did
not. Part of the DNA-protein complex has not been supershifted, possibly owing
to the binding of other T genes present in the cell extract to the same
sequence. For example, it has recently been reported that Tbx20 can also
activate the Pitx2c enhancer in vitro; it is likely that it binds to
the same T-half site (Takeuchi et al.,
2005
). A DNA-protein complex that could not be supershifted with
the Tbx1 antibody was also visible in control experiments in non-Tbx1
transfected 293T cells, suggesting that endogenous T-box proteins may be
present in these cells (data not shown). Lysates transfected with
Tbx1 expression vector resulted in a weak Tbx1-DNA complex in the
presence of an oligonucleotide containing the consensus T-half site. Addition
of 100-fold excess of the consensus oligonucleotide resulted in loss of the
signal (Fig. 5C). Mutated
oligos M1 and M2 did not lead to a T-box-DNA complex.
|
| DISCUSSION |
|---|
|
|
|---|
Tbx1 and Nkx2.5 regulate asymmetric Pitx2 expression
The establishment of the left right axis in the vertebrate embryo involves
four steps: the determination of the left-right polarity in or near the node,
signals that transfer the left-right identity from the node to the lateral
plate mesoderm (LPM), expression of signaling molecules Nodal and
Lefty1 in the left LPM, and activation of Pitx2, which
regulates asymmetric organ morphogenesis
(Hamada, 2001
). The expression
of the last is regulated via an enhancer in the Pitx2 gene that is
located in the intron between exons 4 and 5. This enhancer
(Pitx2-ASE), which is responsible for the left-sided expression,
contains three FAST-binding sites and an Nkx2.5-binding site, which are
necessary for asymmetric regulation of Pitx2. First, Pitx2
expression is initiated through Nodal signaling from the node through
FAST transcription factors. After Nodal expression has ceased,
Pitx2 expression is maintained by the transcription factor Nkx2.5
(Shiratori et al., 2001
).
|
It is tempting to speculate that Tbx1 is not the only protein required with
Nkx2.5 for maintenance of Pitx2 expression. It is likely that other
T-box proteins can bind to the T-half site in the Pitx2-ASE and
regulate Pitx2 expression in other regions of the heart. It has
recently been published that Tbx20 can also activate the Pitx2
enhancer in vitro. A knockdown of Tbx20 in mice has revealed its
important role for the development of the outflow tract and the right
ventricle (Takeuchi et al.,
2005
), both Pitx2-expressing structures. It is possible
that Tbx20 regulates Pitx2 expression in these structures.
|
The AHF/SHF appears to be a subpopulation of this second lineage
(Kelly, 2005
). In this study,
we show that Pitx2 and Tbx1 are co-expressed in
Isl1-positive regions in the SHF and that double heterozygous mice
for Pitx2 and Tbx1 show defects of the arterial as well as
the venous pole of the heart. These findings suggest that the
Tbx1-Pitx2 pathway must be a crucial part of the second lineage.
Tbx1 expression has already been previously shown in the AHF/SHF
in the pharyngeal mesoderm as wells as in the pharyngeal endoderm where it is
co-expressed with two fibroblast growth factor genes, Fgf8 and
Fgf10 (Vitelli et al.,
2002
; Xu et al.,
2004
; Hu et al.,
2004
) (reviewed by Kelly,
2005
). Both genes are down regulated in the Tbx1-null
mutant, suggesting that they are downstream of Tbx1 on both sides of
the SHF (Vitelli et al., 2002
;
Xu et al., 2004
) (S.N. and V.
Aggarwal, unpublished). In this study, we provide evidence for a novel and
complementary Tbx1-Pitx2 pathway in the left SHF
(Fig. 6). Tbx1 activates
Pitx2 directly, and by interaction with Nkx2.5 it is responsible for
maintenance of Pitx2 expression in the left SHF. Target genes of
Pitx2 in the secondary heart field have not yet been identified. However, in
vivo and in vitro studies support a role for Pitx2 in cell
proliferation and migration (Kioussi et
al., 2002
; Wei and Adelstein,
2002
), as well as in regulating growth factor activity
(Liu et al., 2003
).
