|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online December 12, 2006
doi: 10.1242/10.1242/dev.02712
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Columbia University, College of Physicians and Surgeons, Department of Genetics and Development, 701 W. 168th St., New York, NY 10032, USA.
* Author for correspondence (e-mail: vep1{at}columbia.edu)
Accepted 24 October 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Tbx4, Hindlimb, Limb, T-box, Tbx5, Fgf10, Mouse
| INTRODUCTION |
|---|
|
|
|---|
The T-box family is an evolutionarily ancient family of transcription
factors characterized by a shared DNA-binding domain. Several T-box genes are
expressed in the limb (Naiche et al.,
2005
), and heterozygous mutations in TBX3, TBX4 and
TBX5 cause limb defects in humans
(Bamshad et al., 1997
;
Basson et al., 1997
;
Bongers et al., 2004
). In
mouse, all of the Tbx2 subfamily (Tbx2, Tbx3, Tbx4 and Tbx5)
have been shown to play roles in limb development
(Agarwal et al., 2003
;
Davenport et al., 2003
;
Harrelson et al., 2004
;
Naiche and Papaioannou, 2003
).
Tbx5 is expressed specifically in the forelimb, while Tbx4,
a closely related gene, is expressed in the hindlimb. Both genes are expressed
in their respective limb fields well before the morphological appearance of
the limb bud and continue to be expressed throughout the limb mesenchyme
through late gestation (Gibson-Brown et
al., 1996
). Due to this differential and early expression, it has
been proposed that Tbx4 and Tbx5 play central roles in
creating the differences between forelimbs and hindlimbs, and several
experiments in chick have suggested that ectopic expression of these genes can
transform limb fates (Rodriguez-Esteban et
al., 1999
; Takeuchi et al.,
1999
; Takeuchi et al.,
2003
). However, these experiments were complicated by the
expression of endogenous Tbx4 and Tbx5. More recent work in
which Tbx5 was replaced with Tbx4 has suggested that
Tbx4 and Tbx5 can substitute for each other and serve little
or no role in establishing the differences between limbs
(Minguillon et al., 2005
).
Tbx5 plays a crucial role in the initiation of the forelimb bud.
Null alleles of Tbx5 in mouse and zebrafish result in embryos that
show no forelimb bud formation and do not express Fgf10 in the
forelimb field (Agarwal et al.,
2003
; Garrity et al.,
2002
; Ng et al.,
2002
; Rallis et al.,
2003
). Several lines of evidence have been used to show that
Tbx5 mediates limb outgrowth through direct transcriptional
regulation of Fgf10 (Agarwal et
al., 2003
; Ng et al.,
2002
), and experiments with a presumed dominant negative allele of
Tbx5 suggest that loss of this gene during limb development truncates
limb outgrowth (Rallis et al.,
2003
). The high conservation, similar expression pattern and
functional redundancy between Tbx4 and Tbx5 strongly suggest
that Tbx4 would operate similarly in the hindlimb. However, our
previous work has shown that null mutations in Tbx4 produce a
slightly different limb phenotype than Tbx5 null mutations, in that
Fgf10 expression is initiated in the hindlimb field of Tbx4
mutant embryos and a morphological bud is formed, but the hindlimb bud does
not maintain Fgf10 expression or grow in explant cultures
(Naiche and Papaioannou,
2003
). However, embryonic lethality of the Tbx4 null
mutation due to failure of chorioallantoic fusion prevented our examining limb
outgrowth in vivo.
In this study we exploit a conditional allele of Tbx4 to circumvent allantois failure and extend our data on the phenotype of Tbx4 null hindlimbs. As Tbx4 and Tbx5 have subtly different roles in limb bud initiation, we investigated whether loss of Tbx4 during later limb development also results in limb truncation, similar to the dominant-negative Tbx5, by ablating Tbx4 gene function at multiple stages of limb development. Our findings indicate that early expression of Tbx4 is required for maintaining proximal and medial limb tissue, but does not solely regulate Fgf10 or limb outgrowth. Examination of hindlimbs that had lost Tbx4 function revealed no role for Tbx4 in hindlimb identity.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Mouse strains, mating and embryo collection
The Rosa-ERcreT2 (de
Luca et al., 2005
) and Prx-cre
(Logan et al., 2002
) lines
were the kind gifts of Thomas Ludwig and Cliff Tabin, respectively. The
EIIa-cre line was obtained from Jackson Labs (strain #003314). All
mice were kept on outbred backgrounds. The dark period was 19.00 to 05.00 h
and noon on the day a mating plug was observed was identified as embryonic day
(E) 0.5. Yolk sacs were used for genotyping.
ERcre induction via tamoxifen
Tamoxifen (Sigma #T5648, 20 mg/ml in sunflower oil) was administered via
intraperitoneal injection. At E7.5, 6 mg (approximately 0.18 mg/g body weight)
was administered between 17.30 and 23.30 h. At E9.5 and later time points, 7
mg was administered between 17.30 and 19.30 h.
Embryo genotyping
Embryos from Tbx4cond/cond; Rosa-ERcre matings
were examined for the recombination of Tbx4cond into
Tbx4tm1.1Pa (the null allele) using primers A and B
(above) in combination with the excision-specific primer C:
TCATCTAGGCTTCACAGCC. For Prx-cre crosses, all embryos were genotyped
for wild type, Tbx4tm1.1Pa, and
Tbx4cond alleles using primers A, B and C as well as for
the presence of Prx-cre (using primers CGATGCAACGAGTGATGAGG and
GCATTGCTGTCACTTGGTCGT). Quantitation of alleles in
Fig. 1 was done using primers
A, B and C with a graded series of mixed DNA of known composition prepared
identically to sample DNA.
