|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 22 March 2006
doi: 10.1242/dev.02342
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Division of Genetics, Genomics and Development, Center for Integrative
Genomics, Department of Molecular and Cell Biology, University of California,
Berkeley, CA 94720, USA.
2 Department of Genetics, Stanford Medical School, Stanford, CA 94305,
USA.
* Author for correspondence (e-mail: harland{at}socrates.berkeley.edu)
Accepted 27 February 2006
| SUMMARY |
|---|
|
|
|---|
Key words: FGF, FGF8, FGF8a, FGF8b, FGF8f, Mesoderm, Neural, Patterning, Spliceforms, FGF8 isoforms, Alternative spliceforms, Xenopus, Hindbrain, Spinal cord
| INTRODUCTION |
|---|
|
|
|---|
In Xenopus laevis, FGF was the first identified mesoderm inducer
(Kimelman and Kirschner, 1987
;
Slack et al., 1987
;
Slack et al., 1990
), and
disruption of FGF signaling results in the loss of most trunk and tail
mesoderm (Amaya et al., 1991
;
Amaya et al., 1993
). Although
the initial view held that FGF was a mesoderm inducer, subsequent experiments
have suggested it was more important in the maintenance of mesoderm through a
feedback loop involving brachyury
(Isaacs et al., 1994
;
Schulte-Merker and Smith,
1995
; Kroll and Amaya,
1996
).
FGF8 is expressed in the presumptive mesoderm by gastrulation, but
only had minimal effects on mesoderm formation
(Christen and Slack, 1997
;
Hardcastle et al., 2000
).
However, only the FGF8a spliceform was tested. In addition to its
role in mesoderm formation, FGF signaling has an established role in neural
patterning. Several FGFs, including FGF8, are expressed in the early
posterior dorsal mesoderm, where they are in proximity to the presumptive
neuroectoderm (Christen and Slack,
1997
).
Several studies have disrupted FGF signaling in the whole embryo to
investigate its normal role. Embryos injected with the dominant-negative FGFR1
(XFD) have perturbed posterior mesoderm and neural development
(Amaya et al., 1991
;
Amaya et al., 1993
;
Pownall et al., 1996
;
Pownall et al., 1998
). In
embryos transgenic for XFD and expressing it before gastrulation, early
expression of posterior patterning Hox genes are inhibited, and embryos
develop with posterior truncations
(Pownall et al., 1998
).
Several experiments in explants and tissue recombinants have reported that
induction of anterior neural tissue is not perturbed by inhibiting FGF
signaling but that posterior neural tissue is dependent upon FGF signaling
(McGrew et al., 1997
;
Xu et al., 1997
;
Barnett et al., 1998
;
Holowacz and Sokol, 1999
;
Ribisi et al., 2000
). When
embryos receive a transplant of presumptive neural ectoderm expressing either
XFD or a dominant-negative form of the Ras GTPase, posterior neural tissue did
not form, but anterior neural tissue did form, confirming that FGF signaling,
specifically FGF signaling through Ras, is necessary for posterior neural
tissue formation (Xu et al.,
1997
; Ribisi et al.,
2000
).
Although many FGF ligands have similar effects in Xenopus
explants, it is not clear why they have quantitatively or qualitatively
different effects in normal development. Cell culture experiments suggest that
different FGF ligands activate specific FGF receptors and promote
proliferation (Ornitz et al.,
1996
), and in oligodendrocyte cultures, different FGF-FGFR
combinations have specific effects on cell proliferation and differentiation
(Fortin et al., 2005
). In vivo
experiments have resolved differences in ligand activity as well; for example,
large differences are apparent in the developing limb bud where FGF8
secreted from the apical ectodermal ridge and FGF10 secreted from the
mesenchyme of the limb bud have distinct activities
(Martin, 1998
).
In addition to differences in activity between FGF ligands, there is
evidence for differences between individual spliceforms of the FGF8
gene. The mammalian FGF8 is alternatively spliced to yield as many as
seven different protein forms in the mouse and four in human
(Crossley and Martin, 1995
;
MacArthur et al., 1995b
;
Gemel et al., 1996
). These
variants have shown different activities in cell culture experiments: for
example, human and mouse FGF8B/Fgf8b, but not
FGF8A/Fgf8a, robustly transform NIH3T3 cells
(MacArthur et al., 1995a
;
Ghosh et al., 1996
), and
FGF8B/Fgf8b binds multiple FGFR `c' spliceforms expressed in
BaF3 cells and induces mitosis. However, FGF8A/Fgf8a has no
detectable activity (MacArthur et al.,
1995b
; Blunt et al.,
1997
). At the midbrain-hindbrain boundary,
FGF8A/Fgf8a promotes midbrain fates, but
FGF8B/Fgf8b transforms midbrain to cerebellar fate
(Liu et al., 1999
;
Sato et al., 2001
;
Liu et al., 2003
).
In this study, we characterize the activity of FGF8a and
FGF8b in X. laevis and X. tropicalis early
development. FGF8b, unlike FGF8a, is a robust inducer of
mesodermal cell fate in both explants and whole embryos. Recently, Myers et
al. (Myers et al., 2004
) used
a mouse Fgf8 to induce mesoderm in X. laevis explants, and
we show here that this mesoderm induction is due to its splicing; thus, X.
laevis FGF8b, human FGF8B and mouse Fgf8f all have very
similar activities when analyzed in X. laevis. FGF8 has at a minimum
a dual role in early Xenopus development. Strong knockdown of
FGF8 results in reduction of xbra and myoD
expression, disruption of gastrulation, and a subsequent reduction in the
paraxial mesoderm. The FGF8b spliceform is specifically needed for
mesoderm development. FGF8 is also involved in early neural
development, and we expand the previous findings that FGF8a can
posteriorize the neural plate, demonstrating that it functions to restrict the
caudal boundary of anterior neural gene expression, and to expand hindbrain
and spinal cord gene expression domains. Using a loss-of-function approach, we
demonstrate that FGF8 is essential for proper establishment of
posterior neural fate: reduction of both FGF8a and FGF8b, as
well as loss of FGF8a alone, causes a reduction in MHB, hindbrain and
spinal cord domains in Xenopus.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Ectodermal explants (animal caps)
Ectodermal explants (animal caps) (300-400 µ2) were excised
from stage 9 embryos with either an eye-brow knife or with the Gastromaster
(XENOTEK Engineering). Animal caps were then cultured in 75% NAM until the
indicated stage and either collected for RT-PCR analysis or fixed.
Whole-mount RNA in situ hybridization
RNA in situ hybridization used multibasket containers
(Sive et al., 2000
). Nuclear
localized ß-galactosidase (nßgal-CS2+) mRNA was used to trace mRNAs.
After fixation for 30 minutes in MEMFA and washing in PBS + 0.1% Tween 20,
tracer was visualized using Red-Gal (Research Organics)
(Sive et al., 2000
); after
staining, embryos were refixed in MEMFA for 1 hour and dehydrated in
methanol.
Embryos that were injected with the fluorescein-conjugated morpholino oligonucleotide as a lineage tracer were processed for in situ hybridization. Then they were rinsed in PBS + 0.1% Tween 20, blocked, incubated with anti-fluorescein alkaline phosphatase-conjugated secondary antibody, washed with MAB, and visualized with magenta phos and tetrazolium red histochemical substrates in a 10:1 ratio.
