|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 29 March 2006
doi: 10.1242/dev.02347
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department of Pediatrics and Medicine, University of California, San Diego,
9500 Gilman Drive, MC 0627, La Jolla, CA 92093-0627, USA.
2 Department of Cell Biology and Otolaryngology, School of Medicine, Emory
University, 615 Michael Street, Atlanta, GA 30322, USA.
3 Divison of Biology and Beckman Institute, California Institute of Technology,
Pasadena, CA 91125, USA.
4 Department of Neuroscience, University of California, San Diego, 9500 Gilman
Drive, MC 0627, La Jolla, CA 92093-0627, USA.
5 Department of Cell and Molecular Biology, House Ear Institute, 2100 West Third
Street, Los Angeles, CA 90057.
6 Molecular Cell and Developmental Biology & Institute for Cellular and
Molecular Biology, 1 University Station C0930, University of Texas, Austin, TX
78712, USA.
Author for correspondence (e-mail:
awynshawboris{at}ucsd.edu)
Accepted 7 March 2006
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Mouse, Planar cell polarity, Convergent extension, Neurulation
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Keller, 2002;
Mlodzik, 2002;
Myers et al., 2002;
Tree et al., 2002a;
Veeman et al., 2003a;
Wallingford et al., 2002). The
Wnt pathway was first defined in Drosophila, where it is required for
the anteroposterior (AP) polarity of the body segments and cell fate
determination (Cadigan and Nusse,
1997). In Xenopus, the Wnt pathway participates in axis
determination and dorsoventral (DV) patterning
(Cadigan and Nusse, 1997). In
mammals, an expanded pathway has diverse effects on cell proliferation and
patterning during gastrulation and organogenesis
(Huelsken and Birchmeier,
2001; Wang and Wynshaw-Boris,
2004; Yamaguchi,
2001). Similarly, the conserved PCP pathway was first uncovered in
Drosophila, where it regulates the polarity of a cell within the
plane of the epithelium, perpendicular to the apicobasal axis of the cell.
Manifestations of this polarity includes uniformly oriented parallel arrays of
cellular extensions called trichomes on the epithelial cells of the wing and
precisely coordinated orientation of ommatidial units of the compound eye
(Strutt, 2002;
Tree et al., 2002a;
Veeman et al., 2003a). In
Xenopus and zebrafish, an homologous pathway regulates convergent
extension, a coordinated extension of the AP axis with concomitant narrowing
of the mediolateral (ML) axis
(Carreira-Barbosa et al., 2003;
Darken et al., 2002;
Goto and Keller, 2002;
Keller, 2002;
Kinoshita et al., 2003;
Park and Moon, 2002;
Takeuchi et al., 2003;
Veeman et al., 2003b;
Wallingford et al., 2002;
Wallingford et al., 2000).
During convergent extension in these animals, several PCP proteins have been
shown to control the polarity of lamellipodial protrusions that drive cell
intercalation (Jessen et al.,
2002; Wallingford et al.,
2000). In zebrafish, the PCP pathway also appears to regulate
convergent extension, at least in part, through determining the orientation of
cell division (Gong et al.,
2004).
The multifunctional protein Dishevelled (Dsh in fly, XDsh in
Xenopus, and Dvl1, Dvl2 and Dvl3 in mammals) is involved in both the
canonical Wnt signaling pathway as well as the PCP pathway
(Mlodzik, 2002;
Strutt, 2002;
Tree et al., 2002a;
Veeman et al., 2003a;
Wallingford et al., 2002;
Wallingford and Habas, 2005).
In the canonical Wnt pathway, Dsh is important in transmitting a signal
initiated from Wnt binding to its receptor Frizzled and co-receptor
Arrow/Lrp5/6 on the cell surface. As a consequence, the cytoplasmic protein
Armadillo/ß-catenin becomes stabilized and is transported into the
nucleus to activate transcription (He et
al., 2004; Wang and
Wynshaw-Boris, 2004). In the PCP pathway in fly, Dsh participates
with a different set of proteins such as Strabismus (Stbm), Prickle (Pk),
Diego (Dgo) and Flamingo (Fmi) (Das et
al., 2004; Jenny et al.,
2005; Strutt,
2002; Tree et al.,
2002a; Veeman et al.,
2003a). Although the precise mechanisms through which Dsh
determine PCP is not well defined, an asymmetric plasma membrane localization
of Dsh and the other PCP members appears to be both required for and dependent
upon proper establishment of the PCP pathway in the fly
(Axelrod, 2001;
Bastock et al., 2003;
Das et al., 2004;
Jenny et al., 2003;
Jenny et al., 2005;
Rawls and Wolff, 2003;
Strutt et al., 2002;
Strutt, 2002;
Tree et al., 2002a;
Tree et al., 2002b;
Veeman et al., 2003a).
