|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 30 November 2006
doi: 10.1242/dev.02722
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Max-Planck-Institut für Immunbiologie, Abteilung für Molekulare
Embryologie, Stübeweg 51, D-79108 Freiburg, Germany.
2 The Jackson Laboratory, Bar Harbor, ME 04609-1500, USA.
3 Department of Pathology, Clinical Hospital Merkur, 4100 Zagreb, Croatia.
Author for correspondence (e-mail:
Kemler{at}immunbio.mpg.de)
Accepted 27 October 2006
| SUMMARY |
|---|
|
|
|---|
Key words: E-cadherin, N-cadherin, Trophectoderm formation, Cell adhesion, Gene replacement, Mouse
| INTRODUCTION |
|---|
|
|
|---|
E- and N-cad share several structural and functional features. Both are
single-span transmembrane glycoproteins with an extracellular region, a
transmembrane helix and a cytoplasmic domain
(Gumbiner, 1996
;
Kemler, 1993
). The
extracellular region has a modular structure composed of five cadherin-binding
domains that are separated from each other by Ca2+-binding pockets.
The cytoplasmic domain serves as a scaffold for intracellular binding
partners, such as catenins, that link cadherins to the cytoskeleton
(Nose et al., 1990
;
Ozawa et al., 1989
). Both E-
and N-cad are calcium-dependent cell adhesion molecules and undergo homophilic
interactions (Nose et al.,
1990
; Shapiro et al.,
1995
). Heterophilic interactions with other adhesion molecules
have also been described, but these usually confer low adhesiveness
(Cepek et al., 1994
;
Corps et al., 2001
). E-cad and
N-cad first form cis-dimers on the cell surface, followed by homophilic
trans-interaction with molecules on neighboring cells
(Koch et al., 2004
). This
results in a local enrichment and clustering of these adhesion molecules,
which is believed to be the basis for the strong adhesive state of cadherins
typically seen in adherens junctions
(Kemler, 1993
). Different
experimental approaches have helped to unravel the molecular basis of
cadherin-mediated adhesion (Baumgartner et
al., 2000
; Duguay et al.,
2003
; Niessen and Gumbiner,
2002
; Perret et al.,
2002
; Sivasankar et al.,
2001
). Using a quantitative dual pipette assay, the adhesive
strength of E-cad was determined to be 3-4x higher than that of N-cad
when cells expressing an equal amount of these two cadherins were compared
(Chu et al., 2006
;
Chu et al., 2004
).
Besides their similarities, E- and N-cad have in addition specific
individual characteristics. N-cad function in particular appears to be cell
context-dependent as it can induce cellular condensation, for example during
chondrogenic differentiation, or induce morphological changes toward a more
migratory phenotype. These unique functions of either N- or E-cad could
largely depend on the context of interacting proteins. For example, E-cad can
associate with the epidermal growth factor receptor (EGFR)
(Fedor-Chaiken et al., 2003
;
Hazan and Norton, 1998
;
Hoschuetzky et al., 1994
),
whereas N-cad interacts with the fibroblast growth factor receptor (FGFR)
(Byers et al., 1992
;
Williams et al., 1994
) and
promotes FGFR signal transduction. Both E- and N-cad are complexed via their
cytoplasmic domains with catenins (
-, ß-catenin, p120)
(Aberle et al., 1996
;
Anastasiadis and Reynolds,
2000
), key players in linking classical cadherins to the
cytoskeleton. In addition, other interacting molecules, such as kinases and
small GTPases, have been found to bind and modulate the function of the
cadherin-catenin complex (Braga et al.,
1999
; Lickert et al.,
2000
; Lilien et al.,
2002
). Although not thoroughly examined, these cytoplasmic
molecules could interact differently with E- or N-cad, resulting in different
cellular responses. The modulation of the cadherin-catenin complex leads to
changes in a number of important cellular processes, including reorganization
of the cytoskeleton, formation of lamellipodia and cell migration
(Ehrlich et al., 2002
). These
findings have advanced our knowledge of cadherin-mediated cell adhesion, but
it should be noted that most of the results were obtained with cultured cells
and so the biological significance in vivo remains to be clarified.
One of the central questions in cadherin and early mammalian developmental
biology is: why does the organism strictly use only E- or N-cad, two highly
related molecules, during specific, defined developmental processes? In order
to address this question, we asked whether E- and N-cad are functionally
identical and whether N-cad could function in an epithelial cell environment
in vivo. We replaced E-cad with N-cad by inserting an Ncad cDNA into
the Ecad locus using an established knock-in (k.i.) strategy
(Stemmler et al., 2005
). Here
we show that when expressed from the Ecad locus, N-cad is localized
to cells of the E-cad expression domains and displays a similar subcellular
localization. However, although N-cad can rescue loss of E-cad for morula
compaction, it is not able to substitute functionally for E-cad during the
ensuing formation of trophectoderm. Thus, we demonstrate for the first time
that although E-cad and N-cad have similar calcium-dependent adhesive
properties, E-cad plays a unique role during early mouse development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mouse breeding and genotyping
Heterozygous Ecad+/Ncad or
Ecad+/Ncad-GFP embryos were obtained by crossings of k.i.
lines to wild-type (wt) C57BL/6 mice. Preimplantation embryos were collected
from heterozygous intercrosses of each line or from crossings of
Ecadfl/fl;Zp3Cre/+ females to
Ecad+/Ncad-GFP males to additionally remove maternal E-cad
(Boussadia et al., 2002
;
De Vries et al., 2004
).
Genotyping was performed by PCR with genomic DNA isolated from individual
embryos or mouse tail biopsies using primers for the Ncad k.i. allele
(E-cad5'UTR_s: CCAAGAACTTCTGCTAGAC and N-cad_as: TGGCAACTTGTCTAGGGA),
Ecad wt allele (E-cad5'UTR_s/E-cad_as: TACGTCCGCGCTACTTCA),
Ecad floxed allele [pE10.2/pE11as.2
(Boussadia et al., 2002
)],
Cre-recombinase (CAAGTTGAATAACCGGAAATG and GCCAGGTATCTCTGACCAGA).
