|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 29 March 2006
doi: 10.1242/dev.02327
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
University of Dundee, MSI/WTB Complex, Dow Street, Dundee DD1 5EH, UK.
* Author for correspondence (e-mail: j.g.williams{at}dundee.ac.uk)
Accepted 16 February 2006
| SUMMARY |
|---|
|
|
|---|
Key words: DIF-1, Dictyostelium, Prestalk cells, SHAQKY family, MYB transcription factor
| INTRODUCTION |
|---|
|
|
|---|
Developing cells aggregate together and organise themselves into a fruiting
body. Midway through development, approximately one-fifth of the cells in each
aggregate differentiate as prestalk cells, while the remainder differentiate
as prespore cells. There are two principal sub-classes of prestalk cells, pstA
cells and pstO cells (Early et al.,
1993
; Jermyn et al.,
1989
). PstA cells occupy the front half of the prestalk region,
pstO cells occupy the rear half. The pstO-specific and pstA-specific reporter
constructs, normally used to identify these two cell types, derive from the
promoter of the ecmA gene
(Williams et al., 1987
;
Early et al., 1993
). PstO cells
use cap-site distal sequences of the promoter (the ecmO region,
Fig. 1), while pstA cells use
cap-site proximal sequences (the ecmA region).
The best-characterised inducer of cell-type divergence is the chlorinated
hexaphenone DIF-1 (Kay and Jermyn,
1983
; Morris et al.,
1987
). In monolayer assay, DIF-1 induces prestalk and stalk cell
differentiation at the expense of prespore differentiation
(Early and Williams, 1988
;
Kopachik et al., 1985
;
Town et al., 1976
;
Williams et al., 1987
). DIF-1
is produced by the prespore cells as part of a negative-feedback loop that
regulates the pstO to prespore cell ratio
(Kay and Thompson, 2001
).
The ecmA gene is directly induced by DIF-1
(Williams et al., 1987
) and in
the dmtA strain, a mutant that is defective in DIF-1 biosynthesis, the
pstA-specific marker (ecmA:lacZ) is expressed but the pstO-specific
marker (ecmO:lacZ) is not
(Thompson and Kay, 2000
).
These facts suggest that DIF-1 is the physiological inducer of pstO cell
differentiation but not of pstA cell differentiation. The situation is,
however, complicated by the fact that some pstO markers are expressed in
dmtA slugs (Maeda et al.,
2003
).
The dimA and dimB genes both encode bZIP transcription
factors that are required for DIF-1 responsiveness
(Thompson et al., 2004
;
Huang et al., 2006
;
Zhukovskaya et al., 2006
).
DimB binds to the ecmA promoter when DIF-1 is added to cells but the two known
DimB-binding sites lie outwith the characterised pstO-specific region
(Zhukovskaya et al., 2006
).
Previous mutational analyses of the ecmA promoter identified a
132-nucleotide sub-segment (Fig.
1) that directs pstO-specific gene expression
(Early et al., 1993
;
Kawata et al., 1996
). When a
G-box, a non-cell-type-specific promoter element (reviewed by
Schnitzler et al., 1994
), was
fused to the multimerised form of a distal sub-region of the 132-mer
expression was weakly DIF-inducible. Prestalk-specific gene expression and
DIF-inducibility were both abolished when the TTGA repeats, within the distal
domain, were subjected to point mutation.
The TTGA repeats bind in vitro to the Dictyostelium STAT protein
Dd-STATa (Kawata et al., 1997
)
but Dd-STATa is not the in vivo activator
(Mohanty et al., 1999
;
Araki et al., 1998
). There is a
DIF-regulated STAT, Dd-STATc, but it also is not required for pstO cell
differentiation (Fukuzawa et al.,
2001
). Thus, identification of the TTGA repeats in the ecmO
promoter region led, circuitously, to the identification of the DIF-1:Dd-STATc
pathway. However, identifying the inductive pathway that is responsible for
pstO cell differentiation remains key to understanding Dictyostelium
pattern formation. We have therefore analysed the pstO-specific region of the
ecmA promoter further and present evidence that it is regulated by a
novel MYB protein.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DIF induction assay
Transformants, bearing lacZ constructs and selected at a G418
concentration of 10 µg/ml, were harvested from growth, washed and
resuspended in stalk medium [10 mM KCl, 2 mM NaCl, 1 mM CaCl2, 10
mM MES (pH 6.2)] containing 5 mM cAMP and 50 µM cerulenin, with or without
100 nM DIF. The polyketide synthesis inhibitor, cerulenin, acts as an
inhibitor of endogenous DIF-1 synthesis and use of a low G418 concentration
was found to be necessary to prevent a high background level of lacZ
expression in the parental control. In some experiments, cells were
pre-incubated for 1 hour before addition of cAMP; similar results were
obtained with both procedures.