Antisense RNA probes were made for the following transcripts: xbra
(Smith et al., 1991
);
myoD (Hopwood et al.,
1989
); ntub (Good et
al., 1989
); sox2
(Grammer et al., 2000
);
nrp1 (Knecht et al.,
1995
); otx2 (Lamb et
al., 1993
); en2
(Hemmati-Brivanlou et al.,
1991
); krox20 (Bolce
et al., 1992
); hoxB9
(Sharpe et al., 1987
);
dbx (Gershon et al.,
2000
); ntubulin (Good
et al., 1989
); collagen type II
(Amaya et al., 1993
);
rx1 (Casarosa et al.,
1997
); sox2 (GenBank AL680500); and ephA4
(Smith et al., 1997
). X
tropicalis probes en2, myoD, krox20, hoxB9, otx2, n-tubulin have
been described previously (Khokha et al.,
2002
).
DNA constructs and cloning
X. laevis FGF8a (Christen and
Slack, 1997
) that had been subcloned into pCS107
(Monsoro-Burq et al., 2003
)
was used in this study. X. laevis FGF8b was found in GenBank
(Accession Number BG892841; IMAGE: 4084172). The coding sequence was amplified
using Pfu polymerase and PCR with the following primers: U,
5'-GGATCCATGAACTACATCACCTCCATCC-3'; D,
5'-GAATTCTTACCGAGAACTTGAATATCGAGT-3'. The version with 5'
and 3' UTRs was not as potent as the coding sequence alone. The coding
sequence was cloned into the pCS108 expression vector. Mouse Fgf8a
(Crossley and Martin, 1995
)
and human FGF8B (Ghosh et al.,
1996
) were subcloned into pCS108. X. tropicalis FGF8a and
FGF8b spliceforms were found by BLASTing EST databases, GenBank
CX742774 (Xt FGF8a), GenBank BC082344 (Xt FGF8b).
mRNA synthesis and injection
Synthetic capped messenger RNA was made using the SP6 mMessage mMachine kit
(Ambion). Quantified mRNA was resuspended in RNAse-free H2O and
stored at -80° C. The following constructs were linearized with
AscI and used as templates for SP6 mediated in vitro mRNA synthesis:
X. laevis FGF8a (XLFGF8a-CS7)
(Monsoro-Burq et al., 2003
);
X. laevis FGF8b with 5' and 3' UTR (XLFGF8bfl-CS8);
X. laevis FGF8b with only the coding sequence (XLFGF8b-CS8); mouse
Fgf8a (Crossley and Martin,
1995
) subcloned into pCS108 (mF8a-CS8); mouse Fgf8f
(mF8f-CS7) (Myers et al.,
2004
); human FGF8B
(Ghosh et al., 1996
) subcloned
into CS108 (HsFGF8b-CS8); X. laevis FGF4
(Isaacs et al., 1992
)
subcloned into pCS107 (FGF4-CS107); X. laevis noggin (CS2+xnoggin)
(Mariani and Harland, 1998
);
and nuclear beta-galactosidase (nßgal-CS2+)
(Turner and Weintraub, 1994
).
Embryos were injected into one cell at the two-, four- or eight-cell stage, as
indicated, in 5 or 10 nl volumes.
RT-PCR
Trizol reagent was used to isolate RNA from embryos and explants for
reverse-transcriptase polymerase chain reaction (RT-PCR)
(Wilson and Melton, 1994
). One
embryo equivalent or 15 ectodermal explants were used for each RT-PCR
experiment. To assay for DNA contamination in RT-PCR experiments, an
uninjected control embryo was processed without reverse transcriptase and
labeled as the RT minus lane in each experiment. EF1
or
ornithine decarboxylase (ODC) were used as loading controls.
RT-PCR primers for the following have been described: EF1
(Krieg et al., 1989
);
xbra (Isaacs et al.,
1994
); muscle actin (MA)
(Wilson and Melton, 1994
);
sox2 (Liu and Harland,
2003
); NCAM, en2, krox20 and hoxB9
(Hemmati-Brivanlou and Melton,
1994
); otx2 (Lamb and
Harland, 1995
); hoxD1 and xcad3
(Kolm et al., 1997
);
slug (Mizuseki et al.,
1998
); ODC (Hudson et
al., 1997
). The primers used for detection of Xenopus
FGF8a and FGF8b are: U,
5'-ATCACCTCCATCCTGGGCTATC-3'; D,
5'-TGCGAACTCTGCTTCCAAACG-3'; FGF8a, 253 bp;
FGF8b, 286 bp.
Morpholino oligonucleotide (MO) design and injection
A morpholino oligonucleotide (MO) (Gene Tools) was designed to bind the
translation initiation region of the FGF8 mRNA; the sequence of the
X. laevis FGF8 translation blocking morpholino oligonucleotide
(XlMOF8) is 5'-GGAGGTGATGTAGTTCATGTTGCTC-3'. A four-mismatch
oligonucleotide 5' GGAGGTGATGTAGCTCATCCTGCCC 3' had a fivefold
lower specific activity in X. laevis. The splice-blocking MOs are as
follows: MOSAF8a, 5'-CTCTGCTCCCTCACATGCTGTGTAA-3'; MOSDF8,
5'-AGACGGATGTTCGGGTCCATTTAAC-3'. The Gene Tools standard control
MO (5'-CCTCTTACCTCAGTTACAATTTATA-3') conjugated to fluorescein was
used as a lineage tracer. The morpholino oligonucleotides were resuspended in
RNAse-free 1/20xMR. The injection volume was either 5 nl or 10 nl.
| RESULTS |
|---|
|
|
|---|
X. laevis and X. tropicalis FGF8 mRNAs are not found
maternally, but are detectable by RT-PCR at stage 9.5 just before gastrulation
(Fig. 1C,D). FGF8b is
expressed at higher levels than FGF8a, and expression of both is
maintained throughout early development. In situ hybridization to
FGF8 in X. tropicalis confirms that expression begins
circumferentially around the blastopore and becomes restricted dorsally as
gastrulation proceeds (Fig.
1E,F). By late gastrula, it is expressed in the posterior dorsal
mesoderm, and as neurulation proceeds it is expressed in the future
midbrain-hindbrain boundary, and then in the anterior neural ridge and future
pharyngeal arches and placode regions (Fig.
1G-J). This pattern is consistent with the X. laevis
expression patterns (Christen and Slack,
1997
). Because FGF8 is expressed in the presumptive
mesoderm by gastrulation and in the posterior dorsal mesoderm during early
neural patterning, it is a good candidate for affecting mesoderm and neural
development.
|
|
FGF8a and FGF8b have separable activities: FGF8b expands mesoderm in the embryo
To explore the different activities of FGF8a and FGF8b in
the embryo, we tested whether they would expand mesodermal tissue at the
gastrula stage. Control embryos express xbra in a ring around the
blastopore at stage 11 (Fig.
2I,J). Xenopus FGF8a overexpression did not increase the
xbra expression domain (Fig.
2K,L), in agreement with Hardcastle et al.
(Hardcastle et al., 2000
).