ES cell isolation and culture, embryo culture and blastocyst outgrowth analysis
ES cells were cultured on DR-4 feeder cells in ES cell medium [DMEM with
15% FCS, supplemented with 500 U/ml LIF (Chemicon, ESGRO #ES1107)]. Hetero-
and homozygous N-cad-GFP k.i. ES cell lines were isolated from zona
pellucida-free E2.5 embryos obtained from heterozygous intercrosses according
to standard procedures (Doetschman et al.,
1985
). For in vitro culture, preimplantation embryos were flushed
from oviducts or uteri at E2.5 or E3.5, respectively, in M2 medium (Sigma,
M7167) and incubated in microdrops of KSOM medium (Specialty media,
MR-020P-5F) under mineral oil (Fluka) for 24 or 48 hours and processed for
time-lapse analysis or whole-mount immunofluorescence and subsequent
genotyping. For blastocyst outgrowth analysis embryos were recovered at E2.5,
treated with acidic Tyrode's solution (Sigma, T1788) to remove the zona
pellucida and cultured in ES cell medium (see above) in gelatinized tissue
culture chambers (Lab-tek, #177402) for 4 days. Blastocyst outgrowths were
fixed and processed for whole-mount immunofluorescence.
Generation of chimeric embryos and ß-galactosidase histochemistry
Ecad+/Ncad-GFP or
EcadNcad-GFP/Ncad-GFP ES cells were injected into
129-Gt(ROSA)26Sor/J (ROSA26)
(Soriano, 1999
) or
Ecad+/Ncad; Gt(ROSA)26Sor/J E3.5 blastocysts and
transferred to pseudopregnant females. Embryos were collected at E7.5 to E9.5,
fixed in 1% formaldehyde/0.2% glutaraldehyde/PBS solution, then incubated
overnight in X-gal staining solution, and processed as described previously
(Stemmler et al., 2005
).
Time-lapse microscopy
Time-lapse recordings were performed as described
(Hiiragi and Solter, 2004
). To
record the morula compaction process, embryos were recovered at E2.5 and
photographed every 30 minutes for 24 hours. To record blastocyst formation,
embryos were recovered at E2.5, cultured in KSOM for 24 hours and then
photographed every 30 minutes for another 24 hours. After recording, the DNA
of individual embryos was recovered for genotyping.
RNA preparation and RT-PCR
RNA was isolated from individual or pooled embryos using the PicoPure RNA
Isolation Kit (Arcturus, #KIT0204). cDNA was produced using Superscript II
reverse transcriptase according to the manufacturer's instructions
(Invitrogen). Specific transcripts were detected with primer combinations for
Ncad-GFP (fw, GTGGGAATCAGACGGCTA and rev, CCTCCTTGAAGTCGATGC),
Ecad (fw, GAGCTGTCTACCAAAGTG and rev, TTCATCACGGAGGTTCCT), and
Ncad 3'UTR (fw, AGTTTGGGCTCCCAGGGAATATCA and rev,
CCTTTATCTGCAACCAGCTGCGTA).
|
Immunohistochemistry, whole-mount immunofluorescence and antibodies
Dehydrated, PFA-fixed embryos were embedded in paraffin wax and sectioned
at 7 µm (Wilkinson and Green,
1990
). Immunohistochemistry on paraffin sections was performed as
described previously (Batlle et al.,
2002
). Whole-mount immunofluorescence on preimplantation embryos
was performed as described (Kanzler et
al., 2003
) with the following modifications. All procedures were
carried out at room temperature. Embryos were fixed for 20 minutes in 2% PFA
in PBS containing 0.05% Tween 20 (PBT). After permeabilization for 20 minutes
with 0.25% Triton X-100 in PBS and several washes in PBT, embryos were blocked
for 20 minutes with 2% goat serum in PBT and then incubated for 1 hour with
primary antibodies. After intensive washes, embryos were incubated for 30
minutes with secondary antibodies, washed, mounted in microdrops on a
glass-bottom dish and analyzed by confocal microscopy (see below).
The following antibodies were used. Mouse anti-N-cadherin (1:200, BD
Transduction Laboratories, #610921), mouse monoclonal anti-E-cadherin (1:200,
BD Transduction Laboratories, #610182), mouse monoclonal anti-ß-catenin
(1:200, BD Transduction Laboratories, #610154), polyclonal rabbit anti-ZO1
(1:200, Zymed, #617300), affinity-purified rabbit anti-gp84 antibody against
the extracellular domain of E-cadherin (1:200)
(Vestweber and Kemler, 1984
),
rat monoclonal antibody TROMA-1 against cytokeratin 8 (1:20)
(Kemler et al., 1981
), rabbit
anti-ezrin (1:200) which was a kind gift of Paul Mangeat
(Andreoli et al., 1994
),
polyclonal rabbit anti-PKC
(1:300, Santa Cruz, sc-216), mouse monoclonal
anti-Oct4 (1:200, Santa Cruz, sc-5279), polyclonal rabbit anti-Cdx2 (1:100)
which was a kind gift of Felix Beck (Beck
et al., 2003
), mouse monoclonal anti-myogenin (1:50, Abcam,
ab1835), mouse monoclonal anti-ß-tubulin III (1:200, Sigma, T8660), mouse
monoclonal anti-GFAP (1:200, Sigma, G3893), mouse monoclonal
anti-neurofilament 160 (1:50, Sigma, N5264), mouse monoclonal anti-nestin
(1:5, DSHB, Rat-401), mouse monoclonal anti-GFP (1:100, Roche, #11814460001),
Alexa-488-labeled rabbit anti-GFP (1:100, Molecular Probes, A21311). For mouse
and rabbit antibodies the DAKO Envision+ System HRP was used as a secondary
reagent (DakoCytomation, K4000 and K4002). For rat antibodies, secondary
peroxidase-conjugated anti-rat IgG antibody (1:100, Jackson ImmunoResearch
Laboratories, 312-035-003) was used. Staining of paraffin sections was
visualized with DAB Peroxidase Substrate (Sigma, D-4293). For
immunofluorescence, secondary species-specific Alexa-fluorochrome-conjugated
antibodies were used at a dilution of 1:300 (Molecular Probes). To detect
actin filaments, embryos were stained with Alexa-Fluor 488 Phalloidin (1:200,
Molecular Probes, A12379). Nuclei were visualized with DAPI (1:1000, Molecular
Probes, D3571).