Cell suspension was added into the wells of a 96-well tissue culture plate and incubated overnight at 22°C. Cells were lysed in 100 µl buffer [100 mM HEPES (pH 8.0), 1 mM MgSO4, 5 mM DTT, 2% Triton X-100] containing 1 mM CPRG (Roche). The plate was incubated at 37°C until the colour developed. The ß-galactosidase activity was measured at 595 nm. Averages and standard deviations were calculated from multiple biological experiments, where each assay condition was analysed in duplicate or in some cases quadruplicate.
DIF induction assays and analysis of ecmA gene expression by RT-PCR
Cells were harvested from growth, washed and plated at densities varying
between 104 and 105 cells/cm2 in stalk medium
[10 mM KCl, 2 mM NaCl, 1 mM CaCl2, 10 mM MES (pH 6.2)] and
incubated at 22°C for 1 hour. The medium was changed to stalk salts,
cerulenin, at concentrations between 50 µM and 150 µM, and 5 mM camp,
then incubated for a further 6 hours. Then the medium was removed and replaced
with stalk medium, the same concentration of cerulenin
(Kay, 1998
) and concentrations
of DIF-1 up to 100 nM. The plates were incubated at 22°C for 16 hours and
RNA was extracted using an RNeasy kit (Qiagen) and analysed by RT-PCR using a
`TITANIUM' One-Step RT-PCR kit (BD Biosciences). The ecmA primers
are: forward, CCAATTAGCTGTCCAAAACC; reverse, GCAATCACCTTTACCTCCTG. They
generate a 480 nucleotide fragment; IG7, a constitutively expressed mRNA, was
used as control.
Nuclear extract preparation and gel retardation assay
Nuclear extracts were prepared from slug stage cells and gel retardation
assays performed as previously (Kawata et
al., 1996
). The probe was made by annealing complementary
oligonucleotides with BamHI cohesive ends, derived from the 30-mer
sequence (Fig. 2A)
(gatccTTTATTTAAACAGTTACACCCCACAATTTTg), followed by labelling with
[
-32P] dATP. The CP2 wild-type and mutant oligonucleotides,
that were used as G-box/CAE competitors, were: parental,
gatccCGGGTGTGTTAAGTTAGGGGTGGGTTTTATAg; mutant,
gatccCGGGTGTGTTAAGTTAGGGcTcGGTTTTATAg.
Protein purification and mass spectrometry
Nuclear extract derived from 3.5x1011 slug cells was
partially purified by precipitation with 40% (w/v) ammonium sulfate, followed
by heparin sepharose chromatography. It was then loaded onto a DNA affinity
column bearing an oligonucleotide corresponding to the 22-mer. This was
synthesized as a duplicate copy, annealed with the complementary strand,
multimerized by ligation and coupled to sepharose beads. Bound proteins were
eluted with 0.4 M KCl. The eluted proteins were further purified through a
second round of binding on the affinity column, concentrated and loaded onto
an SDS-polyacrylamide gel. After staining with Colloidal Blue Staining Kit
(Invitrogen), protein bands were excised from the gel and digested, in-gel,
with trypsin. The resulting peptides were analysed by MALDI-TOF
(Matrix-Assisted Laser Desorption/Ionisation) mass spectrometry.
Antibody generation
A rabbit polyclonal antibody was generated and affinity purified, using the
C-terminal 15 amino acids of MybE as immunogen. The antibody recognizes MybE
but it also detects unrelated proteins. Therefore, it was useful only for
western transfer analysis.
Gene disruption
A ClaI fragment of 2.3 kb containing most of the mybE-coding
region was cloned into pGEM7 (Promega) and a hygromycin resistance cassette
was inserted between two BalII sites, located at nt+574 and nt+2079
relative to the ATG initiation codon. Transformants were isolated clonally and
screened for gene disruption by PCR and western blotting.
Expression of a MybE protein fragment in E. coli
The region of mybE-encoding the MYB domain (amino acids 487-818)
was cloned in pGEX 5X-1 (Pharmacia). It was expressed in E. coli
strain BL21 Codonplus RIL (Stratagene), as a GST-fusion protein, and purified
using glutathione-sepharose (Amersham).
| RESULTS |
|---|
|
|
|---|
Cap-site proximal elements within the minimal ecmO region are necessary and sufficient for prestalk-specific gene expression
The cap-site distal half of the 62-mer is composed of runs of T residues,
interspersed with a few A residues (Fig.