Recent genetic studies have also provided evidence that a putative PCP
pathway exists in mammals (Curtin et al.,
2003; Hamblet et al.,
2002; Kibar et al.,
2001; Montcouquiol et al.,
2003; Murdoch et al.,
2001; Wang et al.,
2005; Wang et al.,
2006). Loop tail (Lp) is a point mutation of
Ltap or Vangl2, a homolog of the fly PCP component
Stbm (Kibar et al.,
2001; Montcouquiol et al.,
2003; Murdoch et al.,
2001), while Crash and Spin cycle (Crsh,
Scy) are distinct mutations of Celsr1, a homolog of the PCP
pathway member fmi (Curtin et
al., 2003). Frizzled 3 (Fzd3) and frizzled 6
(Fzd6) encode two of the Frizzled receptors in mammals
(Wang et al., 2006). Lp,
Crsh, Scy, Fzd3-/-; Fzd6-/- and
Dvl1-/-; Dvl2-/- mutants result in
misorientation of stereocilia of sensory hair cells in the cochlea. The
uniform orientation of the stereocilia on hair cells in the cochlea has been
proposed to be a manifestation of PCP
(Lewis and Davies, 2002).
Indeed, we found that a transgenic Dvl2-EGFP protein capable of rescuing the
stereocilia orientation defects in Dvl1-/-;
Dvl2-/- mutants displayed asymmetric plasma membrane
localization that is disrupted in Lp/Lp embryos
(Wang et al., 2005). Others
reported a similar Vangl2-dependent asymmetric localization of Fzd3
and Fzd6 in the sensory hair cells, utricles and cristae
(Wang et al., 2006),
suggesting a conserved PCP pathway as the underlying mechanism in coordinating
stereocilia orientation. In addition, Lp, Crsh, Scy, Fzd3-/-;
Fzd6-/- and Dvl1-/-; Dvl2-/-
mutants all result in a unique severe neural tube closure defect in which the
entire neural tube from mid-brain to tail fails to close, a congenital defect
termed craniorachischisis in humans
(Curtin et al., 2003;
Hamblet et al., 2002;
Kibar et al., 2001;
Murdoch et al., 2001;
Wang et al., 2006). The cause
of craniorachischisis in these mutants has been inferred to be failure of
convergent extension, because, in Xenopus, overexpression of
wild-type or mutant forms of XDsh and Stbm (which blocks convergent extension)
usually results in similar neural tube closure defects
(Copp et al., 2003;
Darken et al., 2002;
Goto and Keller, 2002;
Ueno and Greene, 2003;
Wallingford and Harland,
2002). However, the developmental mechanisms disrupted by the loss
of conserved mammalian PCP pathway members during neurulation have not been
investigated. There is no experimental evidence that the neural tube defect in
these PCP mutant mice results from convergent extension defects, and if so, it
is not clear how PCP regulates convergent extension in mammals.
In this study, we provide evidence that during neurulation, Dvl1
and Dvl2 are required for concomitant lengthening and narrowing of
neural plate, a morphogenetic process that resembles convergent extension.
Using a Dvl2 BAC transgene expressing a functional Dvl2-EGFP protein,
we found that subcellular Dvl2 localization in neuroepithelium is consistent
with its function in convergent extension. Intriguingly, although Lp
genetically interacts with Dvl genes during neurulation and in cochlea
development, Lp appears to have no effect on Dvl2 localization in the
neuroepithelium, in contrast to its drastic effect on Dvl2 distribution in the
cochlea (Wang et al., 2005).
We found that part of the N-terminal DIX domain, which is essential for Dvl2
function in the Wnt pathway (Capelluto et
al., 2002), was largely dispensable for its function during
neurulation or recruitment to the plasma membrane. By contrast, the C-terminal
DEP domain, which is solely required for Dsh/Dvl function in PCP/convergent
extension in flies and Xenopus
(Axelrod et al., 1998;
Boutros et al., 1998;
Rothbacher et al., 2000;
Wallingford and Harland, 2001;
Wallingford et al., 2000), was
essential for Dvl2 function in neurulation and for plasma membrane
localization. To further test whether we can genetically distinguish PCP and
convergent extension, we produced a Dvl2 BAC transgene carrying a
point mutation identical to the dsh1 allele in fly, which
specifically abolishes the PCP pathway. Our analysis of the mutant transgene
suggests stringent conservation of Dvl function in convergent extension and
PCP.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Generating Dvl2-EGFP and mutant 
DIX-EGFP, DEP-EGFP and dsh1-EGFP BAC transgenes
A BAC clone containing the Dvl2 genomic sequence, derived from a
PCR screen of a BAC library from Genome Systems, was characterized for genomic
integrity and potential rearrangement by using 11 overlapping PCR reactions
that covered the entire Dvl2 genomic region. The existence of at
least two flanking genes on the 3' and 5' ends were confirmed by
designing specific PCR primers based on the sequence information in the mouse
genome database. Modifications of the BAC, including insertion of two LoxP
sites and EGFP-coding sequence in-frame to the last codon of Dvl2
were performed as described (Lee et al.,
2001). Dvl2-EGFP1 had an EGFP cassette fused in-frame to
the last codon of Dvl2 and a LoxP site inserted into intron 2 for
genotyping purpose (see Mouse strains and genotyping), whereas
Dvl2-EGFP2 contained an additional LoxP site inserted in the 3'
flanking gene Acadvl (acyl-Coenzyme A dehydrogenase, very long
chain). Using BAC recombineering techniques, DIX-EGFP and
DEP-EGFP deletion mutant transgenes were generated by removing
sequence encoding amino acids 67-159 and amino acids 442 to 736, respectively.
dsh1-EGFP point mutation was generated by replacing AAG with ATG to
introduce a K to M substitution at amino acid 446. Modified BACs were purified
and pronuclear injection was performed as described to create transgenic mice
(Lee et al., 2001).