Several studies have already investigated molecular and genetic
relationships between the Tbx and Pitx gene families. In the process of limb
patterning, Pitx1 acts by imparting a positional cue in response of which the
activation of Tbx4 occurs that directs hindlimb outgrowth
(Minguillon et al., 2005
). In
the pituitary gland, the T box factor, Tpit, cooperates with Pitx1/2 in the
activation of the POMC promoter (Lamolet
et al., 2001
). Whereas in our experiments we have not identified a
feedback action of Pitx2 on the Tbx1 expression, we cannot rule out an
additional possible cooperative interaction between the two genes. Indeed,
preliminary Tbx1 and Pitx2 Co-IP experiments (S.N., unpublished) suggest this
possibility. It still has to be determined, however, if the physical
interaction between Tbx1 and Pitx2 is relevant within the SHF because
candidate downstream target genes are not known.
Genetic modifiers of heart defects in 22q11DS
The 22q11DS is characterized by a multitude of cardiovascular defects
occurring in 60% of individuals with 22q11DS. The different malformations
occur with variable penetrance. This suggests that genetic modifiers in the
form of single nucleotide polymorphisms (SNPs) and/or stochastic factors alter
the severity of syndrome and modify the penetrance of heart defects.
Studies in Df1/+ mice possessing a 1 Mb deletion in the region of synteny
to the 22q11.2 critical region showed that different genetic backgrounds play
a major role in altering the penetrance of cardiovascular defects relevant to
the disorder (Taddei et al.,
2001
). This suggests that genetic variation, or SNPs, can
influence the severity of heart defects in 22q11DS. One such candidate has
been identified, the vascular endothelial growth factor (VEGF) gene
(Stalmans et al., 2003
).
Inactivation of one isoform of Vegf164 in the mouse
produces similar heart defects as in individuals with 22q11DS. SNP analysis in
these individuals revealed a SNP variant in the 5' untranslated region
of VEGF, which could be found more frequently in individuals with
cardiac defects compared with those with no detectable heart malformations
(Stalmans et al., 2003
). It is
possible that functional SNPs that change an amino acid or that are present in
conserved non-coding regulatory regions of PITX2, NKX2.5, FGF8 or
FGF10, might alter the expressivity of the syndrome. If this is the
case, they might be considered genetic modifiers of the disorder.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Burn, J. and Goodship, J. (1996). Congenital heart disease. In Emery and Rimoin's Principles and Practice of Medical Genetics, Vol.1 (3rd edn) (ed. D. L. Rimoin, J. M. Connor and R. E. Pyeritz), pp.767 -828. New York: Churchill Livingstone.
Cai, C. L., Liang, X., Shi, Y., Chu, P.-H., Pfaff, S. L., Chen, J. and Evans, S. (2003). Isl1 identifies a cardiac progenitor population that proliferates prior to differentiation and contributes a majority of cells to the heart. Dev. Cell 5, 877-889.[CrossRef][Medline]
Campione, M., Steinbeisser, H., Schweickert, A., Deissler, K., van Bebber, F., Lowe, L. A., Nowotschin, S., Viebahn, C., Haffter, P., Kuehn, M. R. et al. (1999). The homeobox gene Pitx2: mediator of asymmetric left-right signaling in vertebrate heart and gut looping. Development 126,1225 -1234.[Abstract]
Chapman, D. L., Garvey, N., Hancock, S., Alexiou, M., Agulnik, S. I., Gibson-Brown, J. J., Cebra-Thomas, J., Bollag, R. J., Silver, L. M. and Papaioannou, V. E. (1996). Expression of the T-box family genes, Tbx1-Tbx5, during early mouse development. Dev. Dyn. 206,379 -390.[CrossRef][Medline]
DiGeorge, A. (1965). A new concept of the cellular basis of immunity. J. Pediatr. 67, 907.[CrossRef]
Franco, D., de Boer, P. A., de Gier-de Vries, C., Lamers, W. H. and Moorman, A. F. (2001). Methods on in situ hybridization, immunohistochemistry and beta-galactosidase reporter gene detection. Eur. J. Morphol. 39,169 -191.[CrossRef][Medline]
Franco, D., Gallego, A., Habets, P. E., Sans-Coma, V. and Moorman, A. F. (2002). Species-specific differences of myosin content in the developing cardiac chambers of fish, birds and mammals. Anat. Rec. 268,27 -37.[CrossRef][Medline]
Gage, P. J., Suh, H. and Camper, S. A. (1999). Dosage requirement of Pitx2 for development of multiple organs. Development 126,4643 -4651.[Abstract]
Habets, P. E., Moorman, A. F., Clout, D. E., van Roon, M. A.,
Lingbeek, M., van Lohuizen, M., Campione, M. and Christoffels, V. M.