|
Teratoma production
1x107 ES cells were injected subcutaneously into 6-8
week-old nude mice in a single-cell suspension. Teratomas were isolated
between 3.5 and 5.5 weeks after injection, and split into two parts for DNA
purification and paraffin embedding.
Confocal microscopy
Confocal analysis was performed using a Leica TCS SP2 UV laser scan head
attached to a Leica DM IRE2 inverted microscope equipped with Leica Confocal
software version 2.5. Optical sections were taken every 2 µm. 3D images
were reconstructed in IMARIS imaging software version 4.05 (Bitplane AG).
| RESULTS |
|---|
|
|
|---|
A scheme for the targeting of the Ecad genomic locus, as well as the diagnostic probes for Southern blot analysis, are depicted in Fig. 1A. Homologous recombination was observed in about 10% of ES cell clones analyzed by Southern blot analysis (Fig. 1B). Homologously recombined ES cell clones expressed N-cad-GFP protein, which was co-localized with E-cad at the cell membrane (Fig. 1C). Two independent clones from each targeting vector were used for blastocyst injection to generate chimeric males. Founders were bred with CMV-Cre deleter females to remove the floxed neomycin gene (Neor in Fig. 1A). Heterozygous offspring of both lines (Ecad+/Ncad or Ecad+/Ncad-GFP) were phenotypically normal and transmitted the k.i. allele in a mendelian ratio. Transcription and protein expression of both k.i. alleles were studied during the development of heterozygous embryos. Comparable results were obtained for N-cad-GFP (Fig. 1D) and N-cad k.i. alleles (Fig. 1E). Using specific primers to Ncad-GFP coding sequence or to the Ncad 3'UTR sequences, Ncad-GFP was found by RT-PCR to be co-expressed together with Ecad mRNA in lung, liver, gut, kidney and skin. In brain, where E-cad is not expressed at high level, N-cad-GFP expression was also very weak as compared with the high level of endogenous N-cad expression (Fig. 1D).
|
Embryos homozygous for N-cad cannot form an intact trophectoderm
In order to ascertain to what extent N-cad can substitute for E-cad,
heterozygous animals were intercrossed with a view to analyzing the
developmental potential of embryos homozygous for the Ncad k.i.
allele. However, no homozygous k.i. mutant embryos were recovered
post-implantation (E5.5-E7.5). Each litter included deciduae which were empty
or filled with cellular debris, suggesting that homozygous mutant embryos
induced a decidual reaction, but failed to undergo further development.
These results pointed to lethal developmental defects during preimplantation development. To test if transcripts from the k.i. allele were already expressed in preimplantation embryos, single E3.5 blastocysts from heterozygous intercrosses were subjected to RT-PCR analysis. Transcripts from the Ncad k.i. allele were detected in both heterozygous and homozygous embryos (Fig. 2F, lanes 2 and 3, respectively), whereas endogenous N-cad was not expressed in wt embryos at this developmental stage (Fig. 2F, lane 1). In early-stage heterozygous blastocysts, N-cad-GFP and E-cad were co-localized at the membrane of cells in the trophectoderm and the inner cell mass (ICM) (Fig. 2A' and B', respectively). Interestingly, in the trophectoderm, N-cad-GFP exhibited baso-lateral membrane localization similar to E-cad. Some punctate staining for N-cad-GFP was also observed on the apical membrane of the trophectoderm (Fig. 2B', arrow). Apparent immunohistochemical differences in the relative staining intensity of E-versus N-cad might merely reflect differences between the antibodies used for detection: E-cad was stained with rabbit affinity-purified antibodies directed against the extracellular domain of the protein (anti-gp84), whereas N-cad and N-cad-GFP were detected with monoclonal antibodies raised against the cytoplasmic domain of N-cad.
The preimplantation development of homozygous mutant, heterozygous and wt
embryos was recorded by time-lapse microscopy prior to genotyping. To minimize
any possible damage caused by the recording procedure, time-lapse analysis was
performed in two steps: from 4- to 8-cell embryos to compacted morulae and
from morulae (E3.5) to blastocysts (E4.5). DIC images were taken every 30
minutes (see Movies 1-4 in the supplementary material). Representative images
from the recordings are provided in Fig.
2C-E'''. All embryos developed into compacted morulae
independent of the genotype (Fig.
2D,D',D'') and no obvious delay in cleavage and/or the
onset of compaction was observed in embryos homozygous for the Ncad
k.i. allele. In addition, no differences were found with respect to cell
numbers or apoptosis among the three genotypes (not shown). However, clear
morphological differences became visible between E3.5 and E4.5, when wt and
heterozygous embryos had formed blastocysts
(Fig. 2E,E'). At this
time-point, homozygous mutant embryos were unable to form an intact
trophectoderm, although they had undergone compaction
(Fig. 2E'',E'''). In
most of the mutant embryos, the outer cells rounded up with clear signs of
reduced cell-cell contacts (Fig.