Mouse strains and genotyping
Mice carrying Lp mutation was obtained from the Jackson Laboratory
(Bar Harbor, ME) and genotyped as described
(Murdoch et al., 2001).
Genotyping of the targeted Dvl1 and Dvl2 alleles was
performed as described (Hamblet et al.,
2002). To differentiate the Dvl2-EGFP BAC transgene from
the endogenous wild-type Dvl2, a pair of primers flanking intron 2
were used (E2F, TGCTTCAATGGAAGGGTTGTC; E3R, TTCTGTCCGAGACTCATGGG) for PCR
(94°C for 20 seconds, 56°C for 20 seconds, 72°C for 30 seconds; 35
cycles). Endogenous wild-type Dvl2 allele gave rise to a PCR product
of 370 bp, while the Dvl2-EGFP or dsh1-EGFP transgenes,
owing to the insertion of the 34 bp LoxP site in intero 2, gave rise to a PCR
product of 404 bp. The targeted Dvl2-null allele would not be
amplified in this PCR reaction. The same PCR was used to genotype for
DEP-EGFP and dsh1-EGFP transgenes. To genotype and
differentiate DIX-EGFP transgenes from the endogenous
Dvl2 and Dvl2 null alleles, a three primer PCR genotyping
strategy was used (I1F, TTGCTCACTGAGTGCCTCTTGC; E3R, TTCTGTCCGAGACTCATGGG; R3,
GCCATGTTCACTGCTGTCTCTC).
Confocal microscopy
To visualize native GFP signal from Dvl2-EGFP or
dsh1-EGFP mice, embryos or cochleas of appropriate stages were
dissected and briefly fixed in 4% paraformaldehyde at 4°C for 1 hour.
Embryos were then counterstained with Alexa Fluor 568 phalloidin (A-12380,
Molecular Probe) according to the manufacturer's protocol. For antibody
staining, embryos were fixed in 4% paraformaldehyde at 4°C overnight.
After blocking in PBS + 5% normal goat serum, embryos were stained with an
anti-GFP antibody (A-6455, Molecular Probe, 1:1000) and a donkey anti-rabbit
IgG antibody (A-21206, Molecular Probe, 1:1000). Embryos were counterstained
with Alexa Fluor 568 phalloidin. For analyzing planar cell polarity of the
organ of Corti, whole-mount organs of Corti were stained with rhodamine or
fluoroscein-conjugated phalloidin. Image was acquired using an Olympus FV 1000
confocal scanning microscope.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
Dvl2-/-; Dvl3-/- double mutants also display
craniorachischisis (J.W., N.S.H. and A.W.-B., unpublished). However,
Dvl1-/- (Lijam et al.,
1997) and Dvl3-/- single mutants or
Dvl1-/-; Dvl3-/- double mutants (J.W. and
A.W.-B., unpublished) do not display neural tube defects. These findings
indicate that Dvl2 is the most important mammalian Dvl gene for
neural tube closure and is sufficient by itself for normal neural tube
closure. By contrast, Dvl1 and Dvl3 are not sufficient by
themselves for normal neural tube closure, but contribute significantly when
Dvl2 is completely missing.
In an effort to determine the cause of the craniorachischisis defect in
Dvl1-/-; Dvl2-/- mutants, we performed in situ
hybridization to determine dorsoventral (DV) patterning as defective DV
patterning in the spinal cord is known to cause severe neural tube closure
defects (Copp et al., 2003;
Ybot-Gonzalez et al., 2002).
We found normal dorsal expression of Wnt1, Pax3 and
Engrailed2 and ventral expression of sonic hedgehog
(shh) in the spinal cord of Dvl1-/-;
Dvl2-/- mutants (data not shown). These results suggest that
the failure of neural tube closure in Dvl1-/-;
Dvl2-/- mutants is not due to abnormal DV patterning.
Furthermore, the normal expression of En2, a known Wnt target gene,
suggests that the canonical Wnt pathway was not globally disrupted in
Dvl1-/-; Dvl2-/- mutants.
Recent studies in Xenopus have indicated an essential role of
XDsh-mediated convergent extension morphogenetic movement in neural tube
closure (Wallingford and Harland,
2002). In Xenopus, convergent extension results in
coordinated elongation of the AP axis and narrowing of the ML axis, and is
reflected as a continuous increase of the length-to-width ratio (LWR) during
neurulation (Wallingford et al.,
2002; Wallingford and Harland,
2002). To determine whether Dvl1-/-;
Dvl2-/- mutants display defects consistent with a disruption
of convergent extension, we adopted the methods used in Xenopus
(Wallingford and Harland,
2002) and measured the LWR of neurulating mouse embryos
(Fig. 1; Materials and
methods). In control embryos, we found that the LWR continuously increased
during neurulation (Fig. 1E).
However, when we systematically measured Dvl1-/-;
Dvl2-/- mutant embryos, we found consistent, significant
reduction of LWR from the earliest time point where we could perform this
analysis (Fig. 1E). More
strikingly, from the five- to seven-somite stages, immediately before the
first apposition of neural folds at closure 1 at the 7-somite stage in control
embryos (Fig. 1C)
(Ybot-Gonzalez et al., 2002),
there was virtually no increase of the LWR in Dvl1-/-;
Dvl2-/- mutant embryos.