(2002). Cooperative action of Tbx2 and Nkx2.5 inhibits ANF
expression in the atrioventricular canal: implications for cardiac chamber
formation. Genes Dev.
16,1234
-1246.
Hamada, H. (2001). Left-right asymmetry. In Mouse Development (ed. J. Rossant and P. P. L. Tam), pp. 55-70. San Diego: Academic Press.
Hoogaars, W. M., Tessari, A., Moorman, A. F., de Boer, P. A., Hagoort, J., Soufan, A. T., Campione, M. and Christoffels, V. M. (2004). The transcriptional repressor Tbx3 delineates the developing central conduction system of the heart. Cardiovasc. Res. 624,89 -99.
Hu, T., Yamagishi, H., Maeda, J., McAnally, J., Yamagishi, C.
and Srivastava, D. (2004). Tbx1 regulates fibroblast growth
factors in the anterior heart field through a reinforcing autoregulatory loop
involving forkhead transcription factors. Development
131,5491
-5502.
Jerome, L. A. and Papaioannou, V. E. (2001). DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1.Nat. Genet. 27,286 -291.[CrossRef][Medline]
Kelly, R. G. (2005). Molecular inroads into the anterior heart field. Trends Cardiovasc. Med. 15, 51-56.[CrossRef][Medline]
Kelly, R. G., Brown, N. A. and Buckingham, M. E. (2001). The arterial pole of the mouse heart forms from Fgf10-expressing cells in pharyngeal mesoderm. Dev. Cell 1,435 -440.[CrossRef][Medline]
Kioussi, C., Briata, P., Baek, S. H., Rose, D. W., Hamblet, N.
S., Herman, T., Ohgi, K. A., Lin, C., Gleiberman, A., Wang, J. et al.
(2002). Identification of a Wnt/Dvl/ß-catenin
Pitx2
pathway mediating cell-type-specific proliferation during development.
Cell 111,673
-685.[CrossRef][Medline]
Kitamura, K., Miura, H., Miyagawa-Tomita, S., Yanazawa, M., Katoh-Fukui, Y., Suzuki, R., Ohuchi, H., Suehiro, A., Motegi, Y., Nakahara, Y. et al. (1999). Mouse Pitx2 deficiency leads to anomalies of the ventral body wall, heart, extra- and periocular mesoderm and right pulmonary isomerism. Development 126,5749 -5758.[Abstract]
Lamolet, B., Pulichino, A. M., Lamonerie, T., Gauthier, Y., Brue, T., Enjalbert, A. and Drouin, J. (2001). A pituitary cell-restricted T box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104,849 -859.[CrossRef][Medline]
Liao, J., Kochilas, L., Nowotschin, S., Arnold, J. S., Aggarwal,
V. S., Epstein, J. A., Brown, M. C., Adams, J. and Morrow, B. E.
(2004). Full spectrum of malformations in velo-cardio-facial
syndrome/DiGeorge syndrome mouse models by altering Tbx1 dosage.