Injection of Xenopus FGF8b mRNA expanded the mesodermal territory in
a non-cell-autonomous manner as xbra expression is expanded beyond
the lineage-traced tissue (Fig.
2O,P).
This difference in activity between the two forms of FGF8 on the whole embryo is conserved. Overexpression of mouse FGF8a had the same phenotype as Xenopus FGF8a and did not expand xbra expression (Fig. 2M,N). Both human FGF8B and mouse Fgf8f phenocopied the Xenopus FGF8b expansion of xbra (Fig. 2Q-T).
Hardcastle et al. (Hardcastle et al.,
2000
) found that overexpression of Xenopus FGF8a can
induce ectopic neurons detectable by in situ hybridization to neuronal
ß-tubulin (ntub). To address further whether FGF8a
and FGF8b have separable activities, embryos were injected with a
range of doses and analyzed for production of ectopic neurons and effects on
mesoderm. Xenopus FGF8a overexpression does not expand mesoderm
(Fig. 2W), but it does cause
massive ectopic ntub expression in a punctate, non-cell-autonomous
manner over the entire epidermis (Fig.
2X). FGF8b (Fig.
2O,P) induces mesoderm strongly and disrupts gastrulation at 5 pg
doses and higher. At a very low dose, FGF8b does not appear to affect
mesoderm, but it does have a very weak ability to increase ntub
expression (Fig. 2AA,BB),
suggesting that it also possesses at least a low level of the FGF8a
activity. This contrasts with a recent report that FGF8b robustly
induces ectopic ntub (Shim et
al., 2005
). At an even lower dose of FGF8b (0.1pg), no
phenotype is observed (data not shown) and no dose mimicked FGF8a.
Importantly, even at high doses, FGF8a does not expand mesoderm
(Fig. 2K,L,W).
Mouse Fgf8a and Fgf8f parallel the activities of
Xenopus FGF8a and FGF8b. Mouse FGF8a causes ectopic
ntub expression in a non-cell-autonomous manner
(Fig. 2Y,Z). Mouse
FGF8f induces mesoderm (Fig.
2S,T) and perturbs gastrulation and myoD expression
(Fig. 2EE), while reducing
ntub expression (Fig.
2FF). At a low dose, mouse FGF8f mispatterns
ntub with a few ectopic neurons present, and it slightly expands
myoD expression (Fig.
2CC,DD). Xenopus FGF4 has the same effect as both
Xenopus FGF8b and mouse Fgf8f in that it affects mesoderm
and does not result in the massive ectopic ntub expansion
(Hardcastle et al., 2000
).
Morpholino oligonucleotides targeted to Xenopus FGF8
Several morpholino oligonucleotides (MOs) (Gene Tools) were designed to
prevent either translation or proper splicing of FGF8 transcripts in
X. laevis and X. tropicalis
(Fig. 3A). XlMOF8 was targeted
to the translational start site of X. laevis. The XlMOF8 inhibited
FGF8 protein synthesis in in vitro transcription and translation
assays when the template had the XlMOF8 target sequence but not when the
target was absent (data not shown). In animal cap assays, explants injected
with FGF8b mRNA expressed xbra
(Fig. 3B, lane 4), whereas
uninjected animal caps did not (lane 3). When 40 ng of XlMOF8 was injected
with FGF8b containing the target sequence, no xbra was
induced (Fig. 3B, lane 6), and
this effect was eliminated when the XlMOF8 target sequence was mutated (lane
7). Similarly, FGF4 induced xbra in the presence of the
XlMOF8 (lane 8).
|
FGF8 is necessary for proper mesoderm formation: FGF8b is the FGF8 spliceform affecting mesodermal development
FGF signaling is necessary for trunk and tail mesoderm formation
(Amaya et al., 1991
;
Amaya et al., 1993
), and FGF
signaling functions by maintaining xbra expression in the presumptive
mesoderm (Isaacs et al., 1994
;
Schulte-Merker and Smith,
1995
; Kroll and Amaya,
1996
). To determine whether FGF8 is an important ligand
in mediating this process, we analyzed the effect of knocking down
FGF8. Injection of the translation blocking MO XlMOF8 causes a severe
reduction in xbra expression by the gastrula stage, and xbra
expression can be restored by human FGF8B, mouse Fgf8f and
Xenopus FGF4 (Fig.
4B-E). Strongly reducing the FGF8 spliceforms with the
FGF8 splice-blocking MO, MOSDF8, reduces xbra
(Fig. 4F; blue hybridization
signal, pink/red lineage tracer). This reduction can be rescued with
FGF8b but not with FGF8a
(Fig. 4G,H). The
FGF8a-specific MO MOSAF8a does not diminish xbra expression
(Fig. 4I), demonstrating that
FGF8a is not necessary for proper mesoderm formation. Similarly,
reduction of the FGF8 spliceforms results in a reduction in
xbra expression in X. tropicalis
(Fig. 4K), and this can be
rescued with FGF8b (Fig.
4L). These results demonstrate that FGF8 is necessary for
mesoderm formation in the embryo and suggests that FGF8b is the
predominant FGF8 spliceform involved in early mesoderm formation.
|
Because several FGF ligands (FGF3, FGF4, FGF8b) are expressed
around the blastoporal region in Xenopus laevis and have been shown
to affect mesoderm formation in whole embryos
(Isaacs et al., 1992
;
Isaacs et al., 1994
;
Lombardo et al., 1998
;
Fisher et al., 2002
) (Figs
1,
2,
3,
4), multiple FGF ligands
contribute to early mesoderm formation and patterning in Xenopus, but
FGF8b appears to be particularly necessary for early mesoderm
formation in the Xenopus embryo.
FGF8a promotes posterior neural fate in explants and in the whole embryo
Whereas a strong knockdown of FGF8 results in a reduction in
mesoderm formation, a lower level knockdown of both spliceforms or loss of
FGF8a alone causes a reduction in posterior neural tissue development
with little effect on mesoderm formation. To follow up on the initial
observations of Christen and Slack
(Christen and Slack, 1997
)
that FGF8a caused headless tadpoles
(Fig. 5C), we first analyzed
how FGF8a mRNA overexpression affects explants and anteroposterior
neural patterning in the whole embryo. Because it does not affect mesoderm
formation (Figs 2,
4), we focused on the activity
of FGF8a.
FGF signaling posteriorizes explants
(Cox and Hemmati-Brivanlou,
1995
), is necessary for posterior neural tissue to develop in
explants (Holowacz and Sokol,
1999
) and can induce posterior neural tissue directly in explants
(Kengaku and Okamoto, 1995
;
Lamb and Harland, 1995
). In
Fig. 5, we show that
FGF8a mRNA can induce posterior neural transcripts directly in
explants. FGF8a induces expression of hindbrain transcripts
(krox20, hoxD1), spinal cord transcripts (hoxB9 and
cad3), and at a very high dose the midbrain-hindbrain boundary
marker, en2 (Fig. 5A,
lanes 10-12). In combination with noggin, which induces expression of
the anterior transcript, otx2, FGF8a causes strong expression of the
MHB gene, en2 and a slight reduction in the level of otx2
expression (lanes 6-9), confirming the ability of FGF8a to act as a
posteriorizing agent.
|
To understand how FGF8a can affect neural pattern, embryos were
examined for expression of a range of anteroposterior transcripts by in situ
hybridization. Injection of FGF8a mRNA reduces anterior neural gene
expression domains. The forebrain and midbrain mRNA, otx2
(Lamb et al., 1993
) and the
eye-specific rx1 (Casarosa et
al., 1997
) are strongly reduced in FGF8a-injected embryos
(Fig. 5J-M). Similarly, the
forebrain domain of ephA4 expression
(Smith et al., 1997
) is
reduced (Fig. 5O,P).