2E''). When E3.5 to E4.5 homozygous mutant embryos were
stained for N-cad-GFP, the protein predominantly localized to cell-cell
contact sites, becoming more irregularly distributed between the membrane and
in the cytoplasm as the mutant phenotype became more apparent
(Fig. 2B''). Only
occasionally did an outer cell layer separate from the inner cells and small
cavity-like cysts form (Fig.
2E'''). Even with prolonged culture, homozygous mutant
embryos never hatched from the zona pellucida and many cells vacuolized and
died. Thus, the phenotype of the Ncad-GFP k.i. mutant is remarkably
similar to that of classical E-cad-null mutant embryos
(Larue et al., 1994
).
Differentiation marker analysis and trophectoderm outgrowth of N-cad-GFP mutant embryos
Normally, during the transition from morula to blastocyst, the outer cell
layer of the embryo polarizes and starts to express a variety of epithelial
cell-specific genes required for the future trophectoderm.
To determine if the expression of epithelial cell-specific genes is altered
in Ncad-GFP mutant embryos, immunohistological analysis was
performed, with subsequent genotyping of each embryo. The transcription
factors Cdx2 and Oct4 (Pou5f1 - Mouse Genome Informatics) specify the
trophectodermal and ICM lineages, respectively, in wt blastocysts
(Fig. 3A), although some
trophectodermal cells still co-express Cdx2 and Oct4 in E3.5 blastocysts (not
shown). In EcadNcad/Ncad mutant embryos, Oct4 was also
preferentially localized in nuclei of inner cells, whereas Cdx2 was found in
outer cells, although co-localization could be seen to some extent
(Fig. 3A'). These results
suggest that an epithelial cell-specific program is initiated in the outer
cells of mutant embryos. This interpretation was further supported by the
finding that the outer cells expressed several epithelial markers
(Fig. 3B-E'). As in wt
embryos, the intermediate filament protein cytokeratin 8 (keratin 8 - Mouse
Genome Informatics) was expressed by the outer cells of homozygous embryos
(Fig. 3B,B').
Furthermore, the tight junction protein ZO-1 (Tjp1 - Mouse Genome Informatics)
showed a typical punctate localization in the trophectoderm of wt embryos
(Fig. 3C). In homozygous mutant
embryos, ZO-1 was less punctate and more extended along the lateral membrane
of outer cells (Fig.
3C'). Other epithelial cell-specific markers, such as
occludin, PKC-zeta (Prkcz - Mouse Genome Informatics) and desmosomal
cadherins, were also expressed in the outer cells of homozygous mutant embryos
(not shown). Ezrin (villin 2 - Mouse Genome Informatics), a member of the ERM
protein family, links the actin cytoskeleton to the plasma membrane and is
involved in the formation and stabilization of the apical microvillus pole
during morula compaction (Louvet et al.,
1996
). In early mutant embryos, ezrin was localized at the apical
pole of outer cells, similar to the distribution found in normal embryos
(Fig. 3D,D'). At later
stages, between E4.0-E4.5, when the mutant phenotype became apparent, ezrin
also localized to the baso-lateral membrane (not shown). Actin cytoskeleton
staining with Phalloidin gave similar results. Actin was found to be
concentrated at the apical pole of outer cells in wt and mutant embryos, but
also at the baso-lateral membrane of advanced-stage mutant embryos
(Fig. 3E'; for wt, see
E). Mutant embryos died within the zona pellucida, which hampered further
analysis of their differentiation potential.
To address the question whether, under in vitro conditions, outer cells of the homozygous N-cad k.i. mutant could further differentiate into trophoblast cells, the zonae pellucidae of mutant and wt E2.5 embryos were removed and the embryos cultured on gelatin-coated dishes. In both cases, trophoblast outgrowths containing giant cells were observed (Fig. 4A,A', arrows). Although E-cad was detected in only Ecad+/+ ICMs (Fig. 4B,B'), outgrowths were positive for cytokeratin 8 in both cases (Fig. 4C-D'). Remarkably, mutant embryos formed an ICM on top of the attached trophectoderm (Fig. 4A', arrowhead), and this allowed us to establish ES cell lines.
These results show that, in embryos expressing N-cad-GFP from the Ecad locus, inside and outside blastomeres can be distinguished by molecular markers, and outside cells exhibit many features of normal trophectodermal cells. Although outer cells start to polarize, polarization is not maintained in mutant embryos. A possible drawback of these experiments is that some maternal E-cad is present in the mutant embryos that could contribute to compaction and possibly to the onset of differentiation.
Mutant N-cad-GFP embryos lacking maternal E-cad
Zygotic Ecad gene inactivation has revealed that maternal E-cad
can mediate compaction at morula stage
(Larue et al., 1994
;
Ohsugi et al., 1997
).
Depletion of the maternal E-cad resulted in the dissociation of blastomeres,
but adhesion and compaction could be rescued by the paternal Ecad
allele (De Vries et al.,
2004
). Thus, it was important to study the possible contribution
of maternal E-cad to the Ncad-GFP mutant phenotype, particularly in
the polarization and the expression of epithelial markers in the outer cells
of mutant embryos. Using a zona pellucida glycoprotein 3 promoter-driven Cre
recombinase in combination with a floxed Ecad allele, we were able to
inactivate the maternal Ecad gene specifically during oocyte
maturation (De Vries et al.,
2004
). Such females were crossed with
Ecad+/Ncad-GFP males to produce
Ecad-/+ or Ecad-/Ncad-GFP embryos.
Time-lapse recording was performed between E2.5 and E4.0, and representative
pictures are shown in Fig.
5A-B'. Interestingly, both Ecad-/+ and
Ecad-/Ncad-GFP embryos compacted around E3.0
(Fig. 5A,A'). Since both
the Ecad wt and the Ncad-GFP alleles are paternal, this
result indicates that the Ncad-GFP allele can also rescue the initial
cell adhesion defect caused by the lack of maternal E-cad. However,
thereafter, the N-cad-GFP protein was unable to maintain the formation of an
intact trophectoderm, as was also the case for E-cad encoded by the paternal
allele (Fig. 5B,B').