2A). Deletion of this region, to yield a 30-mer construct,
eliminates biological activity (Fig.
2A). Multimerising a small promoter element sometimes allows it to
function in a sequence context where a single copy of the element is
ineffective (Kawata et al.,
1996
; Powell-Coffman et al.,
1994
). Therefore, we analysed constructs containing a multimer
fused to heterologous basal promoter elements. The multimerised element
contains the central 22 nucleotides of the 30-mer
(Fig. 3A). The fourfold
multimer of the 22-mer (Fig.
3A) directs strong, generic (i.e. pstA, pstO and ALCs)
prestalk-specific gene expression (Fig.
3B).
|
|
The 22-mer sequence is both necessary and sufficient for DIF-1 inducibility
Cells transformed with the lacZ constructs described above were
tested for DIF-1 inducibility in a monolayer assay. The 94-mer construct
displays a twofold increase in expression in the presence of DIF-1
(Fig. 2B). This is a lower
induction ratio than with longer fragments and presumably reflects the absence
of elements needed for high expression. Nonetheless, it is reproducible and
the 62-mer and 30-mer constructs show no significant increase in activity with
DIF-1 (Fig. 2B). Point
mutations in either the dyad element or the C-rich sequence eliminate DIF-1
inducibility of the 94-mer construct (Fig.
4B). Moreover, when multimerised, the sequences contained within
the 22-mer are sufficient to direct strong DIF-1 inducible gene expression
(Fig. 3C).
|
Identification of MybE as the predominant 22-mer binding protein
When the 30-mer (employed in preference to the 22-mer for technical reasons
related to the stability of short AT-rich duplexes) is used as a probe in gel
retardation with nuclear extracts prepared from slug cells, one major retarded
complex and two minor complexes are observed (respectively marked with an
arrow and arrowheads in Fig.
5A). Unlabelled 30-mer, used as a competitor, inhibits formation
of the major complex but the minor complexes are relatively unaffected.
Variants of the 30-mer, containing the point mutations analysed in the
biological experiments described above
(Fig. 4A,B), are ineffective as
competitors for the major complex (Fig.
5A). Hence, it is a specific complex.
In order to identify interacting protein(s), a slug nuclear extract was twice purified on a multimerised 22-mer affinity column (Fig. 5B). The final eluate contains many protein species and the 10 most abundant of these were identified by mass spectrometry (Fig. 5B; data not shown). Many are predicted to be RNA-binding proteins, presumably sticking non-specifically to the affinity column, but the two highest molecular weight species are MYB family members.
MYB transcription factors contain one to three copies (termed R1 to 3) of a
highly characteristic DNA-binding domain (reviewed in
Lipsick, 1996
). These are
typically just over 50 amino acids in length. Each forms a helix-turn-helix in
solution and R2 and R3 intercalate into the major groove of DNA
(Ogata et al., 1994
). There
are three previously characterised Dictyostelium MYBs, all containing
three MYB domains (Stober-Grasser et al.,
1992
; Otsuka and van Haastert,
1998
; Guo et al.,
1999
). We have therefore named the two new MYB proteins MybD and
MybE, and the genes that encode them mybD and mybE
(annotated as DDB0220512 and DDB0216342 in
http://dictybase.org/).
In all of the extracts analysed, MybE was the strongest staining species on the final preparative gel (e.g. Fig. 5B). MybD was present at a lower apparent abundance and in one preparation it was not detectable. It seemed probable, therefore, that the binding of MybD to the 22-mer was in some way artefactual. This led us to concentrate further effort on MybE.
Although most MYB proteins contain two or three MYB domains a large number
of plant MYB transcription factors contain only one MYB domain (reviewed by
Jin and Martin, 1999
). Apart
from the presence of one MYB domain, the principal difference between these
and orthodox MYB domains is that the amino acids surrounding and including the
third of the regularly spaced tryptophan residues, which characterize
canonical MYB domains, is replaced by the consensus sequence SH[AL]QKY[RF].
They are therefore sometimes termed the `SHAQKY' family (InterPro Accession
Number IPR006447).
An alignment of MybE with several members of the plant family is presented in Fig. 6A. The presence of the sequence SHGQY, at a precisely analogous position to the SHAQKY consensus in the plant MYBs, confirms both MybE and MybD as members of the SHAQKY family. Analysis of the genome sequence reveals five additional members of the family in Dictyostelium but one of them, MybH, contains both a SHAQKY class Myb domain and an orthodox Myb domain (Fig. 6B).
|
|
This was first analysed using a prototypic G box, from the promoter of the
cprB gene (Hjorth et al.,
1988
; Pears et al.,
1985
; Pears and Williams,
1987
), as competitor in a band shift assay
(Fig. 5A). The cprB G
box is not an effective competitor against the 30-mer probe.