This result reveals that, like Xenopus, convergent extension,
which is defined as concomitant lengthening and narrowing of a tissue
(Wallingford et al., 2002),
occurs during mouse neurulation and is affected in Dvl1-/-;
Dvl2-/- mutants prior to the time at which neural tube closure
defects are observed. As suggested in Xenopus
(Wallingford and Harland,
2002), the resulting wider neural plate in Dvl1-/-;
Dvl2-/- mutants may also be incompatible with normal neural
tube closure in the mouse.
Null (Pinson et al., 2000)
and hypomorphic (Kokubu et al.,
2004) alleles of the Wnt co-receptor Lrp6 result in the
less severe neural tube defects exencephaly or spina bifida, implicating the
canonical Wnt pathway in neural tube closure. In addition, the canonical Wnt
pathway is crucial for the elongation of the AP axis through, at least in
part, activating brachyury (T) expression
(Yamaguchi et al., 1999).
Therefore, we analyzed the expression of T to confirm that the
reduced LWR was not due to the loss of function of the canonical Wnt pathway.
In the early headfold stage, T is expressed in the notochord, node
and primitive streak. In Wnt3a-null mice, T expression was
reported to be lost in the anterior primitive streak. The loss of T
expression was interpreted as the cause of axis shortening in
Wnt3a-/- mutants
(Yamaguchi et al., 1999).
However, in Dvl1-/-; Dvl2-/- mutants,
T expression in the anterior primitive streak appeared to be normal,
suggesting that the reduced LWR was not due to a failure of the canonical Wnt
pathway (Fig. 2A,B) and that
reduced dose of Dvl in Dvl1-/-; Dvl2-/- mutants
does not cause global loss of function of Wnt signaling.
In contrast to the primitive streak, we observed a different pattern of
T staining in the notochord. In the wild-type embryos, the notochord
was slender and there were no T-positive cells outside of the
notochord (Fig. 2A). In the
Dvl1-/-; Dvl2-/- mutants, however, the
notochord was wider, and there were also a few T-positive cells
outside of the notochord (Fig.
2B). As lengthening of the notochord in the mouse was argued to be
driven by convergent extension-like cell movements in the absence of cell
division (Beddington, 1994),
the different pattern of T staining in the Dvl1-/-;
Dvl2-/- mutants suggests a reduction of PCP-dependent
convergence of the notochord cells towards midline.
Lp/Lp embryos also display disruption of convergent extension
To test the validity of this hypothesis, we examined Lp mutant
that harbors a loss-of-function mutation in the mouse PCP gene Vangl2
(Kibar et al., 2003;
Kibar et al., 2001;
Murdoch et al., 2001). When we
analyzed T expression in the Lp/Lp mouse embryos, we
observed a similar broadening of the notochord, as well as stranding of
T-positive cells outside of the notochord, further evidence that
these defects could be due to a disruption of convergent extension
(Fig. 2C,D). Furthermore, when
we determined the LWR in neurulating Lp/Lp mutant embryos, we found
that, similar to Dvl1-/-; Dvl2-/- mutants,
Lp/Lp embryos displayed a significant reduction of the LWR prior to
closure 1 (Fig. 3A).
Lp/+ mutants display kinky or looped tails but nonetheless manage to
close their neural tubes in most cases, and displayed a moderate reduction of
LWR. Accompanying the reduced LWR, Lp/+ embryos displayed delayed
closure of neural tube: their neural tubes often remained unfused at the 8- to
9-somite stage, while in the same stage wild-type embryos, neural tube has
fused extensively along the AP axis (Fig.
3B,C). These results provide further evidence that the mammalian
PCP pathway regulates convergent extension to effect neural tube closure in
the mouse.
|
; Goto and Keller,
2002; Park and Moon,
2002; Wallingford and Harland,
2002; Wallingford et al.,
2000), we determined whether Dvl and Lp
genetically interact during mouse neurulation. We crossed
Dvl1+/-; Dvl2+/-; Lp/+ triple
heterozygotes with Dvl2-/- homozygotes, and genotyped the
surviving offspring (Table 1).
Out of 48 pups that survived, 50% of the expected Dvl2-/-
homozygotes were recovered (expected six, recovered three), consistent with
our previous observation that 50% of Dvl2-/- mutants die
at birth because of heart defects (Hamblet
et al., 2002). Reducing the dose of Dvl1 by half did not
affect the viability of Dvl2-/- mutants as we were still
able to recover 50% of the expected Dvl1+/-;
Dvl2-/- mutants (Table
1). However, reducing the dose of Lp by half had much
more deleterious effect on the viability of Dvl2-/-
mutants, as we recovered no neonates that were Dvl2-/-;
Lp/+, either with or without additional Dvl1 mutation.
|
Association of neural tube closure defect with PCP defect in the cochlea
In addition to the neural tube closure defect, we recently found that
Dvl1-/-; Dvl2-/- mutants and
Dvl2-/-; Lp/+ also display disruption of the uniform
stereociliary bundle orientation in the cochlea
(Wang et al., 2005), a
manifestation of mammalian PCP (Klein and
Mlodzik, 2005; Lewis and
Davies, 2002). The association of these two phenotypes has also
been reported in two other mammalian PCP mutants identified so far,
Lp and Celsr, strongly implying that a conserved PCP pathway
regulates both hair cell polarity and neural tube closure.
|
). The strict
association between neural tube closure and stereociliary polarity in
Dvl1-/-; Dvl2-/- mutants indicates that both
phenotypes can be modified by genetic background variation to the same extent,
further arguing a highly conserved genetic circuitry underlies both mammalian
convergent extension and PCP.