Marker analysis
Whole-mount in situ hybridization was performed according to standard
protocols (Wilkinson and Nieto,
1993
). Two to five embryos were used for each marker and stage.
Alcian Blue and Alcian Blue/Alizarin Red skeletal preparations were performed
according to standard protocols (Nagy et
al., 2003
), with the modification that Alcian Blue stain in the
latter protocol was prepared at 150 mg/l in 80% ethanol, 20% acetic acid.
Limb measurements and cell counts
Limb widths were determined by photographing the dorsal aspect of each limb
and measuring across the widest part of the limb perpendicular to the
proximodistal axis. Cell counts were obtained by dissecting off limbs,
dissociating the tissue with 2 µg/ml collagenase for 1 hour at 37°C and
counting cells using a hemacytometer. The mitotic index of the progress zone
was computed by staining sections with anti-phosphohistone H3 (Upstate),
counterstaining with Nuclear Fast Red and counting nuclei in the area 150
µm subjacent to the AER in the center of the limb. Cell death was assessed
by incubating live embryos in 5 µmol/l Lysotracker Red (Invitrogen L7528)
in Hank's balanced salt solution for 30 minutes at 37°C.
| RESULTS |
|---|
|
|
|---|
Ablation of Tbx4 before hindlimb development
In experiments with the Rosa-ERcre transgene, we compared
Tbx4cond/cond embryos (control) to
Tbx4cond/cond; Rosa-ERcre/+ embryos (hereafter
referred to as ERcre embryos) to ensure that the effects we saw were
not due to either the Tbx4cond allele or to tamoxifen
administration. During these experiments, we noted that Cre activity from the
Rosa-ERcre caused apoptosis and fetal lethality, which will be
described elsewhere, so we also examined Tbx4cond/+;
Rosa-ERcre/+ embryos to ensure that the observed phenotypes were due
to the loss of Tbx4 rather than the effects of Cre activity. To first
verify that excision of Tbx4cond produced the expected
phenotype, we administered tamoxifen at E6.5, approximately 24 hours before
expression of Tbx4 is seen in any tissue. ERcre embryos
(n=19) were indistinguishable from Tbx4 null embryos and
died at E10.5 due to failure of chorioallantoic fusion (data not shown).
We then administered tamoxifen at E7.5 to excise Tbx4 after the initial formation of the allantois, but before expression appeared in the hindlimb field. Tamoxifen injections at E7.5 resulted in complete excision of Tbx4 within 24 hours (Fig. 1B), well before hindlimb expression appeared at E9.5. Approximately half of the ERcre embryos recapitulated the null phenotype, while the remaining ERcre embryos underwent allantoic fusion and survived past E10.5. In these embryos, a visible limb bud was formed but was degenerating by E11.5 (Fig. 2A,B). Early limb markers in ERcre embryos injected with tamoxifen at E7.5 were identical to those of Tbx4 null embryos: at E10.0 Fgf10 was weakly expressed in the hindlimb field (Fig. 2C,D) and sporadic Fgf8 was seen in the AER (Fig. 2E,F), but Fgf10 was lost from the hindlimb bud by E10.5 (Fig. 2G,H).
|
|
Cartilage stains were done on E14.5 embryos from tamoxifen injections at all of the above stages (Fig. 3H-J). Abnormal pelvic connections were seen in ERcre embryos from E10.5 and 9.5 tamoxifen injections (Fig. 3I,J). No defects were observed in the forelimbs of any embryos (Fig. 3K,L) or in hindlimbs of embryos injected at E11.5 (data not shown). Cre-expressing Tbx4 heterozygous embryos given tamoxifen at E9.5 developed hindlimbs identical to control embryos, demonstrating that Cre activity produced no hindlimb defects when an intact copy of Tbx4 was present (Fig. 3M,N). However, hindlimbs from ERcre embryos injected at E10.5 and 9.5 had hypoplastic pelvises and fibulas, aplastic or severely hypoplastic femurs, which did not articulate with the pelvis, and abnormal anterior digits (Fig. 3O-T). In some ERcre embryos from E10.5 injections digit formation was normal, but in some of these embryos the hindlimb digits I and II were thinner than controls and the metatarsal of the first digit appeared to originate near the middle of the metatarsal of digit II instead of near the tarsal bones (Fig. 3Q). The autopod of some ERcre embryos injected at E9.5 had thin and partially fused digits I and II (Fig. 3R), similar to E10.5 injections, while others had four-digit autopods, representing either a complete fusion between digits I and II or the loss of digit II (Fig. 3S). In some embryos, soft-tissue fusion appeared to have occurred between digits II and III (Fig. 3G and data not shown), but no fusion between the skeletal elements of digits II and III were ever observed. Despite the obvious abnormalities, all skeletal elements formed in ERcre embryos injected at E9.5, including the most distal phalanges, revealing no outgrowth requirement for Tbx4.
Hindlimb identity in Tbx4-ablated hindlimbs
Our previous work with the null allele showed that Tbx4 is not
required for the initial expression of hindlimb identity markers at E10.5, but
we could not evaluate the maintenance of hindlimb identity in the absence of
Tbx4 due to the failure of hindlimb outgrowth. Using
Tbx4cond we examined hindlimb identity in ERcre
embryos injected with tamoxifen at E9.5.