We also generated a recombinant protein in E. coli, comprising the approximate C terminal half of MybE and encompassing the entire MYB domain, and studied its binding to the 30-mer. The E. coli-derived protein binds to the 30-mer and comparative competition experiments, using the dyad and the C-rich region separately, were performed (Fig. 7). Because they are very short elements, each was synthesised in two copies as a direct repeat. A similarly duplicated version of the 30-mer was used as a control. The duplicated 30-mer competes very efficiently but the duplicated C-rich region and the duplicated dyad both fail to compete (Fig. 7). Additionally, all three point mutations within the 30-mer (Fig. 5A), two of which alter the C-rich region, render it ineffective as a competitor (Fig. 7). In combination, these data indicate that the C-rich region is as essential for binding to MybE as the dyad element.
|
A mybE-null strain was generated, by replacing most of the coding region sequence with a hygromycin resistance cassette. A large number of randomly selected clones were analysed by PCR and apparent disruptants were subjected to western transfer analysis using a polyclonal antibody directed against a C terminal peptide of MybE. It detects a protein of approximately 100 kDa, the size expected for MybE (Fig. 8B).
One of the strains analysed, the mybE strain, did not detectably
express mybE. This strain grew and developed poorly when first
isolated but after a period in culture it grew and developed well. MybE
and control strains were co-transformed with ecmAO:lacZ, a generic prestalk
marker, and also with pspA:gus. The latter construct contains the promoter of
pspA, a gene that encodes a prespore protein, coupled to
ß-glucoronidase. Sequential staining with a ß-glucoronidase
chromogen, X-gluc, and with the ß-galactosidase substrate salmon-gal
yields a red prestalk region and a blue prespore region
(Early et al., 1993
).
|
Analysis of slugs stained for ß-galactosidase alone allows better visualisation of the prestalk sub-populations. MybE slugs show strong ecmAO:lacZ expression in the very front of the slug, with only a few scattered staining cells in what would normally be the pstO region (Fig. 9B). The heavily stained, anterior region corresponds to the pstA region of a normal slug. In such slugs, stained for ß-galactosidase alone, the ALCs are much more easily visualised and, remarkably, there are almost no stained ALCs in the null strain (Fig. 9B).
|
|
MybE is essential for normal expression in the major prestalk cell sub-types
Differentiation of the prestalk cell sub-types in the null strain was
further investigated using additional reporter constructs.
MybE is essential for DIF-1 inducible expression of ecmA
Parental and mybE mutant cells expressing either the
ecmAO:lacZ or the 4x22:lacZ construct were induced
with DIF-1 in monolayer assay and lacZ activity was assayed. There is
strong induction for both constructs in the parental cells but the two fusion
constructs are not induced in the mybE strain
(Fig. 11A). For
ecmAO:lacZ, this result was confirmed at the RNA level; by inducing
cells with several concentrations of DIF-1 and monitoring lacZ
expression using RT-PCR (Fig.
11B). Using the same RNA samples but with ecmA primers, RT-PCR was
used to show that the endogenous ecmA gene is, as expected, also non
DIF-1 inducible in the mybE strain
(Fig. 11B).
|
| DISCUSSION |
|---|
|
|
|---|
A dyad within the 22-mer fits the MYB-binding site consensus and is almost
identical to a sequence element identified within a subregion of the G6P
isomerase promoter that directs prestalk-specific expression. Point mutational
analysis showed that this sequence is necessary for prestalk-specific
expression but the element was not further characterised
(Tabata et al., 2001
). As
would have been predicted from the sequence of the dyad, the multimerised
22-mer binds in vitro to a MYB protein: MybE.
There is also an essential, C-rich region located downstream of the dyad.
There are examples of DNA-binding sites for MYB proteins that extend
downstream of the conserved region (e.g.
Howe et al., 1991
) and the
C-rich region in the 22-mer is located very close to the dyad. Hence, it may
form part of an extended binding site for MybE.
Similarities between the mybE- strain and other Dictyostelium mutants
The mybE strain initially grew and developed poorly but, after a
period in culture, growth and development improved. It is unclear whether the
improvement in development was simply the result of higher cell viability or
whether secondary mutations acquired during the adaption process suppressed
developmental defects. Therefore, the developmental phenotype we describe must
be regarded as a minimal phenotype. However, this phenotype fits a pattern;
because there are strong similarities between the mybE strain and known
mutants in DIF-1 signalling.