Plasma membrane distribution of Dvl2 and its dependence on the DEP domain during neurulation
During fly wing development, it has been reported that Dsh proteins are
localized asymmetrically on the plasma membrane
(Axelrod, 2001;
Bastock et al., 2003). This
asymmetric membrane distribution is both dependent upon and important for the
proper establishment of planar cell polarity
(Axelrod, 2001;
Bastock et al., 2003). We
recently generated a Dvl2 bacterial artificial chromosome (BAC)
transgene that contains an EGFP-coding sequence inserted in-frame to the last
codon of Dvl2 (Wang et al.,
2005) and found that transgenic Dvl2-EGFP protein displayed a
Vangl2-dependent polarized membrane distribution in the organ of Corti.
Furthermore, the transgene was also able to rescue the cochlea elongation and
stereocilia orientation defects in Dvl1-/-;
Dvl2-/- mutants (Wang et
al., 2005), indicating that the Dvl2 BAC transgene can
fully substitute for the endogenous Dvl2 function during inner ear
development.
We further found that this Dvl2 BAC transgene, as well as an
additional Dvl2 BAC transgene (Dvl2-EGFP2,
Fig. 4A) that contains two
flanking LoxP sites, was also able to rescue Dvl1-/-;
Dvl2-/- and Dvl2-/-; Lp/+ mutants to
fertile adults, suggesting that the encoded Dvl2-EGFP fusion protein could
also substitute for the endogenous Dvl2 during neurulation
(Fig. 4B). Consistent results
were acquired from all six independent lines derived from the two transgenes,
suggesting BAC transgenic approach is a reliable method to produce transgenic
protein capable of replacing endogenous Dvl2, presumably owing to its ability
to recapitulate more consistently the endogenous gene expression pattern and
level (Lee et al., 2001).
We investigated whether the Dvl2 protein localized in a polarized fashion
during mouse neurulation using these Dvl2 BAC transgenes. In
neurulating embryos of different somite stages, we observed the Dvl2-EGFP
transgenic protein primarily localized to the plasma membrane in the
neuroepithelium (Fig. 5A,E,I).
The more diffuse apparent distribution of Dvl2-EGFP and F-actin in some cells
in Fig. 5A-D was the result of
capture of a single focal plane immediately underneath the apical plasma
membrane, presumably reflecting a close association of Dvl2-EGFP to the apical
plasma member. When the entire series of z stacks were examined (data
not shown), it was clear that both Dvl and actin were localized to the lateral
plasma membrane as individual optical sections are scanned more basally
through the cell. Nevertheless, we could not find any evidence for an
asymmetric pattern of Dvl2-EGFP distribution on the plane of the
neuroepithelium (Fig. 5A,E,I;
data not shown). Furthermore, the Lp mutation did not affect the
membrane localization of Dvl2-EGFP as we observed the same membrane
distribution pattern in Lp/Lp mutants
(Fig. 5B,F,J; data not shown).
Consistent results were observed in multiple transgenic lines using confocal
microscopy of Dvl2-EGFP from live (Fig.
5I,J) and briefly fixed embryos
(Fig. 5E,F), or from
permanently fixed embryos stained with an anti-GFP antibody
(Fig. 5A,B). In addition,
although manipulating the activity of a number of PCP homologs in
Xenopus and zebrafish could alter the cell orientation and elongation
along the ML axis (Jessen et al.,
2002; Veeman et al.,
2003b; Wallingford et al.,
2000), our analysis did not reveal obvious differences of cell
polarity in the neuroepithelium of wild-type and Lp/Lp embryos
(compare Fig. 5E,F with 5G,H).
We note that in Xenopus, ML cell polarity in the mesoderm undergoing
convergent extension is easy to observe because as the cells intercalate, they
align and elongate mediolaterally (Shih
and Keller, 1992). By contrast, neural cells elongate only
episodically during convergent extension in Xenopus, so at any given
time only a few cells will be elongated and appear mediolaterally polarized
(Elul et al., 1997). Thus, it
may be more difficult to assess mediolateral polarity in neural cells with
static confocal imaging.
|
;
Boutros et al., 1998;
Rothbacher et al., 2000;
Wallingford and Habas, 2005;
Wallingford et al., 2000). In
Xenopus, mediolateral intercalation in the mesoderm requires the
C-terminal DEP domain but not the N-terminal DIX domain of Xdsh
(Wallingford and Harland,
2001; Wallingford et al.,
2000). To confirm that mammalian neurulation requires the same
domain of Dvl2, we generated mutant Dvl2 BAC transgenes identical to
the DEP mutant in Xenopus (DEP-EGFP,
Fig. 4A)
(Rothbacher et al., 2000;
Wallingford and Harland, 2001;
Wallingford and Harland, 2002;
Wallingford et al., 2000).