Immunofluorescence clearly demonstrated that the paternally-encoded E-cad and
N-cad-GFP proteins localize to the baso-lateral membrane of outer cells
(Fig. 5C,E'). Cell-cell
contacts in the outer cells appeared to be more dense in the presence of E-cad
than of N-cad-GFP alone. In agreement with previous experiments,
double-labeling revealed that in embryos expressing N-cad-GFP, the tight
junction protein ZO-1 localized correctly to the outer cells
(Fig. 5F'). However,
staining for ezrin revealed a clear difference between Ncad-GFP
mutant embryos with or without maternal E-cad (compare
Fig. 3D' with
Fig. 5D'). In embryos
lacking maternal E-cad and expressing only the paternal Ncad-GFP
allele, ezrin was concentrated less distinctly at the apical pole of the outer
cells and was localized at the baso-lateral membrane
(Fig. 5D'). In control
embryos expressing only the paternal Ecad allele, ezrin localized
specifically to the apical pole of outer cells
(Fig. 5D). These results
indicate that the paternal N-cad-GFP cannot efficiently induce and maintain
polarization of the outside cells even though they express some epithelial
markers. Staining for Oct4 and Cdx2 revealed partial co-expression
(Fig. 5G-H'), although
Cdx2 protein was largely found in the nuclei of outer cells
(Fig. 5H,H'). Taken
together, embryos without maternal E-cad and expressing only paternal
N-cad-GFP can compact but show an impaired maintenance of polarization, even
though outside cells express epithelial cell markers.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
|
The most surprising result of our study is that embryos homozygous for the
Ncad k.i. allele phenocopy the classical Ecad knockout. This
suggests that E-cad has specific properties for trophectoderm formation which
N-cad cannot provide. This view is supported by experiments in which
Ecad cDNA was introduced by the same k.i. strategy. Homozygous
Ecad k.i. embryos can form blastocysts and implant (M.S.,
unpublished). As with E-cad-null mutants, embryos homozygous for the
Ncad k.i. allele undergo compaction, and the outer cells initiate
epithelial polarization. This is accompanied by the normal expression of genes
such as ezrin and aPkc (Prkca - Mouse Genome Informatics)
and epithelial cell-specific genes, such as cytokeratin 8 or ZO1.
Since maternal E-cad can mediate compaction and initiate polarization of the
outside cells (Larue et al.,
1994
; Ohsugi et al.,
1997
), it was important to study the participation of N-cad in
preimplantation development in the absence of maternal E-cad. After removal of
maternal E-cad in the growing oocyte, E-cad expression from the paternal
genome is sufficient for compaction and blastocyst formation
(De Vries et al., 2004
).
Interestingly, under the same experimental conditions, deleting maternal E-cad
but zygotically expressing N-cad from the paternal k.i. allele results in
compaction and expression of epithelial markers in the outer cells. However,
such embryos also fail to form an intact trophectoderm. This clearly shows
that N-cad can confer cell-cell adhesion but lacks some properties needed for
the formation of the trophectodermal epithelium. Thus, formation of
trophectoderm in these embryos may be impaired owing to defects in the
establishment of specialized cellular junctions that are required for the
formation of a fully polarized epithelium
(Fleming et al., 1994
;
Sheth et al., 2000
). We noted
that the tight junction protein ZO-1 is not correctly localized at the
apico-lateral membrane in mutant embryos. This, together with the more
extended distribution of other peripheral proteins, may indicate that N-cad is
unable to assemble the cytocortical network required for proper junction
formation.
In an earlier study, it was shown that E-cad can substitute for N-cad
during cardiogenesis, suggesting that these two molecules are interchangeable
in their functional properties (Luo et
al., 2001
). This is in contrast to our results demonstrating that
N-cad cannot substitute for E-cad in early embryonic development. It may well
be that N-cad cannot provide adhesive strength sufficient for the integrity of
the trophectoderm epithelial cell layer. Alternatively, E-cad may be part of a
trophectoderm-specific signaling program in addition to its cell adhesion
program.
Attempts to overcome the developmental block of homozygous Ncad k.i. embryos by morula aggregation or tetraploid experiments failed, most likely owing to the segregation of E-cad- and N-cad-expressing cells from each other. However, the differentiation potential of homozygous Ncad-GFP ES cells could be analyzed after blastocyst injection of mutant ES cells and the generation of teratomas. We generated chimeric embryos by injection of homozygous Ncad k.i. ES cells into ROSA26 blastocysts and demonstrated that both homozygous and heterozygous Ncad k.i. ES cells can clearly contribute to all three germ layers in vivo. They contribute to both the surface ectoderm and presumptive neural ectoderm. In the case of homozygous mutant ES cell injections, we observed strong malformations of embryos already at E7.5, which were always accompanied by a high ES cell contribution. It is likely that in embryos with a high contribution of EcadNcad-GFP/Ncad-GFP cells, normal tissue segregation is impaired. The expression of N-cad in E-cad expression domains probably perturbed the adhesive code set by the differential expression of E- and N-cad during gastrulation. In teratomas obtained with homozygous N-cad-GFP ES cells we observed various epithelial structures, such as keratinized, gland or respiratory epithelia, in the tumors that expressed N-cad. Thus, although N-cad cannot substitute for E-cad during trophectoderm differentiation, it is sufficient for epithelial formation during tumor growth. Teratomas are generated by subcutaneous injection of clumps of ES cells. The epithelial structures generated during tumor growth may be less differentiated or subject to only weak mechanical stress. By contrast, the trophectoderm is a highly specialized epithelium that must form a dense cell layer to resist the increased pressure generated by the blastocoel fluid. N-cad may not provide sufficient adhesive force to substitute for E-cad, underlining the specific requirement for E-cad for the differentiation and maintenance of the trophectodermal epithelial cell layer. It is possible that only E-cad is capable of ensuring correct assembly of the cytoskeleton and cytoskeleton-associated proteins for the cytodifferentiation processes required for a functional trophectoderm. Alternatively, E-cad may exhibit additional specific signaling functions that N-cad cannot provide.