The morphological phenotype of the mybE strain is very similar to
that of the dimA and dimB, DIF response, and dmtA, DIF
biosynthesis, mutants (Thompson et al.,
2004
; Thompson and Kay,
2000
; Huang et al.,
2006
; Zhukovskaya et al.,
2006
); all form long thin slugs that frequently split into
fragments. The other, striking similarity between the dmtA, dimA
and mybE strains is that all three are selectively defective in the
expression of ecmAO:lacZ and ecmO:lacZ in pstO cells [the
situation with DimB is unclear because it showed such a difference in an Ax3
background (Huang et al.,
2006
) but not in an AX2 background
(Zhukovskaya et al., 2006
)].
It will be of interest to determine the signalling relationships between MybE
and the DimA and DimB proteins.
Other proportioning mutants also display a change in the extent of the pstO
region while retaining a normally sized pstA zone
(Han and Firtel, 1998
;
Chung et al., 1998
;
Nelson et al., 2000
;
Ennis et al., 2000
). However,
the mybE strain has a more severe defect than any of these strains. It
raises the question of whether the mybE-mutant has: (1) a pstO region with no
ecmA gene expression but otherwise normal patterning; (2) a pstO
region with no expression of ecmA and altered expression patterns of
other prestalk-specific genes, or (3) no pstO region. In order to distinguish
between these possibilities it will be necessary to analyse additional pstO
markers (Maeda, 2003
).
MybE is required for the normal differentiation of ALCs
A notable feature of the mybE null, not to our knowledge
previously described for any other mutant, is the virtual absence of ALCs that
express ecmA promoter-derived markers. The fact that ecmA
expression in both pstO and ALCs is greatly reduced is of interest because
prior studies suggest a close link between the ALCs and the pstO cells;
pstO-specific constructs, derived from the ecmA promoter, are also
expressed in ALCs and the two populations continually interchange position
within the slug (Early et al.,
1993
; Abe et al.,
1994
). There are ALCs in the mybE slugs, as detected by
neutral red staining (J.G.W., unpublished). However, the ALCs population is
composed of multiple prestalk subtypes
(Jermyn and Williams, 1991
;
Jermyn et al., 1996
) and the
neutral red-positive cells in the mutant are presumably one or more of the
non-ecmA-expressing subtypes.
|
All these facts are best explained if MybE directly mediates the induction
of ecmA gene expression by DIF-1. If so, MybE could be activated in
some way by DIF-1 or, alternatively, it could be a constitutive component of
the transcriptional complex. Precedent gives no clear guidance on these
possibilities because there is no canonical pathway of MYB protein activation.
There are several examples of phosphorylation of MYB proteins, but
modification is effected by diverse kinases and no general mechanism of
regulation has emerged (Winn et al.,
2003
; Kanei-Ishii et al.,
2004
; Oelgeschlager et al.,
1995
; Ramsay et al.,
1995
; Leverson et al.,
1998
; Andersson et al.,
2003
; Sugano et al.,
1998
).
Interestingly, however, there are precedents for SHAQKY proteins mediating
induction by a diffusible molecules; the PHR1 protein of Arabidopsis
activates gene expression in response to phosphate deprivation
(Rubio et al., 2001
) and the
three OsMYBS proteins of rice mediate gibberelin and sugar regulation of
-amylase gene expression (Lu et
al., 2002
). Unusually for Myb proteins, PHR1 functions as a dimer
(Rubio et al., 2001
) and yeast
two-hybrid analysis shows that MybE also forms homodimers (M.F. and J.G.W.,
unpublished data). Given these similarities, it will be of interest to
determine whether DIF-1 and MybE form part of a pathway that resembles a plant
signalling pathway.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, T., Early, A., Siegert, F., Weijer, C. and Williams, J. G. (1994). Patterns of cell movement within the Dictyostelium slug revealed by cell type-specific, surface labeling of living cells. Cell 77,687 -699.[CrossRef][Medline]
Andersson, K. B., Kowenz-Leutz, E., Brendeford, E. M., Tygsett,
A. H., Leutz, A. and Gabrielsen, O. S. (2003).
Phosphorylation-dependent down-regulation of c-Myb DNA binding is abrogated by
a point mutation in the v-myb oncogene. J. Biol. Chem.
278,3816
-3824.