When crossed into Dvl1-/-; Dvl2-/- background,
DEP-EGFP completely failed to rescue the neurulation defects
(Fig. 4C; eight
Dvl1-/-; Dvl2-/-;DEP-EGFP
expected, six recovered, all of which displayed craniorachischisis). By
contrast, a DIX-EGFP transgene, in which part of the DIX
domain was deleted, could still fully rescue the neurulation defect in
Dvl1-/-; Dvl2-/- mutants
(Fig. 4F; 12
Dvl1-/-; Dvl2-/-;DIX-EGFP
expected, 15 recovered, all of which displayed normal neural tube closure). As
the DIX-EGFP transgene removed a VKEEIS motif in the
N-terminal region that is essential for Dvl2 function in the canonical Wnt
pathway (Capelluto et al.,
2002), this result also confirmed that the neural tube closure
defect in Dvl1-/-; Dvl2-/- mutants was not due
to the loss of function of Wnt signaling.
|
DIX-EGFP was still primarily
membrane localized (Fig. 4G),
indistinguishable from wild-type Dvl2-EGFP, DEP-EGFP was evenly
distributed in the cytoplasm (Fig.
4D). This result is consistent with existing literature and
confirmed the requirement of the DEP domain in targeting Dvl2 to the plasma
membrane during mammalian neurulation.
A point mutation identical to the fly dsh1 allele disrupted the ability of Dvl2-BAC to rescue the neurulation defect in Dvl1-/-; Dvl2-/-
The result above suggested that DEP-dependent plasma membrane localization
of Dvl2-EGFP could be a pre-requirement for its involvement in neural
convergent extension and neural tube closure. However, there were differences
in Dvl2-EGFP localization in the neuroepithelium and that in the organ of
Corti, where Dvl2-EGFP showed an asymmetric membrane distribution that was
disrupted in Lp/Lp mutants, reminiscent of fly PCP establishment
(Fig. 6E) (see
Wang et al., 2005). We
wondered whether this could be due to a difference in how Dvl proteins
function during convergent extension and PCP establishment. To further address
this issue, we tested whether the point mutation dsh1 identified in
fly, which specifically abolished the PCP
(Axelrod et al., 1998;
Boutros et al., 1998), might
affect convergent extension in mammals. The dsh1 mutation results in
a K to M missense mutation in the C-terminal DEP domain
(Axelrod et al., 1998;
Boutros et al., 1998). Using
BAC recombineering, we introduced an identical mutation into
Dvl2-EGFP BAC (Fig.
4A) and produced transgenic mice. All Dvl1-/-;
Dvl2-/-; dsh1-EGFP embryos recovered at E9.5 or later
displayed craniorachischisis (Fig.
7A,D, eight expected, six recovered, all of which displayed
craniorachischisis), suggesting that the dsh1 mutation completely
disrupted the ability of Dvl2 to function during convergent extension. In
addition, consistent with our proposal that convergent extension underlies
cochlea elongation (Wang et al.,
2005), we observed a shorter and wider cochlea in
Dvl1-/-; Dvl2-/-; dsh1-EGFP embryos
(Fig. 6E,F). However, in either
wild-type or Dvl1-/-; Dvl2-/- background, this
mutation did not appear to appreciably affect the membrane localization of
Dvl2-EGFP (Fig. 7B,C) in
neuroepithelium during neurulation.
To determine whether dsh1 also affects the PCP establishment in
mammals, we analyzed the stereociliary bundle orientation in the cochlea. In
P0 (postnatal day 0) control pups, the stereociliary bundles of sensory hair
cells in the cochlea showed uniform orientation
(Fig. 7G,I). By contrast, in a
P0 Dvl1-/-; Dvl2-/-; dsh1-EGFP cochlea, we
observed a disruption of the uniform stereocilia orientation and a less
recognizable form of stereocilia (Fig.
7H,J), resembling the Dvl1-/-;
Dvl2-/- mutants. Occasional mis-alignment of inner hair cells,
which has also been found in Dvl1-/-; Dvl2-/-
and Dvl2-/-; Lp/+ mutants
(Wang et al., 2005), was also
observed (Fig. 7J and
Fig. 5D', arrows).
In fly wing development, the dsh1 mutation was thought to disrupt
PCP establishment through abolishing DSH-EGFP localization to the plasma
membrane (Axelrod, 2001). To
investigate how the dsh1 mutation might disrupt PCP in mammals, we
examined its distribution during stereociliary bundle formation. In E16.5
Dvl1-/-; Dvl2-/-; Dvl2-EGFP embryos, before
stereociliary polarity could be detected, wild-type Dvl2-EGFP was already
localized to the distal membrane (Fig.
6C,C'), similar to that in the more mature hair cells at
E18.5 (Fig. 6A,A').
However, in E16.5 Dvl1-/-; Dvl2-/-; dsh1-EGFP
embryos, most dsh1-EGFP lost its membrane localization
(Fig. 6D,D', arrowheads)
and formed aggregates in the apical cytoplasm, suggesting that the
dsh1 mutation affected Dvl function in mammalian PCP establishment
through interfering with its localization to the membrane. Intriguingly, the
dsh1-EGFP aggregates were not evenly distributed throughout the apical
cytoplasm but rather restricted primarily to the distal side of hair cells.
Furthermore, the cytoplasmic dsh1-EGFP distribution was largely rescued by
increasing the dose of wild-type Dvl: in phenotypically wild-type E18.5
Dvl1-/-; Dvl2+/-; dsh1-EGFP cochlea, dsh1-EGFP
protein was primarily localized to membrane at the distal side of hair cells
(Fig. 6B,B'), although
its localization appeared to be somewhat punctate when compared with wild-type
Dvl2-EGFP (Fig. 6A,A').