Overexpression of FGF8a causes posterior neural tissue domains to
expand both laterally and anteriorly. FGF8a expands the r3 and r5
domains of ephA4 and krox20
(Bradley et al., 1993
),
resulting in an extension of hindbrain domains laterally and forward
(Fig. 5O,P,U,V). The exposure
to FGF8a signaling appears to transform the behavior of rhombomere 3
into that of rhombomere 5, with a trail of expressing cells extending towards
ventral regions of the embryo. The effects are dose dependent and non-cell
autonomous, as effects are seen on the injected side but also on the
uninjected side. FGF8a expands expression of the spinal cord
transcript, hoxB9 (Sharpe et al.,
1987
) anteriorly (Fig.
5U,V). The midbrain-hindbrain boundary (MHB) expression of
en2 is expanded forward, sometimes to the most anterior regions of
the neural plate (Fig. 5R,S),
consistent with the results of Christen and Slack
(Christen and Slack,
1997
).
The posterior expansion explains the peculiar morphology observed when
sox2 expression is examined (Fig.
5B,D); the bulbous expansion in the anterior of the embryos
reflects the expansion of the posterior neural tissue domains both laterally
and towards the anterior, and this repatterning fits well with previous work
showing that FGF8a can shift neural crest domains laterally and
expand neural crest tissue around the anterior of the embryo
(Monsoro-Burq et al.,
2003
).
FGF8 is essential for proper posterior neural specification in X. laevis and X. tropicalis
Because FGF8a can posteriorize the neural plate
(Fig. 5) and because FGF
signaling is necessary for proper posterior neural tissue formation
(Amaya et al., 1991
;
Amaya et al., 1993
;
Pownall et al., 1996
;
Pownall et al., 1998
;
Ribisi et al., 2000
), we were
interested in determining whether FGF8 was crucial for posterior
neural fate specification.
By using low doses of the MOs that knockdown both FGF8 spliceforms and by using the FGF8a-specific MOSAF8a, we have addressed how FGF8 is involved in neural fate specification and differentiation. First, X. laevis embryos were injected with the indicated MOs and analyzed early in neural development to ascertain which neural fates depended upon FGF8 signaling. XlMOF8, MOSDF8 and MOSAF8a all affect expression of sox2 - it is still present, but it is mispatterned (Fig. 6B-D). This demonstrates that loss of the FGF8a spliceform or a lowering of the levels of both the FGF8a and FGF8b spliceforms prevents proper patterning of the neural plate.
FGF8 signaling is necessary to properly establish the caudal
boundary of the anterior neural domain. Loss of FGF8a or a reduction
in both FGF8a and FGF8b results in slight posterior
expansion of expression of the forebrain and midbrain mRNA otx2
(Fig. 6F-H). Establishment of
the midbrain-hindbrain boundary, an important signaling center as neural
development proceeds, also depends on FGF8 signals. XlMOF8, MOSDF8
and MOSAF8a result in a severe reduction in en2 expression, and any
faint remaining en2 expression is shifted towards the posterior of
the embryo (Fig. 6J-L). XlMOF8-
and MOSDF8-injected embryos also show reduced myoD staining at these
low doses, whereas myoD appears only slightly affected in
MOSAF8a-injected embryos. The slight mispatterning and reduction in
myoD expression may also be in part due to the effect of
FGF8 signaling on the neural plate as the neural plate is important
for somite formation (Mariani et al.,
2001
).
FGF8a and FGF8b signaling is necessary for the
specification of the hindbrain and spinal cord neural plate domains. XLMOF8,
MOSDF8 and MOSAF8a all result in a very strong reduction to loss of expression
of the hindbrain transcript krox20 and of the spinal cord transcript
hoxB9 (Fig. 6N-P).
Additionally, the spinal cord transcript dbx
(Gershon et al., 2000
) is
absent on the injected side (Fig.
6F-H). FGF8 is also necessary for posterior neural tissue
formation in X. tropicalis (data not shown). Because the effect on
posterior neural development occurs early, it strongly suggests that
FGF8 is necessary for the initial specification of posterior neural
fate - not simply to maintain posterior neural tissue.
Congruent with the analysis in early neurula stage embryos, en2 (data not shown), krox20 and hoxB9 are all reduced and, if present, shifted towards the posterior of the embryo at the neural tube stage (Fig. 6Q-S). The effect of XlMOF8, MOSDF8 and MOSAF8a on posterior neural tissue can be rescued by FGF8a mRNA (Fig. 6T-V) where the anterior truncation of the hoxB9 expression domain is reversed, and where krox20 is more strongly expressed and not shifted to the posterior.
The analysis of neural tube stage embryos confirms the importance of
FGF8 to posterior neural development, but it also reveals that
FGF8 is important for placode formation
(Fig. 7B,C). The placode
domains (Schlosser and Ahrens,
2004
) are reduced and the regionalized staining in the brain
regions is perturbed bilaterally but more so on the injected side of the
embryo which agrees with a recent report
(Ahrens and Schlosser, 2005
).
The eye-field, marked by rx1, is expanded towards the posterior in
MOSAF8a-injected embryos (Fig.
7E), again supporting the role of FGF8a in helping to
limit the anterior neural domain boundary. Neuronal differentiation, marked by
ntub (Fig. 7F-M) is
reduced when FGF8a and FGF8b levels are lowered; this is
complementary to the massive expansion of ntub expression when
FGF8a is overexpressed
(Hardcastle et al., 2000
). In
addition to posterior neural reductions, knockdown of FGF8a and
FGF8b causes posterior truncations by the tadpole stage
(Fig. 7I,K,M).
|
|
| DISCUSSION |
|---|
|
|
|---|
Our analysis confirms that Xenopus FGF8a is not a strong mesoderm
inducer because it has almost no activity in mesoderm induction assays in
explants, and it does not expand xbra expression in whole embryos
when overexpressed (Christen and Slack,
1997
). Consistent with this, an FGF8a-specific MO
(MOSAF8a) that blocks the splice acceptor does not affect xbra, yet
knocking down only the FGF8a spliceform does affect neural
patterning. This contrasts remarkably with the activity of Xenopus FGF8b.
X. laevis FGF8b is a robust inducer of xbra in explants, and in
the whole embryo it expands xbra in a non-cell-autonomous manner
(Fig. 2). A strong knockdown
FGF8a and FGF8b with either a translation-blocking MO
(XlMOF8) or a splice-donor blocking MO reduces xbra expression and,
additionally, results in a reduction of myoD expression
(Fig. 4). A low level knockdown
of FGF8a and FGF8b or a strong knockdown of FGF8a
alone causes a reduction in the specification of posterior neural tissue.