Hum. Mol. Genet. 13,1577
-1585.
Lin, C. R., Kioussi, C., O'Connell, S., Briata, P., Szeto, D., Liu, F., Izpisua-Belmonte, J. C. and Rosenfeld, M. G. (1999). Pitx2 regulates lung asymmetry, cardiac positioning and pituitary and tooth morphogenesis. Nature 401,279 -282.[CrossRef][Medline]
Lindsay, E. A., Vitelli, F., Su, H., Morishima, M., Huynh, T., Pramparo, T., Jurecic, V., Ogunrinu, G., Sutherland, H. F., Scambler, P. J. et al. (2001). Tbx1 haploinsufficiency in the DiGeorge syndrome region causes aortic arch defects in mice. Nature 410,97 -101.[CrossRef][Medline]
Liu, C., Liu, W., Palie, J., Lu, M. F., Brown, N. A. and Martin,
J. F. (2002). Pitx2c patterns anterior myocardium and aortic
arch vessels and is required for local cell movement into atrioventricular
cushions. Development
129,5081
-5091.
Liu, W., Selever, J., Lu, M. F. and Martin, J. F.
(2003). Genetic dissection of Pitx2 in craniofacial development
uncovers new functions in branchial arch morphogenesis, late aspects of tooth
morphogenesis and cell migration. Development
130,6375
-6385.
Lu, M. F., Pressman, C., Dyer, R., Johnson, R. L. and Martin, J. F. (1999). Function of Rieger syndrome gene in left-right asymmetry and craniofacial development. Nature 401,276 -278.[CrossRef][Medline]
Lyons, I., Parson, L. M., Harvey, L., Li, R., Andrews, J. E.,
Robb, L. and Harvey, R. P. (1995). Myogenic and morphogenesis
defects in heart tubes of murine embryos lacking the homeobox gene Nkx2.5.
Genes Dev. 9,1654
-1666.
Mammi, I., De Giorgio, P., Clementi, M. and Tenconi, R. (1998). Cardiovascular anomaly in Rieger Syndrome: heterogeneity or contiguity? Acta Ophthalmol. Scand. 76,509 -512.[CrossRef][Medline]
Meilhac, S. M., Esner, M., Kelly, R. G., Nicolas, J. F. and Buckingham, M. E. (2004). The clonal origin of myocardial cells in different regions of the embryonic mouse heart. Dev. Cell 6,685 -698.[CrossRef][Medline]
Meno, C., Shimono, A., Saijoh, Y., Yashiro, K., Mochida, K., Ohishi, S., Noji, S., Kondoh, H. and Hamada, H. (1998). lefty-1 is required for left-right determination as a regulator of lefty-2 and nodal. Cell 94,287 -297.[CrossRef][Medline]
Merscher, S., Funke, B., Epstein, J. A., Heyer, J., Puech, A., Lu, M. M., Xavier, R. J., Demay, M. B., Russell, R. G., Factor, S. et al. (2001). TBX1 is responsible for cardiovascular defects in velo-cardio-facial/DiGeorge syndrome. Cell 104,619 -629.[CrossRef][Medline]
Minguillon, C., Del Buono, J. and Logan, M. P. (2005). Tbx5 and Tbx4 are not sufficient to determine limb-specific morphologies but have common roles in initiating limb outgrowth. Dev. Cell 8,75 -84.[CrossRef][Medline]
Mjaatvedt, C. H., Nakaoka, T., Moreno-Rodriguez, R., Norris, R. A., Kern, M. J., Eisenberg, C. A., Turner, D. and Markwald, R. R. (2001). The outflow tract of the heart is recruited from a novel heart-forming field. Dev. Biol. 238,97 -109.[CrossRef][Medline]
Piedra, M. E., Icardo, J. M., Albajar, M., Rodriguez-Rey, J. C. and Ros, M. A. (1998). Pitx2 participates in the late phase of the pathway controlling left-right asymmetry. Cell 94,319 -324.[CrossRef][Medline]