Similar differences were also noticed at E16.5 (data not shown). Presumably,
the presence of wild-type Dvl3 and Dvl2 protein may account for the partial
rescue of dsh1-EGFP localization defects.
|
;
Wang et al., 2005).
Collectively, these results demonstrated the importance of polarized Dvl2
membrane localization in mammalian PCP establishment in hair cells, but not in
neuroepithelium during neurulation. |
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
;
Myers et al., 2002;
Tada et al., 2002;
Veeman et al., 2003a).
However, significant differences have also been observed that may represent
evolutionary adaptation in each pathway for the distinct downstream cellular
and developmental process (Mlodzik,
2002; Tada et al.,
2002; Veeman et al.,
2003a). Our results further demonstrate that convergent extension
in the neuroepithelium and PCP co-exist in the mouse and may have co-evolved
by using the same set of core PCP proteins.
|
;
Goto and Keller, 2002;
Kibar et al., 2001;
Murdoch et al., 2001).
Finally, the fact that DIX-EGFP BAC transgenes with a deletion
of the VKEEIS motif essential for Dvl2 involvement in the canonical Wnt
pathway (Capelluto et al.,
2002) was still able to fully rescue the lethality of
Dvl1-/-; Dvl2-/- mutants, while
DEP-EGFP and dsh1-EGFP transgenes completely failed
to do so, indicated that the neural tube closure defect in
Dvl1-/-; Dvl2-/- was not due to the loss of
function of Wnt signaling, but solely to the disruption of the PCP
pathway.
Our analyses of LWR suggest that neural plate undergoes coordinated
lengthening and narrowing throughout neurulation, resembling convergent
extension that occurs during Xenopus neural tube closure.
Furthermore, three mouse mutants, Dvl1-/-; Dvl2-/-,
Lp/Lp and Lp/+; Dvl2-/-, all displayed similar severe
neural tube closure defects. In each case, significant reductions in LWR were
found before the seven-somite stage, a crucial time of neurulation where
elevating neural folds appose at dorsal midline. These findings suggest that
the mammalian PCP pathway is the driving force behind this convergent
extension-like morphogenesis process and that, as in the Xenopus, a
disruption of this process is the cause rather than the result of neural tube
closure defects. However, it is important to note that our data do not imply a
similar type of cell movement is involved in mammalian neurulation. Although
convergent extension in Xenopus is driven by cell intercalation
(Elul and Keller, 2000;
Elul et al., 1997;
Shih and Keller, 1992;
Wallingford and Harland,
2001), it can also be accomplished through directed migration or
oriented cell division in zebrafish (Gong
et al., 2004; Solnica-Krezel
et al., 1995; Wallingford et
al., 2002). The exact cell behavior behind mammalian neural
convergent extension remains to be determined.
|
). Based on
the similar neural tube closure defect, we infer that mutations of the
mammalian PCP homologs Celsr1 and Fzd3/6, which cause PCP
defects in the ear, also lead to convergent extension defect during
neurulation (Curtin et al.,
2003; Wang et al.,
2006). Our finding that the missense point mutation dsh1
identified in fly that specifically disrupts the PCP pathway
(Axelrod et al., 1998;
Boutros et al., 1998) also
abolishes the function of Dvl2 to regulate convergent extension and
stereociliary polarity suggested that Dsh/Dvl functions through very conserved
mechanisms in convergent extension and establishment of PCP. This notion is
also supported by that fact that genetic background variation modifies neural
tube closure and stereociliary polarity defects to the same extent.
Using BAC transgenes that express Dvl2-EGFP fusion proteins capable of
replacing endogenous Dvl2 function, we found that Dvl2-EGFP is primarily
localized to the plasma membrane in neuroepithelium, a prerequisite for its
involvement in convergent extension (Park
et al., 2005). Similar to the findings in fly and
Xenopus, we found that the C-terminal DEP domain was required for
Dvl2-EGFP localization to the plasma membrane and its ability to mediate
neural tube closure and presumably, convergent extension during neurulation.
By contrast, although Vangl2 is known to bind to Dvl and the Lp
mutation weakens the binding (Torban et
al., 2004), we did not find any change of Dvl2-EGFP distribution
in the neuroepithelium of neurulating Lp/Lp mutants, indicating that
the membrane localization of Dvl2 in neuroepithelium is not crucially
dependent upon Vangl2 function. This observation is in direct contrast to our
previous findings in cochlea where Dvl2-EGFP displayed an
Lp-dependent asymmetric membrane distribution that correlates with
the localization and orientation of stereocilia, resembling the establishment
of PCP in fly wing cells (Wang et al.,
2005). Similarly, our current results with the dsh1-EGFP
transgene also revealed a disparity between neuroepithelium undergoing
convergent extension and sensory hair cells during PCP establishment. In fly,
the dsh1 point mutation disrupts membrane localization of Dishevelled
(Axelrod, 2001). Here, we found
that the same point mutation abolished Dvl2-EGFP membrane localization in the
cochlea sensory hair cells in Dvl1-/-; Dvl2-/-
embryos and concomitantly, its ability to establish PCP. By contrast, although
the dsh1 mutation also disrupted Dvl2-EGFP function in convergent
extension during neurulation, we could not detect any significant change of
dsh1-EGFP distribution in the neuroepithelium. Collectively, these data
suggested that plasma membrane distribution of Dvl2-EGFP might be necessary
for its involvement in convergent extension, but not sufficient. Like Dvl2, it
has recently been shown that Fzd3 and Fzd6 display Lp-dependent
asymmetric localization in the in the inner ear, but their distribution in the
neuroepithelium has not been reported
(Wang et al., 2006).