In normal E14.5 embryos, all forelimb skeletal elements reside in the same plane (Fig. 3K), whereas hindlimb skeletal elements rotate such that the femur were nearly perpendicular to the plane of the tibia and footplate (Fig. 3O). In ERcre embryos, the relative positions of the pelvis and distal limb elements clearly indicated a hindlimb-like orientation (Fig. 3S,T). Additionally, the carpal bones of the normal forelimb are short (Fig. 3K), while the homologous tarsals in the normal hindlimb form two noticeably longer bones, the talus and the calcaneus. ERcre hindlimbs showed evident formation of the talus and calcaneus (black arrowheads in Fig. 3O,S).
Tbx4 itself is a marker of hindlimb identity, so the expression of
this gene was examined using a probe 3' of the deleted region (3'
probe, Fig. 1A). Tbx4
was expressed robustly throughout the hindlimbs of ERcre embryos at
all stages examined (Fig. 4A-D
and data not shown). Tbx5 is a marker of forelimb identity, and some
evidence suggests that Tbx4 and Tbx5 function
antagonistically to exclude each other from their respective limbs
(Takeuchi et al., 1999
).
However, Tbx5 was maintained exclusively in the forelimb of
ERcre embryos at least 3 days after Tbx4 function had been
lost (Fig. 4E-H). Recent
evidence suggests that Pitx1 is a major determinant of hindlimb
identity (Logan and Tabin,
1999
; Minguillon et al.,
2005
), and this gene was maintained in ERcre hindlimbs at
all stages examined (Fig.
4I-L). A more downstream reporter of hindlimb fate,
Hoxc9, was also maintained in embryos that had lost Tbx4
gene function (Fig. 4M-P). By
both molecular and morphological markers, we found no evidence for a role for
Tbx4 in determining hindlimb identity.
|
The timing of the appearance and growth of the hindlimb buds at E10.5 did not vary between control and ERcre embryos (data not shown). To determine the presence of the ZPA, we first examined the expression of Shh in the limb. Shh was expressed in posterior mesenchyme of E10.5 and 11.5 hindlimbs and was not appreciably different in ERcre embryos (Fig. 5A-B'). To observe the effects of Shh signaling, we examined the expression of Ptc (Ptch1 - Mouse Genome Informatics), a Shh response gene. Ptc appeared in its normal domain in both E10.5 and 11.5 ERcre hindlimbs, but by E11.5 this domain encompassed a larger proportion of the hindlimb (Fig. 5C-D'). We also examined dHand, which is both required for and dependent on Shh signaling, and found a similar result, with normal expression in E10.5 ERcre embryos and a normal-sized expression domain in E11.5 ERcre embryos, but with that domain encompassing more of the hindlimb (Fig. 5E-F'). The expression domains of Ptc and dHand at E12.5 were also normally sized but comprised a greater proportion of the hindlimb in ERcre embryos than in controls (data not shown).
|
As both anterior and posterior limb markers are present in ERcre hindlimbs, we examined the limb margins using Tbx2 and Tbx3. Both these genes were expressed normally in E10.5 ERcre embryos (data not shown). At E11.5, Tbx2 and Tbx3 were expressed in both the anterior and posterior margin of the limb mesenchyme of control embryos (Fig. 5I,K). In ERcre hindlimbs, these expression domains were present and normally sized, but the space between them was obviously narrower, suggesting that there is less tissue in the medial core of the limb (Fig. 5J,L). This was confirmed by cell counts, which showed that the hindlimbs of ERcre embryos contained significantly fewer cells (2.8±1.0x106, n=12) than control hindlimbs (4.3±1.1x106, n=13) with a confidence interval of P<0.015, while forelimbs showed no significant difference (4.2±1.0x106 and 5.2±1.2x106 cells, respectively). In addition, forelimb width was similar between E11.5 control and ERcre embryos, but the ratio of hindlimb to forelimb width was significantly lower in ERcre embryos, with a confidence interval of P<0.0001 (Fig. 5S). This loss of limb core tissue explains the apparent expansion of Shh responsive genes across the limb, as posterior signaling will reach proportionately farther across a thinner limb.
Tbx15, the loss of which has been shown to decrease proliferation
in the limb core (Singh et al.,
2005
), was normal in ERcre embryos, indicating that the
loss of limb core in Tbx4 mutants occurs along a different pathway
(Fig. 5N,O). Bone morphogenetic
proteins (Bmps) have multiple roles in limb development, including AER
maintenance, skeletal formation and apoptosis of interdigital regions
(Capdevila and Izpisua-Belmonte,
2001
), and Bmps are known to interact with T-box genes in several
systems (Papaioannou and Goldin,
2003
). Because post-bud Tbx4 ablation causes aberrant
hindlimb digit formation, we looked at both early and late Bmp expression. The
Bmp2 and Bmp4 expression domains were normal in
ERcre embryos at E10.5 and 11.5, although they also suffered from a
loss of medial non-expressing tissue (Fig.
5O,P and data not shown). In E13.5 ERcre embryos,
interdigital expression of Bmp2 was distally restricted in the
anterior of the hindlimb compared with control embryos, but remained present
between each digit, suggesting that the digital fusions observed are due to a
change in Bmp regulation rather than the absence of Bmp2 expression
(Fig. 5Q,R).
|
Limb outgrowth in Tbx4-ablated hindlimbs
Our previous work showed a requirement for Tbx4 in both outgrowth
and maintenance of Fgf10 expression shortly after limb initiation.