Araki, T., Gamper, M., Early, A., Fukuzawa, M., Abe, T., Kawata, T., Kim, E., Firtel, R. A. and Williams, J. G. (1998). Developmentally and spatially regulated activation of a Dictyostelium STAT protein by a serpentine receptor. EMBO J. 17,4018 -4028.[CrossRef][Medline]
Chung, C. Y., Reddy, T. B. K., Zhou, K. M. and Firtel, R. A.
(1998). A novel, putative MEK kinase controls developmental
timing and spatial patterning in Dictyostelium and is regulated by
ubiquitin-mediated protein degradation. Genes Dev.
12,3564
-3578.
Dingermann, T., Reindl, N., Werner, H., Hildebrandt, M., Nellen, W., Harwood, A., Williams, J. and Nerke, K. (1989). Optimization and in situ detection of Escherichia coli beta-galactosidase gene expression in Dictyostelium discoideum.Gene 85,353 -362.[CrossRef][Medline]
Early, A. E. and Williams, J. G. (1988). A Dictyostelium prespore-specific gene is transcriptionally repressed by DIF in vitro. Development 103,519 -524.[Abstract]
Early, A. E., Gaskell, M. J., Traynor, D. and Williams, J. G. (1993). Two distinct populations of prestalk cells within the tip of the migratory Dictyostelium slug with differing fates at culmination. Development 118,353 -362.[Abstract]
Ennis, H. L., Dao, D. N., Pukatzki, S. U. and Kessin, R. H.
(2000). Dictyostelium amoebae lacking an F-box protein
form spores rather than stalk in chimeras with wild type. Proc.
Natl. Acad. Sci. USA 97,3292
-3297.
Fukuzawa, M., Araki, T., Adrian, I. and Williams, J. G. (2001). Tyrosine phosphorylation-independent nuclear translocation of a Dictyostelium STAT in response to DIF signaling. Mol. Cell 7,779 -788.[CrossRef][Medline]
Guo, K., Anjard, C., Harwood, A., Kim, H. J., Newell, P. C. and Gross, J. D. (1999). A myb-related protein required for culmination in Dictyostelium. Development 126,2813 -2822.[Abstract]
Han, Z. and Firtel, R. A. (1998). The homeobox-containing gene Wariai regulates anterior-posterior patterning and cell-type homeostasis in Dictyostelium. Development 125,313 -325.[Abstract]
Hjorth, A., Datta, S., Khanna, N. C. and Firtel, R. A. (1988). Analysis of cis and trans elements involved in cAMP-inducible gene expression in Dictyostelium discoideum. Dev. Genet. 9,435 -454.[CrossRef][Medline]
Howe, K. M., Watson, R. J., Reakes, C. F., McMahon, J., Garcia,
A., LaMontagne, K., Reavis, D., Stober-Grasser, U. and Lipsick, J. S.
(1991). Nucleotide preferences in sequence-specific recognition
of DNA by c-myb protein. Nucleic Acids Res.
19,3913
-3919.
Huang, E., Blagg, S. L., Keller, T., Katoh, M., Shaulsky, G. and
Thompson, C. (2006). bZIP transcription factor interactions
regulate DIF responses in Dictyostelium. Development
133,449
-458.
Jermyn, K. A. and Williams, J. G. (1991). An analysis of culmination in Dictyostelium using prestalk and stalk-specific cell autonomous markers. Development 111,779 -787.[Abstract]
Jermyn, K. A., Duffy, K. T. and Williams, J. G. (1989). A new anatomy of the prestalk zone in Dictyostelium.Nature 340,144 -146.[CrossRef][Medline]
Jermyn, K. A., Traynor, D. and Williams, J. G. (1996). The initiation of basal disc formation in Dictyostelium discoideum is an early event in culmination. Development 122,753 -760.[Abstract]
Jin, H. and Martin, C. (1999). Multifunctionality and diversity within the plant MYB-gene family. Plant Mol. Biol. 41,577 -585.[CrossRef][Medline]
Kanei-Ishii, C., Ninomiya-Tsuji, J., Tanikawa, J., Nomura, T.,
Ishitani, T., Kishida, S., Kokura, K., Kurahashi, T., Ichikawa-Iwata, E., Kim,
Y. et al. (2004). Wnt-1 signal induces phosphorylation and
degradation of c-Myb protein via TAK1, HIPK2, and NLK. Genes
Dev. 18,816
-829.
Kawata, T., Early, A. and Williams, J. G. (1996). Evidence that a combined activator-repressor protein regulates Dictyostelium stalk cell differentiation. EMBO J. 15,3085 -3092.[Medline]
Kawata, T., Shevchenko, A., Fukuzawa, M., Jermyn, K., Totty, N. F., Zhukovskaya, N. V., Sterling, A. E., Mann, M. and Williams, J. G. (1997). SH2 signaling in a lower eukaryote: a STAT protein that regulates stalk cell differentiation in Dictyostelium.Cell 89,909 -916.[CrossRef][Medline]
Kay, R. R. (1998). The biosynthesis of
differentiation-inducing factor, a chlorinated signal molecule regulating
Dictyostelium development. J. Biol. Chem.