Ryan, A. K., Blumberg, B., Rodriguez-Esteban, C., Yonei-Tamura, S., Tamura, K., Tsukui, T., de la Pena, J., Sabbagh, W., Greenwald, J., Choe, S. et al. (1998). Pitx2 determines left-right asymmetry of internal organs in vertebrates. Nature 394,545 -551.[CrossRef][Medline]
Schweickert, A., Campione, M., Steinbeisser, H. and Blum, M. (2000). Pitx2 isoforms: involvement of Pitx2c but not Pitx2a or Pitx2b in vertebrate left-right asymmetry. Mech. Dev. 90, 41-51.[CrossRef][Medline]
Semina, E. V., Reiter, R., Leysens, N. J., Alward, W. L., Small, K. W., Datson, N. A., Siegel-Bartelt, J., Bierke-Nelson, D., Bitoun, P., Zabel, B. U. et al. (1996). Cloning and characterization of a novel bicoid-related homeobox transcription factor gene, RIEG, involved in Rieger syndrome. Nat. Genet. 14,392 -399.[CrossRef][Medline]
Shiratori, H., Sakuma, R., Watanabe, M., Hashiguchi, H., Mochida, K., Sakai, Y., Nishino, J., Saijoh, Y., Whitman, M. and Hamada, H. (2001). Two-step regulation of left-right asymmetric expression of Pitx2: initiation by nodal signaling and maintenance by Nkx2.5. Mol. Cell 7,137 -149.[CrossRef][Medline]
Shprintzen, R. J., Goldberg, R. B., Lewin, M. L., Sidoti, E. J., Berkman, M. D., Argamaso, R. V. and Young, D. (1978). A new syndrome involving cleft palate, cardiac anomalies, typical facies, and learning disabilities: velo-cardio-facial syndrome. Cleft Palate J. 15,56 -62.[Medline]
Stalmans, I., Lambrechts, D., De Smet, F., Jansen, S., Wang, J., Maity, S., Kneer, P., von der Ohe, M., Swillen, A., Maes, C. et al. (2003). VEGF: a modifier of the del22q11 (DiGeorge) syndrome? Nat. Med. 9,173 -82.[CrossRef][Medline]
Taddei, I., Morishima, M., Huynh, T. and Lindsay, E. A.
(2001). Genetic factors are major determinants of phenotypic
variability in a mouse model of the DiGeorge/del22q11 syndromes.
Proc. Natl. Acad. Sci. USA
98,11428
-11431.
Takeuchi, J. K., Mileikovskaia, M., Koshiba-Takeuchi, K., Heidt,
A. B., Mori, A. D., Arruda, E. P., Gertsenstein, M., Georges, R., Davidson,
L., Mo, R. et al. (2005). Tbx20 dose-dependently regulates
transcription factor networks required for mouse heart and motoneuron
development. Development
132,2463
-2474.
Vitelli, F., Taddei, I., Morishima, M., Meyers, E. N. and
Baldini, A. (2002). A genetic link between Tbx1 and
fibroblast growth factor signaling. Development
129,4605
-4611.
Waldo, K. L., Kumiski, D. H., Wallis, K. T., Stadt, H. A., Hutson, M. R., Platt, D. H. and Kirby, M. L. (2001). Conotruncal myocardium arises from a secondary heart field. Development 128,3179 -3188.
Ward, C., Stadt, H., Hutson, M. and Kirby, M. L. (2005). Ablation of the secondary heart field leads to tetralogy of Fallot and pulmonary atresia. Dev. Biol. 284, 72-83.[CrossRef][Medline]
Wei, Q. and Adelstein, R. S. (2002). Pitx2a
expression alters actin-myosin cytoskeleton and migration of HeLa cells
through Rho GTPase signaling. Mol. Biol. Cell
13,683
-697.