Therefore, FGF8 plays at least two separable roles in early
Xenopus development: FGF8 signaling is specifically required
for formation of mesoderm, and this work demonstrates the important role of
FGF8b as the primary FGF8 spliceform involved in this
process. Second, FGF8 signaling is necessary for proper establishment
of posterior neural identity. The FGF8a spliceform is necessary for
this process, and because we see an enhanced posterior neural reduction when
both spliceforms are reduced, it argues that FGF8b may also be
contributing to posterior neural development.
An earlier analysis of Xenopus FGF4 has shown that in addition to
mesoderm inducing activity, it is necessary for full myoD expression
in the embryo (Fisher et al.,
2002
). Taken with our work on FGF8, this demonstrates that both
FGF4 and FGF8b are necessary for proper mesoderm formation
in Xenopus. It is interesting that a strong knockdown of
FGF8 is sufficient to perturb proper mesoderm formation; this
suggests that one need only remove part of the FGF signaling to prevent the
proper xbra feedback loop, and it suggests that these FGFs are
working together to some degree.
Interestingly, FGF8 is involved in proper mesoderm formation in the mouse
but in a different manner. In the mouse, homozygous FGF8
loss-of-function mutants form mesoderm early, but cells do not migrate away
from the streak and later differentiation of mesodermal derivatives does not
occur (Sun et al., 1999
). In
zebrafish, the combination of FGF8 and FGF24 is needed for
establishment of posterior mesoderm
(Draper et al., 2003
). In
contrast to zebrafish, where FGF8 appears involved in establishing
dorsal identity (Furthauer et al.,
1997
; Furthauer et al.,
2004
), in Xenopus, FGF8 does not induce secondary axes as
it can in zebrafish.
Wnt, FGF and RA signaling have all been shown to be involved in posterior
neural development (Lamb and Harland,
1995
; Blumberg et al.,
1997
; Christen and Slack,
1997
; Kolm et al.,
1997
; McGrew et al.,
1997
; Hollemann et al.,
1998
; Domingos et al.,
2001
; Kiecker and Niehrs,
2001
). The FGF8 spliceforms, even the individual
FGF8a, are necessary for establishment of posterior neural identity
and for restriction of the anterior neural domain. Because the effect of
reduction in FGF8 spliceforms is observed early in development, we
argue that FGF8 signaling is necessary for the establishment of
posterior neural fate, not simply for its maintenance. This FGF8
signal would cooperate with other FGFs, Wnts and RA in the formation of
posterior identities (Isaacs et al.,
1995
; Pownall et al.,
1996
; McGrew et al.,
1997
; Lombardo et al.,
1998
; Domingos et al.,
2001
; Kiecker and Niehrs,
2001
). Interestingly, reduction in FGF8 levels does not
cause an expansion of anterior neural gene expression into the normal spinal
cord domains; rather, there is only a limited movement of the caudal anterior
neural gene expression boundary towards the posterior; this would support the
idea that multiple signals are involved in limiting anterior neural gene
expression.
Recent work suggests that FGF signaling is involved in the specification of
all neural tissue, not just for formation of posterior neural tissue
(Pera et al., 2003
;
Delaune et al., 2005
). This
may be why sox2 expression is weakly reduced in XlMOF8- and
MOSDF8-injected embryos, whereas knockdown of specifically FGF8a has
a weaker effect on sox2 expression levels while still strongly
affecting posterior neural gene expression. Perhaps a stronger loss of more
FGF signaling ligands is necessary to preclude neural tissue formation, but a
more temporally precise loss of individual ligands will be necessary to
discern any direct effects on neural development from early mesoderm
formation.
In addition to the differences in activity between FGF spliceforms that
have been observed in several cell culture assays
(MacArthur et al., 1995a
;
MacArthur et al., 1995b
;
Ghosh et al., 1996
;
Blunt et al., 1997
) and in
mesodermal development in X. laevis (Figs
2,
4), differences in activity
between FGF8a and FGF8b in neural development have also been
reported in the mouse and chick. In the mouse and chick, FGF8b
overexpression at the MHB results in expansion of the hindbrain, while
overexpression of FGF8a at the MHB results in some expansion of the
midbrain and ectopic en2 expression
(Liu et al., 1999
;
Sato et al., 2001
;
Sato et al., 2004
). In
addition, in chick extra-embryonic epiblast cells, FGF8b could induce
expression of brachyury and the neuronal precursor gene,
cash4, while FGF8a had no activity
(Storey et al., 1998
).
Although FGF8a and FGF8b have very different activities,
they differ by only 11 amino acids in the N-terminal region of the protein
(Fig. 1A). One possible
explanation is that the difference in activity between FGF8a and
FGF8b - specifically, that FGF8b can robustly induce
mesoderm and expand it in the whole embryo whereas FGF8a cannot and
that FGF8a can posteriorize the neural plate without affecting
mesoderm - could be due to differences in the affinity of the two spliceform
products for different receptors or spectrum of receptors. Recent biochemical
and structural work supports the idea that a large part of the difference in
activity between the two ligands at the MHB in the chick and mouse is due to
differences in affinity between the isoforms for the different FGFRs, with
FGF8b having a higher affinity than FGF8a
(Olsen et al., 2006
). This
must certainly be a contributing mechanism to the differences in their
activities in Xenopus, regardless of whether they bind a different
set or combination of receptors in vivo. It is remarkable that the embryo can
respond in a drastically different way to the two versions of the
FGF8 ligand. As there is evidence that in some cellular contexts,
heparin sulfate can mediate FGF8b interaction with different FGFRs
(Allen and Rapraeger, 2003
), it
would be interesting to know whether molecules such as heparin sulfate
function in eliciting such biologically significant differences in activity.
Furthermore, spliceform specific knockouts in the mouse, which has seven
different splice variants, would be informative in understanding how the
FGF8 gene functions. Alternative splicing of FGF8 confers
specific activity to the spliceforms and is integral to the role of the gene
in early mesodermal and neural development in Xenopus.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahrens, K. and Schlosser, G. (2005). Tissues
and signals involved in the induction of placodal Six1 expression in Xenopus
laevis. Dev. Biol. 288,40
-59.[CrossRef][Medline]
Allen, B. L. and Rapraeger, A. C. (2003).
Spatial and temporal expression of heparan sulfate in mouse development
regulates FGF and FGF receptor assembly. J. Cell Biol.
163,637
-648.
Amaya, E., Musci, T. J. and Kirschner, M. W.
(1991). Expression of a dominant negative mutant of the FGF
receptor disrupts mesoderm formation in Xenopus embryos.
Cell 66,257
-270.[CrossRef][Medline]
Amaya, E., Stein, P. A., Musci, T. J. and Kirschner, M. W.
(1993). FGF signalling in the early specification of mesoderm in
Xenopus. Development
118,477
-487.[Abstract]
Barnett, M. W., Old, R. W. and Jones, E. A.
(1998). Neural induction and patterning by fibroblast growth
factor, notochord and somite tissue in Xenopus. Dev. Growth
Differ. 40,47
-57.[CrossRef][Medline]
Bendtsen, J. D., Nielsen, H., von Heijne, G. and Brunak, S.
(2004). Improved prediction of signal peptides: SignalP 3.0.