These E-cad-specific structural and/or signaling requirements could reside in the extracellular or intracellular part of the protein. Thus, it will be of interest to analyze chimeric proteins composed of the extracellular portion of N-cad with the intracellular domain of E-cad, and vice-versa. When we designed the Ncad k.i. experiments, we did not anticipate such an early phenotype. We reasoned that adding N-cad to the maternal E-cad might allow early development to proceed. It remains possible that N-cad is not compatible with trophectodermal epithelial differentiation, or may even be inhibitory to this process. However, our results clearly demonstrate the specific function of E-cad during preimplantation development and provide the first in vivo evidence that E-cad and N-cad are not interchangeable in developmental processes.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/1/31/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Aberle, H., Schwartz, H. and Kemler, R. (1996).
Cadherin-catenin complex: protein interactions and their implications for
cadherin function. J. Cell Biochem.
61,514
-523.[CrossRef][Medline]
Anastasiadis, P. Z. and Reynolds, A. B. (2000).
The p120 catenin family: complex roles in adhesion, signaling and cancer.
J. Cell Sci. 113,1319
-1334.[Abstract]
Andreoli, C., Martin, M., Le Borgne, R., Reggio, H. and Mangeat,
P. (1994). Ezrin has properties to self-associate at the
plasma membrane. J. Cell Sci.
107,2509
-2521.[Abstract]
Batlle, E., Henderson, J. T., Beghtel, H., van den Born, M. M.,
Sancho, E., Huls, G., Meeldijk, J., Robertson, J., van de Wetering, M.,
Pawson, T. et al. (2002). Beta-catenin and TCF mediate cell
positioning in the intestinal epithelium by controlling the expression of
EphB/ephrinB. Cell 111,251
-263.[CrossRef][Medline]
Baumgartner, W., Hinterdorfer, P., Ness, W., Raab, A.,
Vestweber, D., Schindler, H. and Drenckhahn, D. (2000).
Cadherin interaction probed by atomic force microscopy. Proc. Natl.
Acad. Sci. USA 97,4005
-4010.
Beck, F., Chawengsaksophak, K., Luckett, J., Giblett, S., Tucci,
J., Brown, J., Poulsom, R., Jeffery, R. and Wright, N. A.
(2003). A study of regional gut endoderm potency by analysis of
Cdx2 null mutant chimaeric mice. Dev. Biol.
255,399
-406.[CrossRef][Medline]
Boussadia, O., Kutsch, S., Hierholzer, A., Delmas, V. and
Kemler, R. (2002). E-cadherin is a survival factor for the
lactating mouse mammary gland. Mech. Dev.
115, 53-62.[CrossRef][Medline]
Braga, V. M., Del Maschio, A., Machesky, L. and Dejana, E.
(1999). Regulation of cadherin function by Rho and Rac:
modulation by junction maturation and cellular context. Mol. Biol.
Cell 10,9
-22.
Butz, S. and Larue, L. (1995). Expression of
catenins during mouse embryonic development and in adult tissues.
Cell Adhes. Commun. 3,337
-352.[Medline]
Byers, S., Amaya, E., Munro, S. and Blaschuk, O.
(1992). Fibroblast growth factor receptors contain a conserved
HAV region common to cadherins and influenza strain A hemagglutinins: a role
in protein-protein interactions? Dev. Biol.
152,411
-414.[CrossRef][Medline]
Cepek, K. L., Shaw, S. K., Parker, C. M., Russell, G. J.,
Morrow, J. S., Rimm, D. L. and Brenner, M. B. (1994).
Adhesion between epithelial cells and T lymphocytes mediated by E-cadherin and
the alpha E beta 7 integrin. Nature
372,190
-193.[CrossRef][Medline]
Christofori, G. and Semb, H. (1999). The role
of the cell-adhesion molecule E-cadherin as a tumour-suppressor gene.
Trends Biochem. Sci. 24,73
-76.[CrossRef][Medline]
Chu, Y. S., Thomas, W. A., Eder, O., Pincet, F., Perez, E.,
Thiery, J. P. and Dufour, S. (2004). Force measurements in
E-cadherin-mediated cell doublets reveal rapid adhesion strengthened by actin
cytoskeleton remodeling through Rac and Cdc42. J. Cell
Biol. 167,1183
-1194.
Chu, Y. S., Eder, O., Thomas, W. A., Simcha, I., Pincet, F.,
Ben-Ze'ev, A., Perez, E., Thiery, J. P. and Dufour, S.
(2006). Prototypical type I E-cadherin and type II cadherin-7
mediate very distinct adhesiveness through their extracellular domains.
J. Biol. Chem. 281,2901
-2910.
Corps, E., Carter, C., Karecla, P., Ahrens, T., Evans, P. and
Kilshaw, P. (2001). Recognition of E-cadherin by integrin
alpha(E)beta(7): requirement for cadherin dimerization and implications for
cadherin and integrin function. J. Biol. Chem.
276,30862
-30870.
De Vries, W. N., Evsikov, A. V., Haac, B. E., Fancher, K. S.,
Holbrook, A. E., Kemler, R., Solter, D. and Knowles, B. B.
(2004). Maternal beta-catenin and E-cadherin in mouse
development. Development
131,4435
-4445.
Doetschman, T. C., Eistetter, H., Katz, M., Schmidt, W. and
Kemler, R. (1985). The in vitro development of
blastocyst-derived embryonic stem cell lines: formation of visceral yolk sac,
blood islands and myocardium. J. Embryol. Exp.
Morphol. 87,27
-45.[Medline]
Duguay, D., Foty, R. A. and Steinberg, M. S.