273,2669
-2675.
Kay, R. R. and Jermyn, K. A. (1983). A possible morphogen controlling differentiation in Dictyostelium.Nature 303,242 -244.[CrossRef][Medline]
Kay, R. R. and Thompson, C. R. L. (2001). Cross-induction of cell types in Dictyostelium: evidence that DIF-1 is made by prespore cells. Development 128,4959 -4966.[Medline]
Kessin, R. H. (2001). Dictyostelium.Evolution, Cell Biology, and the Development of Multicellularity. Cambridge: Cambridge University Press.
Kopachik, W. J., Dhokia, B. and Kay, R. R. (1985). Selective induction of stalk-cell-specific proteins in Dictyostelium. Differentiation 28,209 -216.[CrossRef][Medline]
Leverson, J. D., Koskinen, P. J., Orrico, F. C., Rainio, E. M., Jalkanen, K. J., Dash, A. B., Eisenman, R. N. and Ness, S. A. (1998). Pim-1 kinase and p100 cooperate to enhance c-Myb activity. Mol. Cell 4,417 -425.
Lipsick, J. S. (1996). One billion years of Myb. Oncogene 13,223 -235.[Medline]
Lu, C. A., Ho, T. H., Ho, S. L. and Yu, S. M.
(2002). Three novel MYB proteins with one DNA binding repeat
mediate sugar and hormone regulation of alpha-amylase gene expression.
Plant Cell 14,1963
-1980.
Maeda, M., Sakamoto, H., Iranfar, N., Fuller, D., Maruo, T.,
Ogihara, S., Morio, T., Urushihara, H., Tanaka, Y. and Loomis, W. F.
(2003). Changing patterns of gene expression in
Dictyostelium prestalk cell subtypes recognized by in situ
hybridization with genes from microarray analyses. Eukaryot.
Cell 2,627
-637.
Mohanty, S., Jermyn, K. A., Early, A., Kawata, T., Aubry, L., Ceccarelli, A., Schaap, P., Williams, J. G. and Firtel, R. A. (1999). Evidence that the Dictyostelium Dd-STATa protein is a repressor that regulates commitment to stalk cell differentiation and is also required for efficient chemotaxis. Development 126,3391 -3405.[Abstract]
Morris, H. R., Taylor, G. W., Masento, M. S., Jermyn, K. A. and Kay, R. R. (1987). Chemical structure of the morphogen differentiation inducing factor from Dictyostelium discoideum.Nature 328,811 -814.[CrossRef][Medline]
Nelson, M. K., Clark, A., Abe, T., Nomura, A., Yadava, N., Funair, C. J., Jermyn, K. A., Mohanty, S., Firtel, R. A. and Williams, J. G. (2000). An F-Box/WD40 repeat-containing protein important for Dictyostelium cell-type proportioning, slug behaviour, and culmination. Dev. Biol. 224, 42-59.[CrossRef][Medline]
Oelgeschlager, M., Krieg, J., Luscher-Firzlaff, J. M. and Luscher, B. (1995). Casein kinase II phosphorylation site mutations in c-Myb affect DNA binding and transcriptional cooperativity with NF-M. Mol. Cell. Biol. 15,5966 -5974.[Abstract]
Ogata, K., Morikawa, S., Nakamura, H., Sekikawa, A., Inoue, T., Kanai, H., Sarai, A., Ishii, S. and Nishimura, Y. (1994). Solution structure of a specific DNA complex of the Myb DNA-binding domain with cooperative recognition helices. Cell 79,639 -648.[CrossRef][Medline]
Otsuka, H. and van Haastert, P. J. M. (1998). A
novel Myb homolog initiates Dictyostelium development by induction of
adenylyl cyclase expression. Genes Dev.
12,1738
-1748.
Pang, K. M., Lynes, M. A. and Knecht, D. A. (1999). Variables controlling the expression level of exogenous genes in Dictyostelium. Plasmid 41,187 -197.[CrossRef][Medline]
Pears, C. J. and Williams, J. G. (1987). Identification of a DNA sequence element required for efficient expression of a developmentally regulated and cAMP-inducible gene of Dictyostelium discoideum. EMBO J. 6,195 -200.[Medline]
Pears, C. J., Mahbubani, H. M. and Williams, J. G.