Since our current evidence showed no loss of limb outgrowth after
Tbx4 ablation at a later stage, we examined ERcre embryos
injected with tamoxifen at E9.5 for genes known to be involved in the FGF
feedback loop. Despite previous indications that Fgf10 is a direct
transcriptional target of Tbx4, we found substantially normal
expression of Fgf10 in ERcre embryos at E10.5, 11.5, 12.5
and 13.5 (Fig. 6A-H). The only
perturbation of Fgf10 was associated with digit fusion at E13.5
(Fig. 6H).
Fgf8 is the first, and only non-redundant, FGF ectodermal response to Fgf10 limb signaling and is normally expressed along the entire AER. Fgf8 expression was present in the AER of ERcre embryos at E10.5 and 11.5 (Fig. 6I-L), but close examination revealed an anterior truncation of the Fgf8 domain (Fig. 6K'-L'). This anterior loss is consistent with the anterior bias of digit loss observed in E14.5 embryos.
FGF receptor FgfR1 is known to be key in the limb FGF signaling
loop (Ciruna et al., 1997
;
Verheyden et al., 2005
), and
loss of its expression immediately after hindlimb bud formation leads to a
similar phenotype to that of Tbx4
(Li et al., 2005
). Expression
of FgfR1 was nonetheless robust throughout the hindlimbs of
ERcre embryos (Fig.
6M,N). Spry1 is a mesenchymal response to Fgf8
signaling and is thought to act as a negative regulator of FGF signaling.
Spry1 was observed in its normal domain immediately underlying the
AER in ERcre hindlimbs, although that domain was anteriorly
truncated, mirroring the truncated expression domain of Fgf8
(Fig. 6O,P). Wnt signaling is
thought to be part of the FGF limb feedback loop and regulated by
Tbx4 and Tbx5 in limbs, but the precise Wnt genes involved
are not known in mouse (Agarwal et al.,
2003
; Kawakami et al.,
2001
; Takeuchi et al.,
2003
). As a proxy, Lef1 expression, which is activated in
response to Wnt signaling, was examined. Lef1 expression was present
throughout the distal limb in both control and ERcre embryos. Thus,
all elements of the FGF limb feedback loop examined in ERcre embryos
injected at E9.5 were either expressed normally or with minor perturbations in
the anterior hindlimb.
Limb-specific deletion of Tbx4
Prx-cre drives cre expression in forelimbs and hindlimbs
(Logan et al., 2002
) and in
combination with the conditional Tbx5 allele results in pups wholly
lacking forelimbs (Rallis et al.,
2003
). To bypass the fetal lethality caused by the
Rosa-ERcre allele, we produced a limb-specific deletion of
Tbx4 by mating Tbx4cond/cond females with
Tbx4tm1.1Pa/+(null allele); Prx-cre/+ males to
generate Tbx4cond/tm1.1Pa; Prx-cre/+ embryos
(prx-cre) and Tbx4cond/+; +/+ embryos (control).
We dissected early limb bud embryos to observe the kinetics of Tbx4
excision in the presence of Prx-cre. Intact Tbx4, as
measured by the deletion-specific probe
(Fig. 1A), was significantly
downregulated but not entirely lost in advanced E10.5 prx-cre embryos
(Fig. 7A-D), indicating that
prx-cre hindlimbs express Tbx4 for longer than
ERcre hindlimbs administered tamoxifen at E9.5. Cartilage staining of
E15.5 embryos revealed that the hindlimb in prx-cre embryos had a
hypoplastic pelvis and fibula, severely hypoplastic femurs and mild or
nonexistent anterior digit fusions, consistent with the phenotype of
ERcre embryos given tamoxifen at E10.5
(Fig. 7E,F). The ilium and
ischium were identifiable, but the pubic rami were missing. At E11.5, we did
not observe any major difference in apoptotic cells in the hindlimb between
prx-cre embryos and controls (data not shown). prx-cre pups
were viable but had abnormally turned hindlimbs and abnormal pelvic regions
(Fig. 7G,H). Skeletal
preparations showed normal skeletal development in prx-cre pups
(Fig. 7I,J), but the hindlimbs
were turned nearly backwards and not articulated with the pelvis
(Fig. 7I-L). It is unclear
whether the abnormal turning of the hindlimb in prx-cre embryos is a
primary defect due to the loss of Tbx4 or secondary to the loss of
the proximal tissues as leverage points.
|
| DISCUSSION |
|---|
|
|
|---|
|
Our previous work showed no role for Tbx4 in the initial
establishment of hindlimb identity (Naiche
and Papaioannou, 2003
), and our current work shows no requirement
for Tbx4 in maintenance of hindlimb identity during later stages of
limb development. This confirms that other transcription factors, such as
Pitx1 (Minguillon et al.,
2005
), are responsible for coordinating hindlimb-specific
transcriptional regulation and morphological formation.
Tbx4 and FGF signaling
Limb outgrowth is controlled by reciprocal signaling between Fgf10
in the mesenchyme and Fgf8, Fgf4 and other Fgf genes in the AER
(Niswander, 2003
). Previous
work has suggested that Tbx5, and by implication Tbx4, is a
direct regulator of Fgf10 in the limbs
(Agarwal et al., 2003
;
Ng et al., 2002
). Although
hindlimbs that never express Tbx4 initiate low levels of
Fgf10 expression, this expression fails by early E10.5. However, as
shown by our experiments with the conditional allele, the loss of
Tbx4 at approximately E10.5 has no apparent effect on Fgf10
expression. Thus, our work conclusively shows that Tbx4 is not
required for Fgf10 expression in limb development after E10.5.