J. Mol. Biol. 340,783
-795.[CrossRef][Medline]
Blumberg, B., Bolado, J., Jr, Moreno, T. A., Kintner, C., Evans,
R. M. and Papalopulu, N. (1997). An essential role for
retinoid signaling in anteroposterior neural patterning.
Development 124,373
-379.[Abstract]
Blunt, A. G., Lawshe, A., Cunningham, M. L., Seto, M. L.,
Ornitz, D. M. and MacArthur, C. A. (1997). Overlapping
expression and redundant activation of mesenchymal fibroblast growth factor
(FGF) receptors by alternatively spliced FGF-8 ligands. J. Biol.
Chem. 272,3733
-3738.
Bolce, M. E., Hemmati-Brivanlou, A., Kushner, P. D. and Harland,
R. M. (1992). Ventral ectoderm of Xenopus forms neural
tissue, including hindbrain, in response to activin.
Development 115,681
-688.[Abstract]
Bradley, L. C., Snape, A., Bhatt, S. and Wilkinson, D. G.
(1993). The structure and expression of the Xenopus Krox-20 gene:
conserved and divergent patterns of expression in rhombomeres and neural
crest. Mech. Dev. 40,73
-84.[CrossRef][Medline]
Brett, D., Pospisil, H., Valcarcel, J., Reich, J. and Bork,
P. (2002). Alternative splicing and genome complexity.
Nat. Genet. 30,29
-30.[CrossRef][Medline]
Casarosa, S., Andreazzoli, M., Simeone, A. and Barsacchi, G.
(1997). Xrx1, a novel Xenopus homeobox gene expressed during eye
and pineal gland development. Mech. Dev.
61,187
-198.[CrossRef][Medline]
Christen, B. and Slack, J. M. (1997). FGF-8 is
associated with anteroposterior patterning and limb regeneration in Xenopus.
Dev. Biol. 192,455
-466.[CrossRef][Medline]
Cox, W. G. and Hemmati-Brivanlou, A. (1995).
Caudalization of neural fate by tissue recombination and bFGF.
Development 121,4349
-4358.[Abstract]
Crossley, P. H. and Martin, G. R. (1995). The
mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions
that direct outgrowth and patterning in the developing embryo.
Development 121,439
-451.[Abstract]
Delaune, E., Lemaire, P. and Kodjabachian, L.
(2005). Neural induction in Xenopus requires early FGF signalling
in addition to BMP inhibition. Development
132,299
-310.
Dempski, R. E., Jr and Imperiali, B. (2002).
Oligosaccharyl transferase: gatekeeper to the secretory pathway.
Curr. Opin. Chem. Biol.
6, 844-850.[CrossRef][Medline]
Domingos, P. M., Itasaki, N., Jones, C. M., Mercurio, S.,
Sargent, M. G., Smith, J. C. and Krumlauf, R. (2001). The
Wnt/beta-catenin pathway posteriorizes neural tissue in Xenopus by an indirect
mechanism requiring FGF signalling. Dev. Biol.
239,148
-160.[CrossRef][Medline]
Draper, B. W., Stock, D. W. and Kimmel, C. B.
(2003). Zebrafish fgf24 functions with fgf8 to promote posterior
mesodermal development. Development
130,4639
-4654.
Fisher, M. E., Isaacs, H. V. and Pownall, M. E.
(2002). eFGF is required for activation of XmyoD expression in
the myogenic cell lineage of Xenopus laevis.
Development 129,1307
-1315.[Medline]
Fortin, D., Rom, E., Sun, H., Yayon, A. and Bansal, R.
(2005). Distinct fibroblast growth factor (FGF)/FGF receptor
signaling pairs initiate diverse cellular responses in the oligodendrocyte
lineage. J. Neurosci.
25,7470
-7479.
Furthauer, M., Thisse, C. and Thisse, B.
(1997). A role for FGF-8 in the dorsoventral patterning of the
zebrafish gastrula. Development
124,4253
-4264.[Abstract]
Furthauer, M., Van Celst, J., Thisse, C. and Thisse, B.
(2004). Fgf signalling controls the dorsoventral patterning of
the zebrafish embryo. Development
131,2853
-2864.
Gemel, J., Gorry, M., Ehrlich, G. D. and MacArthur, C. A.
(1996). Structure and sequence of human FGF8.
Genomics 35,253
-257.[CrossRef][Medline]
Gershon, A. A., Rudnick, J., Kalam, L. and Zimmerman, K.
(2000). The homeodomain-containing gene Xdbx inhibits neuronal
differentiation in the developing embryo. Development
127,2945
-2954.[Abstract]
Ghosh, A. K., Shankar, D. B., Shackleford, G. M., Wu, K., T'Ang,
A., Miller, G. J., Zheng, J. and Roy-Burman, P. (1996).
Molecular cloning and characterization of human FGF8 alternative messenger RNA
forms. Cell Growth Differ.
7,1425
-1434.[Abstract]
Good, P. J., Richter, K. and Dawid, I. B.
(1989). The sequence of a nervous system-specific, class II
beta-tubulin gene from Xenopus laevis. Nucleic Acids
Res. 17,8000
.
Grammer, T. C., Liu, K. J., Mariani, F. V. and Harland, R.
M. (2000). Use of large-scale expression cloning screens in
the Xenopus laevis tadpole to identify gene function. Dev.
Biol. 228,197
-210.[CrossRef][Medline]
Hardcastle, Z., Chalmers, A. D. and Papalopulu, N.
(2000). FGF-8 stimulates neuronal differentiation through FGFR-4a
and interferes with mesoderm induction in Xenopus embryos. Curr.
Biol. 10,1511
-1514.[CrossRef][Medline]
Harvey, R. P. (1991). Widespread expression of
MyoD genes in Xenopus embryos is amplified in presumptive muscle as a delayed
response to mesoderm induction. Proc. Natl. Acad. Sci.
USA 88,9198
-9202.
Haworth, K. E., Healy, C. and Sharpe, P. T.
(2005). Characterisation of the genomic structure of chick Fgf8.
DNA Seq. 16,180
-186.[Medline]
Hemmati-Brivanlou, A., de la Torre, J. R., Holt, C. and Harland,
R. M. (1991). Cephalic expression and molecular
characterization of Xenopus En-2. Development
111,715
-724.[Abstract]
Hemmati-Brivanlou, A. and Melton, D. A. (1994).
Inhibition of activin receptor signaling promotes neuralization in Xenopus.
Cell 77,273
-281.[CrossRef][Medline]
Hollemann, T., Chen, Y., Grunz, H. and Pieler, T.
(1998). Regionalized metabolic activity establishes boundaries of
retinoic acid signalling. EMBO J.
17,7361
-7372.[CrossRef][Medline]
Holowacz, T. and Sokol, S. (1999). FGF is
required for posterior neural patterning but not for neural induction.
Dev. Biol. 205,296
-308.[CrossRef][Medline]
Hopwood, N. D., Pluck, A. and Gurdon, J. B.
(1989). MyoD expression in the forming somites is an early
response to mesoderm induction in Xenopus embryos. EMBO
J. 8,3409
-3417.[Medline]
Hudson, C., Clements, D., Friday, R. V., Stott, D. and Woodland,
H. R. (1997). Xsox17alpha and -beta mediate endoderm
formation in Xenopus. Cell
91,397
-405.[CrossRef][Medline]
Isaacs, H. V., Tannahill, D. and Slack, J. M.