If Dvl proteins function in convergent extension and PCP through highly
conserved mechanisms, then why would the Lp and dsh1
mutation have different effects on Dvl2-EGFP localization in neuroepithelium
undergoing convergent extension and sensory hair cells undergoing PCP
establishment? One possibility is that another Vangl homolog,
Vangl1, codes for a protein that allows for the membrane localization
of Dvl2 in neuroepithelium but not the inner ear. In zebrafish, Vangl1 and
Vangl2 have largely non-overlapping patterns of expression but similar
biochemical function (Jessen and
Solnica-Krezel, 2004). Vangl1 expression has not been
carefully examined in the developing mammalian neural tube or inner ear.
The second possibility is that in neuroepithelium undergoing convergent
extension, Dvl2-EGFP is distributed at specific locations that depend upon
Vangl2 and a functional PCP pathway, but our imaging techniques are not
sensitive enough to recognize them. To resolve this, we are using different
Cre transgenes and the floxed Dvl2-EGFP2 transgenes to
generate chimeric embryos that consist of individual Dvl2-EGFP cells
surrounded by non-GFP cells. Our preliminary results showed no polarized
distribution of Dvl2-EGFP that could be correlated with either the AP or ML
axis of the embryo. Similar studies in Xenopus also did not reveal
consistent polarized membrane localization of Dsh in mesodermal cells
undergoing convergent extension (Park et
al., 2005).
A third possibility is that although Dvl functions similarly in PCP
establishment and convergent extension, different cellular processes demand
distinct modes of action. For example, during polarity establishment in the
well-aligned sensory hair cells, polarized distribution of Dvl and other PCP
components dictates the precise location of stereociliary assembly within the
hair cells. By contrast, in cells undergoing dynamic cell rearrangement and
intercalation, the localization of Dvl and other PCP components is relatively
mobile to mediate temporary cytoskeleton assembly that underlies cell-cell
adhesion and generates traction (Ulrich et
al., 2005; Wallingford and
Harland, 2002). Supporting evidence comes from the observation
that in Xenopus, XDsh mutant that blocks convergent extension also
leads to less stable membrane protrusions
(Wallingford et al., 2000).
This view is also consistent with the proposal that PCP signaling serves as a
permissive factor in convergent extension, while the alignment and orientation
of cell intercalation may be determined by the AP polarity
(Ninomiya et al., 2004). In
this scenario, membrane localization of Dvl in the neuroepithelium may
represent only a steady state distribution that does not require the function
of Vangl2, nor confer polarity.
To understand more thoroughly the function of the PCP pathway in mammals,
it will be important to find out not only the similarities, but also the
differences between PCP and convergent extension at the cellular and molecular
level. In this regard, it is interesting to note that convergent extension in
Xenopus and zebrafish also involves Wnt/Ca2+ signaling, a
pathway that has not been implicated in PCP determination in fly but
nonetheless requires the function of PCP proteins such as Dsh and Pk
(Veeman et al., 2003a).
Analyzing the function of the Wnt/Ca2+ pathway in the mouse may
lead to a better understanding of how the core PCP proteins co-evolved to
regulate both convergent extension and PCP determination.
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Department of Molecular Physiology and Biophysics, Baylor College of
Medicine, Houston, TX 77030, USA
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Axelrod, J. D. (2001). Unipolar membrane
association of Dishevelled mediates Frizzled planar cell polarity signaling.
Genes Dev. 15,1182
-1187.
Axelrod, J. D., Miller, J. R., Shulman, J. M., Moon, R. T. and
Perrimon, N. (1998). Differential recruitment of Dishevelled
provides signaling specificity in the planar cell polarity and Wingless
signaling pathways. Genes Dev.
12,2610
-2622.
Bastock, R., Strutt, H. and Strutt, D. (2003).
Strabismus is asymmetrically localised and binds to Prickle and Dishevelled
during Drosophila planar polarity patterning.
Development 130,3007
-3014.
Beddington, R. S. (1994). Induction of a second neural axis by the mouse node. Development 120,613 -620.[Abstract]
Boutros, M., Paricio, N., Strutt, D. I. and Mlodzik, M. (1998). Dishevelled activates JNK and discriminates between JNK pathways in planar polarity and wingless signaling. Cell 94,109 -118.[CrossRef][Medline]
Cadigan, K. M. and Nusse, R. (1997). Wnt
signaling: a common theme in animal development. Genes
Dev. 11,3286
-3305.
M substitution at
amino acid 446. Lower panel showed sequence alignment of the wild-type
Dvl2-EGFP and the modified dsh1-EGFP BAC transgenes, as well
as endogenous mouse Dvl1, Dvl2, Dvl3, Xenopus XDsh,
Drosophila Dsh and the dsh1 mutation identified in fly.
Although Dvl2-EGFP1, Dvl2-EGFP2 (B) and