There nevertheless appear to be problems with FGF signaling in the absence
of Tbx4. Several genetic manipulations that produce a partial loss of
FGF signaling also produce limb phenotypes remarkably similar to that observed
in post-bud loss of Tbx4. Loss of FgfR1 immediately after
the initiation of hindlimb budding, approximately the same stage at which we
have ablated Tbx4, causes anterior digit fusions producing a
symmetrical four digit autopod (Li et al.,
2005
). Likewise, the loss of Fgf8 from the AER produces
hindlimbs with hypoplastic femurs and fibulas and loss of anterior digits
(Lewandoski et al., 2000
).
Other FGF perturbations have phenotypes that are more or less severe,
reflecting different degrees and timing of FGF pathway disruption
(Li et al., 2005
;
Moon and Capecchi, 2000
;
Sun et al., 2002
;
Verheyden et al., 2005
), or
that produce similar phenotypes in the forelimb
(Moon and Capecchi, 2000
).
Partial loss of FGF signaling can also produce a similar spectrum of gene
expression changes to loss of Tbx4, including loss of anterior
Fgf8 expression and expansion of Alx4
(Li et al., 2005
;
Sun et al., 2002
;
Verheyden et al., 2005
).
Narrowing of the non-expressing domain of Tbx2 and Tbx3 is
also evident in figures (Li et al.,
2005
). It is probable that the reduction we have observed in
Fgf8 is indicative of a partial loss of FGF signaling in
Tbx4-ablated hindlimbs, a difference probably so slight that it is
not observable by in situ hybridization for FGF pathway components.
Shh is thought to be repressed in the normal limb by Alx4
(Qu et al., 1997
).
Shh also induces dHand expression, which in turn is thought
to repress Alx4 (te Welscher et
al., 2002
), forming mutually exclusive domains of anterior and
posterior limb signaling. However, ablation of Tbx4 either before
limb development or during early limb development resulted in overlapping
areas of Alx4, dHand and Shh expression. As noted above,
several other disruptions of the FGF pathway cause expansion of the
Alx4 domain, suggesting that this may be a general feature of loss of
FGF signaling. It is possible that Alx4-Shh interactions are
dependent on FGF, and consequently Tbx4, function.
A model for Tbx4 and Tbx5 function in the limb
The relatively minor effect of post-initiation Tbx4 loss on FGF
signaling is inconsistent with a report using a dominant-negative allele of
Tbx5, showing that post-initiation loss of Tbx5 halts FGF
signaling and limb growth in the forelimb
(Rallis et al., 2003
). Recent
results from the same lab show that post-initiation ablation of Tbx5
function using a conditional allele does not result in limb truncations or
loss of Fgf10 (Hasson et al.,
2007
). Instead, reduction of the forelimb along the
anteroposterior axis is seen early in forelimb development, analogous to the
thinner hindlimbs seen in our corresponding Tbx4 study. This suggests
that Tbx4 and Tbx5 behave similarly in the limb, but that
dominant-negative alleles produce a different phenotype than conditional
ablation.
In order to explain this difference, we propose that regulation of
Fgf10 in the limb is regulated by (at least) two modules, one (TBE)
that is responsive to Tbx4 and Tbx5 and one (XBE) that is
responsive to an unidentified transcription factor
(Fig. 8). In the early limb
field, this hypothetical transcription factor is either absent and unnecessary
(in the forelimb) or insufficient to drive threshold levels of Fgf10
expression (in the hindlimb). Thus both limbs are dependent on Tbx4
or Tbx5 for establishment of the FGF feedback loop. Once the FGF
signaling feedback loop has been successfully set up, Tbx4 or
Tbx5 and the hypothetical transcription factor have additive effects
on total FGF signaling, so the loss of Tbx4 or Tbx5 produces
relatively mild FGF hypomorphic phenotypes. A dominant negative, where
Tbx4 or Tbx5 is fused to a transcriptional repression
domain, is capable of reducing Fgf10 transcription below threshold
levels, halting limb outgrowth. This model also agrees with in vitro data
according to which Tbx5 alone is capable of driving expression of an
Fgf10 reporter (Agarwal et al.,
2003
; Ng et al.,
2002
). The differential requirement for T-box genes between
initiation and maintenance of FGF signaling also explains the disparity in
Tbx4 and Tbx5 conditional phenotypes when combined with the
Prx-cre allele, as this transgene has been observed to start
expression relatively later in the hindlimb than in the forelimb
(Kmita et al., 2005
;
Logan et al., 2002
), and does
not seem to ablate Tbx4 gene function until after an FGF feedback
loop has formed.
There are several candidates for this proposed Fgf10 regulator.
Sall4 can drive Fgf10 limb expression and activates an
Fgf10 reporter synergistically with either Tbx4 or
Tbx5, but Sall4 expression is dependent on T-box regulation
and is a poor candidate for an independent regulator of Fgf10
(Harvey and Logan, 2006
;
Koshiba-Takeuchi et al.,
2006
). Pitx transcription factors are known to interact
directly with T-box genes (Lamolet et al.,
2001
), and double mutation of Pitx1 and Pitx2
produces a phenotype very similar to the post-initiation loss of Tbx4
(Marcil et al., 2003
), but
loss of these genes also dramatically downregulates Tbx4, suggesting
that the observed phenocopy is due to the downstream loss of Tbx4. A
better candidate is Snai1, which is expressed in the hindlimb at a
relatively earlier stage than in the forelimb, as predicted by our model, and
appears to be upstream of Fgf10
(Isaac et al., 2000
). Also as
predicted, Snai1 expression is maintained in the Tbx4 null
hindlimb field (data not shown) and could therefore drive Fgf10 in
the absence of Tbx4. Another excellent candidate is Lef1,
which can directly regulate Fgf10 in vitro
(Agarwal et al., 2003
), and is
maintained in the hindlimb after Tbx4 has been ablated.