(1992). Expression of a novel FGF in the Xenopus embryo. A new
candidate inducing factor for mesoderm formation and anteroposterior
specification. Development
114,711
-720.[Abstract]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1994). eFGF regulates Xbra expression during Xenopus
gastrulation. EMBO J.
13,4469
-4481.[Medline]
Isaacs, H. V., Pownall, M. E. and Slack, J. M.
(1995). eFGF is expressed in the dorsal midline of Xenopus
laevis. Int. J. Dev. Biol.
39,575
-579.[Medline]
Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch,
P. M., Armour, C. D., Santos, R., Schadt, E. E., Stoughton, R. and Shoemaker,
D. D. (2003). Genome-wide survey of human alternative
pre-mRNA splicing with exon junction microarrays.
Science 302,2141
-2144.
Kan, Z., Rouchka, E. C., Gish, W. R. and States, D. J.
(2001). Gene structure prediction and alternative splicing
analysis using genomically aligned ESTs. Genome Res.
11,889
-900.
Kengaku, M. and Okamoto, H. (1995). bFGF as a
possible morphogen for the anteroposterior axis of the central nervous system
in Xenopus. Development
121,3121
-3130.[Abstract]
Khokha, M. K., Chung, C., Bustamante, E. L., Gaw, L. W., Trott,
K. A., Yeh, J., Lim, N., Lin, J. C., Taverner, N., Amaya, E. et al.
(2002). Techniques and probes for the study of Xenopus tropicalis
development. Dev. Dyn.
225,499
-510.[CrossRef][Medline]
Kiecker, C. and Niehrs, C. (2001). A morphogen
gradient of Wnt/beta-catenin signalling regulates anteroposterior neural
patterning in Xenopus. Development
128,4189
-4201.
Kimelman, D. and Kirschner, M. (1987).
Synergistic induction of mesoderm by FGF and TGF-beta and the identification
of an mRNA coding for FGF in the early Xenopus embryo.
Cell 51,869
-877.[CrossRef][Medline]
Knecht, A. K., Good, P. J., Dawid, I. B. and Harland, R. M.
(1995). Dorsal-ventral patterning and differentiation of
noggin-induced neural tissue in the absence of mesoderm.
Development 121,1927
-1935.[Abstract]
Kolm, P. J., Apekin, V. and Sive, H. (1997).
Xenopus hindbrain patterning requires retinoid signaling. Dev.
Biol. 192,1
-16.[CrossRef][Medline]
Krieg, P. A., Varnum, S. M., Wormington, W. M. and Melton, D.
A. (1989). The mRNA encoding elongation factor 1-alpha (EF-1
alpha) is a major transcript at the midblastula transition in Xenopus.
Dev. Biol. 133,93
-100.[CrossRef][Medline]
Kroll, K. L. and Amaya, E. (1996). Transgenic
Xenopus embryos from sperm nuclear transplantations reveal FGF signaling
requirements during gastrulation. Development
122,3173
-3183.[Abstract]
Lamb, T. M. and Harland, R. M. (1995).
Fibroblast growth factor is a direct neural inducer, which combined with
noggin generates anterior-posterior neural pattern.
Development 121,3627
-3636.[Abstract]
Lamb, T. M., Knecht, A. K., Smith, W. C., Stachel, S. E.,
Economides, A. N., Stahl, N., Yancopolous, G. D. and Harland, R. M.
(1993). Neural induction by the secreted polypeptide noggin.
Science 262,713
-718.
Lander, E. S., Linton, L. M., Birren, B., Nusbaum, C., Zody, M.
C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W. et al.
(2001). Initial sequencing and analysis of the human genome.
Nature 409,860
-921.[CrossRef][Medline]
Liu, A., Losos, K. and Joyner, A. L. (1999).
FGF8 can activate Gbx2 and transform regions of the rostral mouse brain into a
hindbrain fate. Development
126,4827
-4838.[Abstract]
Liu, A., Li, J. Y., Bromleigh, C., Lao, Z., Niswander, L. A. and
Joyner, A. L. (2003). FGF17b and FGF18 have different
midbrain regulatory properties from FGF8b or activated FGF receptors.
Development 130,6175
-6185.
Liu, K. J. and Harland, R. M. (2003). Cloning
and characterization of Xenopus Id4 reveals differing roles for Id genes.
Dev. Biol. 264,339
-351.[CrossRef][Medline]
Lombardo, A., Isaacs, H. V. and Slack, J. M.
(1998). Expression and functions of FGF-3 in Xenopus development.
Int. J. Dev. Biol. 42,1101
-1107.[Medline]
MacArthur, C. A., Lawshe, A., Shankar, D. B., Heikinheimo, M.
and Shackleford, G. M. (1995a). FGF-8 isoforms differ in
NIH3T3 cell transforming potential. Cell Growth
Differ. 6,817
-825.[Abstract]
MacArthur, C. A., Lawshe, A., Xu, J., Santos-Ocampo, S.,
Heikinheimo, M., Chellaiah, A. T. and Ornitz, D. M. (1995b).
FGF-8 isoforms activate receptor splice forms that are expressed in
mesenchymal regions of mouse development. Development
121,3603
-3613.[Abstract]
Mariani, F. V. and Harland, R. M. (1998). XBF-2
is a transcriptional repressor that converts ectoderm into neural tissue.
Development 125,5019
-5031.[Abstract]
Mariani, F. V., Choi, G. B. and Harland, R. M.
(2001). The neural plate specifies somite size in the Xenopus
laevis gastrula. Dev. Cell
1, 115-126.[CrossRef][Medline]
Martin, G. R. (1998). The roles of FGFs in the
early development of vertebrate limbs. Genes Dev.
12,1571
-1586.
McGrew, L. L., Hoppler, S. and Moon, R. T.
(1997). Wnt and FGF pathways cooperatively pattern
anteroposterior neural ectoderm in Xenopus. Mech. Dev.
69,105
-114.[CrossRef][Medline]
Mizuseki, K., Kishi, M., Matsui, M., Nakanishi, S. and Sasai,
Y. (1998). Xenopus Zic-related-1 and Sox-2, two factors
induced by chordin, have distinct activities in the initiation of neural
induction. Development
125,579
-587.[Abstract]
Modrek, B., Resch, A., Grasso, C. and Lee, C.
(2001). Genome-wide detection of alternative splicing in
expressed sequences of human genes. Nucleic Acids Res.
29,2850
-2859.
Monsoro-Burq, A. H., Fletcher, R. B. and Harland, R. M.
(2003). Neural crest induction by paraxial mesoderm in Xenopus
embryos requires FGF signals. Development
130,3111
-3124.
Myers, A. P., Corson, L. B., Rossant, J. and Baker, J. C.
(2004). Characterization of mouse Rsk4 as an inhibitor of
fibroblast growth factor-RAS-extracellular signal-regulated kinase signaling.
Mol. Cell. Biol. 24,4255
-4266.
Nieuwkoop, P. D. and Faber, J. (1994).Normal Table of Xenopus laevis (Daudin)
. New
York: Garland.