Xu, H., Morishima, M., Wylie, J. N., Schwartz, R. J., Bruneau,
B. G., Lindsay, E. A. and Baldini, A. (2004). Tbx1
has a dual role in the morphogenesis of the cardiac outflow tract.
Development 131,3217
-3227.
Yamagishi, H. (2002). The 22q11.2 deletion syndrome. Keio J. Med. 51, 77-88.[Medline]
Yoshioka, H., Meno, C., Koshiba, K., Sugihara, M., Itoh, H., Ishimaru, Y., Inoue, T., Ohuchi, H., Semina, E. V., Murray, J. C. et al. (1998). Pitx2, a bicoid-type homeobox gene, is involved in a lefty-signaling pathway in determination of left-right asymmetry. Cell 94,299 -305.[CrossRef][Medline]
Zeller, R., Bloch, K. D., Williams, B. S., Arceci, R. J. and
Seidman, C. E. (1987). Localised expression of the atrial
natriuretic factor gene during cardiac embryogenesis. Genes
Dev. 1,693
-698.
This article has been cited by other articles:
![]() |
K. N. Ivey, D. Sutcliffe, J. Richardson, R. I. Clyman, J. A. Garcia, and D. Srivastava Transcriptional Regulation During Development of the Ductus Arteriosus Circ. Res., August 15, 2008; 103(4): 388 - 395. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Obler, A L Juraszek, L B Smoot, and M R Natowicz Double outlet right ventricle: aetiologies and associations J. Med. Genet., August 1, 2008; 45(8): 481 - 497. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Poelmann, M. R.M. Jongbloed, and A. C. Gittenberger-de Groot Pitx2: A Challenging Teenager Circ. Res., April 11, 2008; 102(7): 749 - 751. [Full Text] [PDF] |
||||
![]() |
A. Tessari, M. Pietrobon, A. Notte, G. Cifelli, P. J. Gage, M. D. Schneider, G. Lembo, and M. Campione Myocardial Pitx2 Differentially Regulates the Left Atrial Identity and Ventricular Asymmetric Remodeling Programs Circ. Res., April 11, 2008; 102(7): 813 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Galli, J. N. Dominguez, S. Zaffran, A. Munk, N. A. Brown, and M. E. Buckingham Atrial myocardium derives from the posterior region of the second heart field, which acquires left-right identity as Pitx2c is expressed Development, March 15, 2008; 135(6): 1157 - 1167. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang and A. Baldini In vivo response to high-resolution variation of Tbx1 mRNA dosage Hum. Mol. Genet., January 1, 2008; 17(1): 150 - 157. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Farin, M. Bussen, M. K. Schmidt, M. K. Singh, K. Schuster-Gossler, and A. Kispert Transcriptional Repression by the T-box Proteins Tbx18 and Tbx15 Depends on Groucho Corepressors J. Biol. Chem., August 31, 2007; 282(35): 25748 - 25759. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. P. Shih, M. K. Gross, and C. Kioussi Cranial muscle defects of Pitx2 mutants result from specification defects in the first branchial arch PNAS, April 3, 2007; 104(14): 5907 - 5912. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dong, X. Sun, W. Liu, D. Ai, E. Klysik, M.-F. Lu, J. Hadley, L. Antoni, L. Chen, A. Baldini, et al. Pitx2 promotes development of splanchnic mesoderm-derived branchiomeric muscle Development, December 15, 2006; 133(24): 4891 - 4899. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Aggarwal, J. Liao, A. Bondarev, T. Schimmang, M. Lewandoski, J. Locker, A. Shanske, M. Campione, and B. E. Morrow Dissection of Tbx1 and Fgf interactions in mouse models of 22q11DS suggests functional redundancy Hum. Mol. Genet., November 1, 2006; 15(21): 3219 - 3228. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhang, T. Huynh, and A. Baldini Mesodermal expression of Tbx1 is necessary and sufficient for pharyngeal arch and cardiac outflow tract development Development, September 15, 2006; 133(18): 3587 - 3595. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||