While previous hypotheses (ours included) proposed that Tbx4 was a
`master switch' that dictated hindlimb outgrowth and identity, it now appears
that Tbx4 plays a more cooperative role in regulating these
functions. Tbx4 probably coordinates with numerous other
transcription factors to guide limb formation, but its importance should not
be underplayed. Not only is Tbx4 crucial for starting hindlimb
outgrowth and for the formation of hindlimb skeletal elements, but also it has
been conserved as a hindlimb-specific transcription factor since the evolution
of cartilaginous fish (Tanaka et al.,
2002
). Organisms that have subsequently lost hindlimbs have also
lost Tbx4 expression (Cole et al.,
2005
; Shapiro et al.,
2004
; Tanaka et al.,
2005
). This suggests that there are still roles to be discovered
for Tbx4, possibly with regards to regulation of elements of limb
development other than the skeleton.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Agarwal, P., Wylie, J. N., Galceran, J., Arkhitko, O., Li, C.,
Deng, C., Grosschedl, R. and Bruneau, B. G. (2003).
Tbx5 is essential for forelimb bud initiation following patterning of
the limb field in the mouse embryo. Development
130,623
-633.
Bamshad, M., Lin, R. C., Law, D. J., Watkins, W. S., Krakowiak,
P. A., Moore, M. E., Franceschini, P., Lala, R., Holmes, L. B., Gebuhr, T. C.
et al. (1997). Mutations in human TBX3 alter limb,
apocrine and genital development in ulnar-mammary syndrome. Nat.
Genet. 16,311
-315.[CrossRef][Medline]
Basson, C. T., Bachinsky, D. R., Lin, R. C., Levi, T., Elkins,
J. A., Soults, J., Grayzel, D., Kroumpouzou, E., Traill, T. A.,
Leblanc-Straceski, J. et al. (1997). Mutations in human
TBX5 [corrected] cause limb and cardiac malformation in Holt-Oram
syndrome. Nat. Genet.
15, 30-35.[CrossRef][Medline]
Bongers, E. M. H. F., Duijf, P. H. G., Beersum, S. E. M. v.,
Schoots, J., Kampen, A. v., Burckhardt, A., Hamel, B. C. J., Lo?an, F.,
Hoefsloot, L. H., Yntema, H. G. et al. (2004). Mutations in
the human TBX4 gene cause small patella syndrome. Am. J.
Hum. Genet. 74,1239
-1248.[CrossRef][Medline]
Capdevila, J. and Izpisua-Belmonte, J. C.
(2001). Patterning mechanisms controlling vertebrate limb
development. Annu. Rev. Cell Dev. Biol.
17, 87-132.[CrossRef][Medline]
Ciruna, B. G., Schwartz, L., Harpal, K., Yamaguchi, T. P. and
Rossant, J. (1997). Chimeric analysis of fibroblast
growth factor receptor-1 (Fgfr1) function: a role for FGFR1 in
morphogenetic movement through the primitive streak.
Development 124,2829
-2841.[Abstract]
Cole, N. J., Tanaka, M., Prescott, A. and Tickle, C.
(2005). Expression of limb initiation genes and clues to the
morphological diversification of three-spine stickleback. Curr.
Biol. 13,R951
-R952.
Davenport, T. G., Jerome-Majewska, L. A. and Papaioannou, V.
E. (2003). Mammary gland, limb, and yolk sac defects in mice
lacking Tbx3, the gene mutated in human ulnar-mammary syndrome.
Development 130,2263
-2273.
de Luca, C., Kowalski, T. J., Zhang, Y., Elmquist, J. K., Lee,
C., Kilimann, M. W., Ludwig, T., Liu, S. M. and Chua, S. C., Jr
(2005). Complete rescue of obesity, diabetes, and infertility in
db/db mice by neuron-specific LEPR-B transgenes. J. Clin.
Invest. 115,3484
-3493.[CrossRef][Medline]
Garrity, D. M., Childs, S. and Fishman, M. C.
(2002). The heartstrings mutation in zebrafish causes
heart/fin Tbx5 deficiency syndrome. Development
129,4635
-4645.
Gibson-Brown, J. J., Agulnik, S. I., Chapman, D. L., Alexiou,
M., Garvey, N., Silver, L. M. and Papaioannou, V. E. (1996).
Evidence of a role for T-box genes in the evolution of limb morphogenesis and
the specification of forelimb/hindlimb identity. Mech.
Dev. 56,93
-101.[CrossRef][Medline]
Harfe, B. D., Scherz, P. J., Nissim, S., Tian, H., McMahon, A.
P. and Tabin, C. J. (2004). Evidence for an expansion-based
temporal Shh gradient in specifying vertebrate digit identities.
Cell 118,517
-528.[CrossRef][Medline]
Harrelson, Z., Kelly, R. G., Goldin, S. N., Gibson-Brown, J. J.,
Bollag, R. J., Silver, L. M. and Papaioannou, V. E. (2004).
Tbx2 is essential for patterning the atrioventricular canal and for
morphogenesis of the outflow tract during heart development.
Development 131,5041
-5052.