Olsen, S. K., Li, J. Y., Bromleigh, C., Eliseenkova, A. V.,
Ibrahimi, O. A., Lao, Z., Zhang, F., Linhardt, R. J., Joyner, A. L. and
Mohammadi, M. (2006). Structural basis by which alternative
splicing modulates the organizer activity of FGF8 in the brain.
Genes Dev. 20,185
-198.
Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur,
C. A., Coulier, F., Gao, G. and Goldfarb, M. (1996). Receptor
specificity of the fibroblast growth factor family. J. Biol.
Chem. 271,15292
-15297.
Pera, E. M., Ikeda, A., Eivers, E. and De Robertis, E. M.
(2003). Integration of IGF, FGF, and anti-BMP signals via Smad1
phosphorylation in neural induction. Genes Dev
17,3023
-3028.
Pownall, M. E., Tucker, A. S., Slack, J. M. and Isaacs, H.
V. (1996). eFGF, Xcad3 and Hox genes form a molecular pathway
that establishes the anteroposterior axis in Xenopus.
Development 122,3881
-3892.[Abstract]
Pownall, M. E., Isaacs, H. V. and Slack, J. M.
(1998). Two phases of Hox gene regulation during early Xenopus
development. Curr. Biol.
8, 673-676.[CrossRef][Medline]
Ribisi, S., Jr, Mariani, F. V., Aamar, E., Lamb, T. M., Frank,
D. and Harland, R. M. (2000). Ras-mediated FGF signaling is
required for the formation of posterior but not anterior neural tissue in
Xenopus laevis. Dev. Biol.
227,183
-196.[CrossRef][Medline]
Sato, T., Araki, I. and Nakamura, H. (2001).
Inductive signal and tissue responsiveness defining the tectum and the
cerebellum. Development
128,2461
-2469.
Sato, T., Joyner, A. L. and Nakamura, H.
(2004). How does Fgf signaling from the isthmic organizer induce
midbrain and cerebellum development? Dev. Growth
Differ. 46,487
-494.[CrossRef][Medline]
Schlosser, G. and Ahrens, K. (2004). Molecular
anatomy of placode development in Xenopus laevis. Dev.
Biol. 271,439
-466.[CrossRef][Medline]
Schulte-Merker, S. and Smith, J. C. (1995).
Mesoderm formation in response to Brachyury requires FGF signalling.
Curr. Biol. 5,62
-67.[CrossRef][Medline]
Sharpe, C. R., Fritz, A., De Robertis, E. M. and Gurdon, J.
B. (1987). A homeobox-containing marker of posterior neural
differentiation shows the importance of predetermination in neural induction.
Cell 50,749
-758.[CrossRef][Medline]
Shim, S., Bae, N., Park, S. Y., Kim, W. S. and Han, J. K.
(2005). Isolation of Xenopus FGF-8b and comparison with FGF-8a.
Mol. Cell 19,310
-317.
Sive, H. L., Grainger, R. M. and Harland, R. M.
(2000). Early Development of Xenopus laevis:
A Laboratory Manual. New York: Cold Spring Harbor Laboratory
Press.
Slack, J. M., Darlington, B. G., Heath, J. K. and Godsave, S.
F. (1987). Mesoderm induction in early Xenopus embryos by
heparin-binding growth factors. Nature
326,197
-200.[CrossRef][Medline]
Slack, J. M., Darlington, B. G., Gillespie, L. L., Godsave, S.
F., Isaacs, H. V. and Paterno, G. D. (1990). Mesoderm
induction by fibroblast growth factor in early Xenopus development.
Philos. Trans. R. Soc. Lond. B Biol. Sci.
327, 75-84.[Medline]
Smith, A., Robinson, V., Patel, K. and Wilkinson, D. G.
(1997). The EphA4 and EphB1 receptor tyrosine kinases and
ephrin-B2 ligand regulate targeted migration of branchial neural crest cells.
Curr. Biol. 7,561
-570.[CrossRef][Medline]
Smith, J. C., Price, B. M., Green, J. B., Weigel, D. and
Herrmann, B. G. (1991). Expression of a Xenopus homolog of
Brachyury (T) is an immediate-early response to mesoderm induction.
Cell 67,79
-87.[CrossRef][Medline]
Stamm, S., Ben-Ari, S., Rafalska, I., Tang, Y., Zhang, Z.,
Toiber, D., Thanaraj, T. A. and Soreq, H. (2005). Function of
alternative splicing. Gene
344, 1-20.[CrossRef][Medline]
Storey, K. G., Goriely, A., Sargent, C. M., Brown, J. M., Burns,
H. D., Abud, H. M. and Heath, J. K. (1998). Early posterior
neural tissue is induced by FGF in the chick embryo.
Development 125,473
-484.[Abstract]
Sun, X., Meyers, E. N., Lewandoski, M. and Martin, G. R.
(1999). Targeted disruption of Fgf8 causes failure of cell
migration in the gastrulating mouse embryo. Genes Dev.
13,1834
-1846.
Turner, D. L. and Weintraub, H. (1994).
Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal
cells to a neural fate. Genes Dev.
8,1434
-1447.
Wilson, P. A. and Melton, D. A. (1994).
Mesodermal patterning by an inducer gradient depends on secondary cell-cell
communication. Curr. Biol.
4, 676-686.[CrossRef][Medline]
Xu, R. H., Kim, J., Taira, M., Sredni, D. and Kung, H.
(1997). Studies on the role of fibroblast growth factor signaling
in neurogenesis using conjugated/aged animal caps and dorsal ectoderm-grafted
embryos. J. Neurosci.
17,6892
-6898.
This article has been cited by other articles:
![]() |
A. Klingseisen, I. B. N. Clark, T. Gryzik, and H.-A. J. Muller Differential and overlapping functions of two closely related Drosophila FGF8-like growth factors in mesoderm development Development, July 15, 2009; 136(14): 2393 - 2402. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Seo, A. Suenaga, M. Hatakeyama, M. Taiji, and A. Imamoto Structural and Functional Basis of a Role for CRKL in a Fibroblast Growth Factor 8-Induced Feed-Forward Loop Mol. Cell. Biol., June 1, 2009; 29(11): 3076 - 3087. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Hong, B.-Y. Park, and J.-P. Saint-Jeannet Fgf8a induces neural crest indirectly through the activation of Wnt8 in the paraxial mesoderm Development, December 1, 2008; 135(23): 3903 - 3910. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao, K. Tanegashima, H. Ro, and I. B. Dawid Lrig3 regulates neural crest formation in Xenopus by modulating Fgf and Wnt signaling pathways Development, April 1, 2008; 135(7): 1283 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Chang and R. M. Harland Neural induction requires continued suppression of both Smad1 and Smad2 signals during gastrulation Development, November 1, 2007; 134(21): 3861 - 3872. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Guo and J. Y. H. Li Distinct functions of the major Fgf8 spliceform, Fgf8b, before and during mouse gastrulation Development, June 15, 2007; 134(12): 2251 - 2260. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-S. Hong and J.-P. Saint-Jeannet The Activity of Pax3 and Zic1 Regulates Three Distinct Cell Fates at the Neural Plate Border Mol. Biol. Cell, June 1, 2007; 18(6): 2192 - 2202. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||