(2003). Cadherin-mediated cell adhesion and tissue segregation:
qualitative and quantitative determinants. Dev. Biol.
253,309
-323.[CrossRef][Medline]
Ehrlich, J. S., Hansen, M. D. and Nelson, W. J.
(2002). Spatio-temporal regulation of Rac1 localization and
lamellipodia dynamics during epithelial cell-cell adhesion. Dev.
Cell 3,259
-270.[CrossRef][Medline]
Fedor-Chaiken, M., Hein, P. W., Stewart, J. C., Brackenbury, R.
and Kinch, M. S. (2003). E-cadherin binding modulates EGF
receptor activation. Cell Commun. Adhes.
10,105
-118.[Medline]
Fleming, T. P., Butler, L., Lei, X., Collins, J., Javed, Q.,
Sheth, B., Stoddart, N., Wild, A. and Hay, M. (1994).
Molecular maturation of cell adhesion systems during mouse early development.
Histochemistry 101,1
-7.[CrossRef][Medline]
Gumbiner, B. M. (1996). Cell adhesion: the
molecular basis of tissue architecture and morphogenesis.
Cell 84,345
-357.[CrossRef][Medline]
Gumbiner, B. M. (2005). Regulation of
cadherin-mediated adhesion in morphogenesis. Nat. Rev. Mol. Cell
Biol. 6,622
-634.[Medline]
Hatta, K. and Takeichi, M. (1986). Expression
of N-cadherin adhesion molecules associated with early morphogenetic events in
chick development. Nature
320,447
-449.[CrossRef][Medline]
Hazan, R. B. and Norton, L. (1998). The
epidermal growth factor receptor modulates the interaction of E-cadherin with
the actin cytoskeleton. J. Biol. Chem.
273,9078
-9084.
Hazan, R. B., Phillips, G. R., Qiao, R. F., Norton, L. and
Aaronson, S. A. (2000). Exogenous expression of N-cadherin in
breast cancer cells induces cell migration, invasion, and metastasis.
J. Cell Biol. 148,779
-790.
Hazan, R. B., Qiao, R., Keren, R., Badano, I. and Suyama, K.
(2004). Cadherin switch in tumor progression. Ann. N.
Y. Acad. Sci. 1014,155
-163.[CrossRef][Medline]
Hiiragi, T. and Solter, D. (2004). First
cleavage plane of the mouse egg is not predetermined but defined by the
topology of the two apposing pronuclei. Nature
430,360
-364.[CrossRef][Medline]
Hoschuetzky, H., Aberle, H. and Kemler, R.
(1994). Beta-catenin mediates the interaction of the
cadherin-catenin complex with epidermal growth factor receptor. J.
Cell Biol. 127,1375
-1380.
Islam, S., Carey, T. E., Wolf, G. T., Wheelock, M. J. and
Johnson, K. R. (1996). Expression of N-cadherin by human
squamous carcinoma cells induces a scattered fibroblastic phenotype with
disrupted cell-cell adhesion. J. Cell Biol.
135,1643
-1654.
Kanzler, B., Haas-Assenbaum, A., Haas, I., Morawiec, L., Huber,
E. and Boehm, T. (2003). Morpholino oligonucleotide-triggered
knockdown reveals a role for maternal E-cadherin during early mouse
development. Mech. Dev.
120,1423
-1432.[CrossRef][Medline]
Kemler, R. (1993). From cadherins to catenins:
cytoplasmic protein interactions and regulation of cell adhesion.
Trends Genet. 9,317
-321.[CrossRef][Medline]
Kemler, R., Babinet, C., Eisen, H. and Jacob, F.
(1977). Surface antigen in early differentiation.
Proc. Natl. Acad. Sci. USA
74,4449
-4452.
Kemler, R., Brulet, P., Schnebelen, M. T., Gaillard, J. and
Jacob, F. (1981). Reactivity of monoclonal antibodies against
intermediate filament proteins during embryonic development. J.
Embryol. Exp. Morphol. 64,45
-60.[Medline]
Koch, A. W., Manzur, K. L. and Shan, W. (2004).
Structure-based models of cadherin-mediated cell adhesion: the evolution
continues. Cell Mol. Life Sci.
61,1884
-1895.[Medline]
Kuhn, R., Rajewsky, K. and Muller, W. (1991).
Generation and analysis of interleukin-4 deficient mice.
Science 254,707
-710.
Larue, L., Ohsugi, M., Hirchenhain, J. and Kemler, R.
(1994). E-cadherin null mutant embryos fail to form a
trophectoderm epithelium. Proc. Natl. Acad. Sci. USA
91,8263
-8267.
Li, G. and Herlyn, M. (2000). Dynamics of
intercellular communication during melanoma development. Mol. Med.
Today 6,163
-169.[CrossRef][Medline]
Lickert, H., Bauer, A., Kemler, R. and Stappert, J.
(2000). Casein kinase II phosphorylation of E-cadherin increases
E-cadherin/beta-catenin interaction and strengthens cell-cell adhesion.
J. Biol. Chem. 275,5090
-5095.
Lilien, J., Balsamo, J., Arregui, C. and Xu, G.
(2002). Turn-off, drop-out: functional state switching of
cadherins. Dev. Dyn.
224, 18-29.[CrossRef][Medline]
Louvet, S., Aghion, J., Santa-Maria, A., Mangeat, P. and Maro,
B. (1996). Ezrin becomes restricted to outer cells following
asymmetrical division in the preimplantation mouse embryo. Dev.
Biol. 177,568
-579.[CrossRef][Medline]
Luo, Y., Ferreira-Cornwell, M., Baldwin, H., Kostetskii, I.,
Lenox, J., Lieberman, M. and Radice, G. (2001). Rescuing the
N-cadherin knockout by cardiac-specific expression of N- or E-cadherin.