Harvey, S. A. and Logan, M. P. (2006).
sall4 acts downstream of tbx5 and is required for pectoral
fin outgrowth. Development
133,1165
-1173.
Hasson, P., Del Buono, J. and Logan, M. (2007).
Tbx5 is dispensable for forelimb outgrowth. Development
134, 85-92.
Isaac, A., Cohn, M. J., Ashby, P., Ataliotis, P., Spicer, D. B.,
Cooke, J. and Tickle, C. (2000). FGF and genes encoding
transcription factors in early limb specification. Mech.
Dev. 93,41
-48.[CrossRef][Medline]
Kawakami, Y., Capdevila, J., Buscher, D., Itoh, T., Rodriguez
Esteban, C. and Izpisua Belmonte, J. C. (2001). WNT signals
control FGF-dependent limb initiation and AER induction in the chick embryo.
Cell 104,891
-900.[CrossRef][Medline]
Kmita, M., Tarchini, B., Zakany, J., Logan, M. P., Tabin, C. J.
and Duboule, D. (2005). Early developmental arrest of
mammalian limbs lacking HoxA/HoxD gene function.
Nature 435,1113
-1116.[CrossRef][Medline]
Koshiba-Takeuchi, K., Takeuchi, J. K., Arruda, E. P., Kathiriya,
I. S., Mo, R., Hui, C., Srivastava, D. and Bruneau, B. G.
(2006). Cooperative and antagonistic interactions between Sall4
and Tbx5 pattern the mouse limb and heart. Nat. Genet.
38,175
-183.[CrossRef][Medline]
Lamolet, B., Pulichino, A. M., Lamonerie, T., Gauthier, Y.,
Brue, T., Enjalbert, A. and Drouin, J. (2001). A pituitary
cell-restricted T box factor, Tpit, activates POMC transcription in
cooperation with Pitx homeoproteins. Cell
104,849
-859.[CrossRef][Medline]
Lewandoski, M., Sun, X. and Martin, G. R.
(2000). Fgf8 signalling from the AER is essential for normal limb
development. Nat. Genet.
26,460
-463.[CrossRef][Medline]
Li, C., Xu, X., Nelson, D. K., Williams, T., Kuehn, M. R. and
Deng, C. X. (2005). FGFR1 function at the earliest stages of
mouse limb development plays an indispensable role in subsequent autopod
morphogenesis. Development
132,4755
-4764.
Logan, M. and Tabin, C. J. (1999). Role of
Pitx1 upstream of Tbx4 in specification of hindlimb identity.
Science 283,1736
-1739.
Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N. and
Tabin, C. (2002). Expression of Cre recombinase in the
developing mouse limb bud driven by a Prx1 enhancer.
Genesis 33,77
-80.[CrossRef][Medline]
Marcil, A., Dumontier, E., Chamberland, M., Camper, S. A. and
Drouin, J. (2003). Pitx1 and Pitx2 are
required for development of hindlimb buds. Development
130, 45-55.
Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B.
D., Tarpley, J. E., DeRose, M. and Simonet, W. S. (1998).
Fgf-10 is required for both limb and lung development and exhibits
striking functional similarity to Drosophila branchless. Genes
Dev. 12,3156
-3161.
Minguillon, C., Del Buono, J. and Logan, M. P.
(2005). Tbx5 and Tbx4 are not sufficient to determine
limb-specific morphologies but have common roles in initiating limb outgrowth.
Dev. Cell 8,75
-84.[CrossRef][Medline]
Moon, A. M. and Capecchi, M. R. (2000). Fgf8 is
required for outgrowth and patterning of limbs. Nat.
Genet. 26,455
-459.[CrossRef][Medline]
Nagy, A., Gertsenstein, M., Vintersten, K. and Behringer, R.
(2003). Manipulating the Mouse Embryo.
Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press.
Naiche, L. A. and Papaioannou, V. E. (2003).
Loss of Tbx4 blocks hindlimb development and affects vascularization
and fusion of the allantois. Development
130,2681
-2693.
Naiche, L. A., Harrelson, Z., Kelly, R. G. and Papaioannou, V.
E. (2005). T-box genes in vertebrate development.
Annu. Rev. Genet. 39,219
-239.[CrossRef][Medline]
Ng, J. K., Kawakami, Y., Buscher, D., Raya, A., Itoh, T., Koth,
C. M., Rodriguez Esteban, C., Rodriguez-Leon, J., Garrity, D. M., Fishman, M.
C. et al. (2002). The limb identity gene Tbx5
promotes limb initiation by interacting with Wnt2b and Fgf10.Development 129,5161
-5170.
Niswander, L. (2003). Pattern formation: old
models out on a limb. Nat. Rev. Genet.
4, 133-143.[CrossRef][Medline]
Ohuchi, H., Nakagawa, T., Yamamoto, A., Araga, A., Ohata, T.,
Ishimaru, Y., Yoshioka, H., Kuwana, T., Nohno, T., Yamasaki, M. et al.
(1997). The mesenchymal factor, FGF10, initiates and maintains
the outgrowth of the chick limb bud through interaction with FGF8, an apical
ectodermal factor. Development
124,2235
-2244.[Abstract]
Papaioannou, V. E. and Goldin, S. N. (2003).
Introduction to the T-box genes and their roles in developmental signaling
pathways. In Molecular Basis of Inborn Errors of
Development (ed. C. J. Epstein, A. Wynshaw-Boris and R. P.
Erickson). Oxford, UK: Oxford University Press.