(1985). Characterization of two highly diverged but
developmentally coregulated cysteine proteinases in Dictyostelium
discoideum. Nucleic Acids Res.
13,8853
-8866.
Powell-Coffman, J. A., Schnitzler, G. R. and Firtel, R. A.
(1994). A GBF-binding site and a novel AT element define the
minimal sequences sufficient to direct prespore-specific expression in
Dictyostelium discoideum. Mol. Cell. Biol.
14,5840
-5849.
Ramsay, R. G., Morrice, N., Van Eeden, P., Kanagasundaram, V., Nomura, T., De Blaquiere, J., Ishii, S. and Wettenhall, R. (1995). Regulation of c-Myb through protein phosphorylation and leucine zipper interactions. Oncogene 11,2113 -2120.[Medline]
Rubio, V., Linhares, F., Solano, R., Martín, A. C.,
Iglesias, J., Leyva, A. and Paz-Ares, J. (2001). A conserved
MYB transcription factor involved in phosphate starvation signaling both in
vascular plants and in unicellular algae. Genes Dev.
15,2122
-2133.
Schnitzler, G. R., Fischer, W. H. and Firtel, R. A.
(1994). Cloning and characterization of the G-box binding factor,
an essential component of the developmental switch between early and late
development in Dictyostelium. Genes Dev.
8, 502-514.
Stober-Grasser, U., Brydolf, B., Bin, X., Grasser, F., Firtel, R. A. and Lipsick, J. S. (1992). The myb DNA-binding domain is highly conserved in Dictyostelium discoideum.Oncogene 7,589 -596.[Medline]
Sugano, S., Andronis, C., Green, R. M., Wang, Z. Y. and Tobin,
E. M. (1998). Protein kinase CK2 interacts with and
phosphorylates the Arabidopsis circadian clock-associated 1 protein.
Proc. Natl. Acad. Sci. USA
95,11020
-11025.
Tabata, K., Matsuda, Y., Viller, E., Masamune, Y., Katayama, T. and Yasukawa, H. (2001). Myb-binding site regulates the expression of glucosamine-6-phosphate isomerase in Dictyostelium discoideum. Dev. Growth Differ. 43,583 -589.[Medline]
Thompson, C. R. L. and Kay, R. R. (2000). The role of DIF-1 signaling in Dictyostelium development. Mol. Cell 6,1509 -1514.[CrossRef][Medline]
Thompson, C. R. L., Fu, Q., Buhay, C., Kay, R. R. and Shaulsky,
G. (2004). A bZIP/bRLZ transcription factor required for DIF
signaling in Dictyostelium. Development
131,513
-523.
Town, C. D., Gross, J. D. and Kay, R. R. (1976). Cell differentiation without morphogenesis in Dictyostelium discoideum. Nature 262,717 -719.[CrossRef][Medline]
Watts, D. J. and Ashworth, J. M. (1970). Growth of myxamoebae of the cellular slime mould Dictyostelium discoideum in axenic culture. Biochem. J. 119,171 -174.[Medline]
Williams, J. G., Ceccarelli, A., McRobbie, S., Mahbubani, H., Kay, R. R., Early, A., Berks, M. and Jermyn, K. A. (1987). Direct induction of Dictyostelium prestalk gene expression by DIF provides evidence that DIF is a morphogen. Cell 49,185 -192.[CrossRef][Medline]
Winn, L. M., Lei, W. and Ness, S. A. (2003). Pim-1 phosphorylates the DNA binding domain of c-Myb. Cell Cycle 2,258 -262.[Medline]
Zhukovskaya, N. V., Fukuzawa, M., Yamada, Y., Araki, T. and
Williams, J. G. (2006). Dictyostelium bZIP transcription
factor DimB regulates prestalk-specific gene expression.
Development 133,439
-448.
This article has been cited by other articles:
![]() |
J. Langenick, T. Araki, Y. Yamada, and J. G. Williams A Dictyostelium homologue of the metazoan Cbl proteins regulates STAT signalling J. Cell Sci., November 1, 2008; 121(21): 3524 - 3530. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Keller and C. R. L. Thompson Cell type specificity of a diffusible inducer is determined by a GATA family transcription factor Development, May 1, 2008; 135(9): 1635 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tsujioka, N. Zhukovskaya, Y. Yamada, M. Fukuzawa, S. Ross, and J. G. Williams Dictyostelium Myb Transcription Factors Function at Culmination as Activators of Ancillary Stalk Differentiation Eukaryot. Cell, March 1, 2007; 6(3): 568 - 570. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||