Development 128,459
-469.[Abstract]
Miyatani, S., Shimamura, K., Hatta, M., Nagafuchi, A., Nose, A.,
Matsunaga, M., Hatta, K. and Takeichi, M. (1989). Neural
cadherin: role in selective cell-cell adhesion.
Science 245,631
-635.
Niessen, C. M. and Gumbiner, B. M. (2002).
Cadherin-mediated cell sorting not determined by binding or adhesion
specificity. J. Cell Biol.
156,389
-399.
Nollet, F., Berx, G. and van Roy, F. (1999).
The role of the E-cadherin/catenin adhesion complex in the development and
progression of cancer. Mol. Cell Biol. Res. Commun.
2, 77-85.[CrossRef][Medline]
Nose, A., Tsuji, K. and Takeichi, M. (1990).
Localization of specificity determining sites in cadherin cell adhesion
molecules. Cell 61,147
-155.[CrossRef][Medline]
Ohsugi, M., Larue, L., Schwarz, H. and Kemler, R.
(1997). Cell-junctional and cytoskeletal organization in mouse
blastocysts lacking E-cadherin. Dev. Biol.
185,261
-271.[CrossRef][Medline]
Ozawa, M., Baribault, H. and Kemler, R. (1989).
The cytoplasmic domain of the cell adhesion molecule uvomorulin associates
with three independent proteins structurally related in different species.
EMBO J. 8,1711
-1717.[Medline]
Perret, E., Benoliel, A. M., Nassoy, P., Pierres, A., Delmas,
V., Thiery, J. P., Bongrand, P. and Feracci, H. (2002). Fast
dissociation kinetics between individual E-cadherin fragments revealed by flow
chamber analysis. EMBO J.
21,2537
-2546.[CrossRef][Medline]
Radice, G. L., Rayburn, H., Matsunami, H., Knudsen, K. A.,
Takeichi, M. and Hynes, R. O. (1997). Developmental defects
in mouse embryos lacking N-cadherin. Dev. Biol.
181, 64-78.[CrossRef][Medline]
Sambrook, J. and Russell, D. (1994).
Molecular Cloning: A Laboratory Manual. Cold Spring
Harbor: Cold Spring Harbor Laboratory Press.
Schwenk, F., Baron, U. and Rajewsky, K. (1995).
A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene
segments including deletion in germ cells. Nucleic Acids
Res. 23,5080
-5081.
Shapiro, L., Fannon, A. M., Kwong, P. D., Thompson, A., Lehmann,
M. S., Grubel, G., Legrand, J. F., Als-Nielsen, J., Colman, D. R. and
Hendrickson, W. A. (1995). Structural basis of cell-cell
adhesion by cadherins. Nature
374,327
-337.[CrossRef][Medline]
Sheth, B., Fontaine, J. J., Ponza, E., McCallum, A., Page, A.,
Citi, S., Louvard, D., Zahraoui, A. and Fleming, T. P.
(2000). Differentiation of the epithelial apical junctional
complex during mouse preimplantation development: a role for rab13 in the
early maturation of the tight junction. Mech. Dev.
97, 93-104.[CrossRef][Medline]
Sivasankar, S., Gumbiner, B. and Leckband, D.
(2001). Direct measurements of multiple adhesive alignments and
unbinding trajectories between cadherin extracellular domains.
Biophys. J. 80,1758
-1768.
Soriano, P. (1999). Generalized lacZ expression
with the ROSA26 Cre reporter strain. Nat. Genet.
21, 70-71.[CrossRef][Medline]
Stemmler, M. P., Hecht, A., Kinzel, B. and Kemler, R.
(2003). Analysis of regulatory elements of E-cadherin with
reporter gene constructs in transgenic mouse embryos. Dev.
Dyn. 227,238
-245.[CrossRef][Medline]
Stemmler, M. P., Hecht, A. and Kemler, R.
(2005). E-cadherin intron 2 contains cis-regulatory elements
essential for gene expression. Development
132,965
-976.
Suyama, K., Shapiro, I., Guttman, M. and Hazan, R. B.
(2002). A signaling pathway leading to metastasis is controlled
by N-cadherin and the FGF receptor. Cancer Cell
2, 301-314.[CrossRef][Medline]
Takeichi, M. (1988). The cadherins: cell-cell
adhesion molecules controlling animal morphogenesis.
Development 102,639
-655.
Tomita, K., van Bokhoven, A., van Leenders, G. J., Ruijter, E.
T., Jansen, C. F., Bussemakers, M. J. and Schalken, J. A.
(2000). Cadherin switching in human prostate cancer progression.
Cancer Res. 60,3650
-3654.
Vestweber, D. and Kemler, R. (1984). Rabbit
antiserum against a purified surface glycoprotein decompacts mouse
preimplantation embryos and reacts with specific adult tissues.
Exp. Cell Res. 152,169
-178.[CrossRef][Medline]
Wilkinson, D. and Green, J. (1990). In situ
hybridization and three-dimensional reconstruction of serial sections. In
Postimplantation Mouse Embryos: A Practical Approach
(ed. D. Rickwood and D. L. Cockcroft), pp. 155-171.
Oxford: IRL Press.
Williams, E. J., Furness, J., Walsh, F. S. and Doherty, P.
(1994). Activation of the FGF receptor underlies neurite
outgrowth stimulated by L1, N-CAM, and N-cadherin.
Neuron 13,583
-594.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
E. Stepniak, G. L. Radice, and V. Vasioukhin Adhesive and Signaling Functions of Cadherins and Catenins in Vertebrate Development Cold Spring Harb Perspect Biol, November 1, 2009; 1(5): a002949 - a002949. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yagi, M. J. Kohn, I. Karavanova, K. J. Kaneko, D. Vullhorst, M. L. DePamphilis, and A. Buonanno Transcription factor TEAD4 specifies the trophectoderm lineage at the beginning of mammalian development Development, November 1, 2007; 134(21): 3827 - 3836. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||