Qu, S., Niswender, K. D., Ji, Q., van der Meer, R., Keeney, D.,
Magnuson, M. A. and Wisdom, R. (1997). Polydactyly and
actopic ZPA formation in Alx-4 mutant mice.
Development 124,3999
-4008.[Abstract]
Rallis, C., Bruneau, B. G., Del Buono, J., Seidman, C. E.,
Seidman, J. G., Nissim, S., Tabin, C. J. and Logan, M. P. O.
(2003). Tbx5 is required for forelimb bud formation and
continued outgrowth. Development
130,2741
-2751.
Rodriguez-Esteban, C., Tsukui, T., Yonei, S., Magallon, J.,
Tamura, K. and Izpisua Belmonte, J. C. (1999). The T-box
genes Tbx4 and Tbx5 regulate limb outgrowth and identity.
Nature 398,814
-818.[CrossRef][Medline]
Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa,
T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N. et al.
(1999). Fgf10 is essential for limb and lung formation.
Nat. Genet. 21,138
-141.[CrossRef][Medline]
Shapiro, M. D., Marks, M. E., Peichel, C. L., Blackman, B. K.,
Nereng, K. S., Jonsson, B., Schluter, D. and Kingsley, D. M.
(2004). Genetic and developmental basis of evolutionary pelvic
reduction in threespine sticklebacks. Nature
428,717
-723.[CrossRef][Medline]
Singh, M. K., Petry, M., Haenig, B., Lescher, B., Leitges, M.
and Kispert, A. (2005). The T-box transcription factor
Tbx15 is required for skeletal development. Mech.
Dev. 122,131
-144.[CrossRef][Medline]
Sun, X., Mariani, F. V. and Martin, G. R.
(2002). Functions of FGF signalling from the apical ectodermal
ridge in limb development. Nature
418,501
-508.[CrossRef][Medline]
Takeuchi, J. K., Koshiba-Takeuchi, K., Matsumoto, K.,
Vogel-Hopker, A., Naitoh-Matsuo, M., Ogura, K., Takahashi, N., Yasuda, K. and
Ogura, T. (1999). Tbx5 and Tbx4 genes determine the wing/leg
identity of limb buds. Nature
398,810
-814.[CrossRef][Medline]
Takeuchi, J. K., Koshiba-Takeuchi, K., Suzuki, T., Kamimura, M.,
Ogura, K. and Ogura, T. (2003). Tbx5 and Tbx4 trigger limb
initiation through activation of the Wnt/Fgf signaling cascade.
Development 130,2729
-2739.
Tanaka, M., Munsterberg, A., Anderson, W. G., Prescott, A. R.,
Hazon, N. and Tickle, C. (2002). Fin development in a
cartilaginous fish and the origin of vertebrate limbs.
Nature 416,527
-531.[CrossRef][Medline]
Tanaka, M., Hale, L. A., Amores, A., Yan, Y., Cresko, W. A.,
Suzuki, T. and Postlethwait, J. H. (2005). Developmental
genetic basis for the evolution of pelvic fin loss in the pufferfish
Takifugu rubripes. Dev. Biol.
281,227
-239.[CrossRef][Medline]
te Welscher, P., Fernandez-Teran, M., Ros, M. A. and Zeller,
R. (2002). Mutual genetic antagonism involving GLI3 and dHAND
prepatterns the vertebrate limb bud mesenchyme prior to SHH signaling.
Genes Dev. 16,421
-426.
Verheyden, J. M., Lewandoski, M., Deng, C., Harfe, B. D. and
Sun, X. (2005). Conditional inactivation of Fgfr1 in mouse
defines its role in limb bud establishment, outgrowth and digit patterning.
Development 132,4235
-4245.
Wilkinson, D. G. and Nieto, M. A. (1993).
Detection of messenger RNA by in situ hybridization to tissue sections and
whole mounts. Methods Enzymol.
225,361
-373.[Medline]
Xu, X., Li, C., Garrett-Beal, L., Larson, D., Wynshaw-Boris, A.
and Deng, C. X. (2001). Direct removal in the mouse of a
floxed neo gene from a three-loxP conditional knockout allele by two novel
approaches. Genesis 30,1
-6.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
V. Katsanou, S. Milatos, A. Yiakouvaki, N. Sgantzis, A. Kotsoni, M. Alexiou, V. Harokopos, V. Aidinis, M. Hemberger, and D. L. Kontoyiannis The RNA-Binding Protein Elavl1/HuR Is Essential for Placental Branching Morphogenesis and Embryonic Development Mol. Cell. Biol., May 15, 2009; 29(10): 2762 - 2776. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Tzchori, T. F. Day, P. J. Carolan, Y. Zhao, C. A. Wassif, L. Li, M. Lewandoski, M. Gorivodsky, P. E. Love, F. D. Porter, et al. LIM homeobox transcription factors integrate signaling events that control three-dimensional limb patterning and growth Development, April 15, 2009; 136(8): 1375 - 1385. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Vokes, H. Ji, W. H. Wong, and A. P. McMahon A genome-scale analysis of the cis-regulatory circuitry underlying sonic hedgehog-mediated patterning of the mammalian limb Genes & Dev., October 1, 2008; 22(19): 2651 - 2663. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Menke, C. Guenther, and D. M. Kingsley Dual hindlimb control elements in the Tbx4 gene and region-specific control of bone size in vertebrate limbs Development, August 1, 2008; 135(15): 2543 - 2553. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hasson, J. Del Buono, and M. P. O. Logan Tbx5 is dispensable for forelimb outgrowth Development, January 1, 2007; 134(1): 85 - 92. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||