|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 11 April 2007
doi: 10.1242/dev.001495
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Divisions of Pediatric Ophthalmology, Children's Hospital Research Foundation,
Cincinnati, OH45229, USA.
2 Divisions of Developmental Biology, Children's Hospital Research Foundation,
Cincinnati, OH45229, USA.
3 Department of Ophthalmology, College of Medicine, University of Cincinnati,
Cincinnati, OH45229, USA.
4 Graduate Program of Molecular and Developmental Biology, College of Medicine,
University of Cincinnati, Cincinnati, OH45229, USA.
5 Department of Pathology, University of Michigan, 109 Zina Pitcher Drive, Ann
Arbor, MI48109, USA.
6 Division of Nephrology, Children's Hospital Research Foundation, Cincinnati,
OH45229, USA.
7 Cancer and Developmental Biology Laboratory, Cell Signaling in Vertebrate
Development Section, National Cancer Institute, Frederick, MD 21701-1201,
USA.
* Author for correspondence (e-mail: Richard.Lang{at}cchmc.org)
Accepted 27 February 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Pax6, pygopus 2, Wnt, Lens induction, Mesenchyme, Neural crest, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Molecular genetic analysis has established model pathways for the
regulation of lens induction (Lang,
2004
). Currently, the apex of these pathways is occupied by the
paired and homeodomain transcription factor Pax6. Pax6 is necessary,
and in Xenopus embryo assays also sufficient, for lens induction
(Chow et al., 1999
;
Ashery-Padan et al., 2000
). In
the mouse, there are two phases of Pax6 expression in the PLE. The
early, so-called pre-placodal phase, corresponds to the head surface ectoderm
of the E8.5 mouse embryo (Grindley et al.,
1995
). Later, Pax6 is upregulated in a smaller, placodal
region domain (defined as Pax6placode). Assessment of
Pax6 transcription in the Pax6Sey-null mutant
(Hill et al., 1991
) has shown
that the placodal phase of Pax6 expression is dependent on the
pre-placodal Pax6 (Grindley et al.,
1995
; Lang, 2004
).
The placodal phase of Pax6 expression is also dependent on Fgf
receptor activity (Faber et al.,
2001
; Gotoh et al.,
2004
) and Bmp7 signaling
(Wawersik et al., 1999
), as
well as Meis family transcription factors
(Zhang et al., 2002
). It has
been shown that Bmp4 signaling regulates Sox2 expression in the
presumptive lens (Furuta and Hogan,
1998
) and that Sox2 functions in cooperation with Pax6 to regulate
some aspects of lens development (Kamachi
et al., 2001
).
The canonical Wnt pathway has a crucial role in development and disease
(Nusse, 2005
). A family of
lipid-modified Wnt ligands (Willert et
al., 2003
) can activate a receptor complex comprising a
multi-transmembrane-pass Frizzled family member and a co-receptor of the
Arrow/Lrp5/Lrp6 class (He et al.,
2004
). Activation of this complex initiates signal transduction
culminating in stabilization of ß-catenin, its association with Lef/Tcf
family transcription factors (Eastman and
Grosschedl, 1999
) and target gene regulation. The Wnt pathway is
suggested to be inhibitory to early lens development and to restrict the
region of surface ectoderm that can form lens
(Smith et al., 2005
). Defects
in the Lrp6-null mouse also suggest that Wnt signaling is required
for lens epithelial integrity and differentiation
(Stump et al., 2003
).
Pygopus was identified as a core component of the Wingless(Wg)/Wnt
signaling pathway in Drosophila
(Belenkaya et al., 2002
;
Kramps et al., 2002
;
Parker et al., 2002
;
Thompson et al., 2002
).
Pygopus exists in a complex with Armadillo/ß-catenin, Legless/Bcl9,
Pan/Tcf and parafibromin (CDC73)/Hyrax and has an essential co-activator
function (Mosimann et al.,
2006
). Pygopus incorporates N-terminal homology and plant homology
domains (NHD, PHD) crucial for activity
(Thompson, 2004
;
Tolwinski and Wieschaus, 2004
;
Townsley et al., 2004
;
Hoffmans et al., 2005
;
Stadeli and Basler, 2005
). In
the fly, pygopus loss-of-function results in many defects that are
very similar to wg loss-of-function
(Belenkaya et al., 2002
;
Parker et al., 2002
).
Morpholino inhibition studies in Xenopus have shown that the
Pygo2 orthologs Pygo2
and Pygo2ß
regulate Wnt pathway responses (Belenkaya
et al., 2002
; Lake and Kao,
2003
) as well as expression of eye markers such as Pax6,
Rx-1 and BF-1 (Lake and Kao,
2003
). Some analyses have suggested that pygopus has
functions outside the Wnt pathway
(Belenkaya et al., 2002
;
Parker et al., 2002
).
There are two pygopus homologs in the mouse: pygopus 1
(Pygo1) and pygopus 2 (Pygo2)
(Li et al., 2004
). To date,
their in vivo functions have not been investigated. Here, we examined the
consequences of germline and somatic mutation of Pygo1 and
Pygo2. Germline Pygo2 mutation results in microophthalmia
that is a consequence of a defect in lens induction. Using a series of Cre
recombinase drivers and the conditional allele for Pygo2, we show
that Pygo2 in the OM and PLE cooperate to promote lens development. Finally,
we show that although Pygo2 can regulate normal activity of the Wnt pathway in
the OM, loss of mesenchymal Wnt pathway activity has no consequence for lens
development. Combined, these data indicate that Pygo2 has a crucial, Wnt
pathway-independent role in lens induction.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-cre
(Macatee et al., 2003
Gene targeting
The Pygo1flox and Pygo2flox alleles
were generated using standard techniques
(Joyner, 1995
;
Bell et al., 2003
) with the
constructs shown (Fig. 1).
Genomic segments required for the constructs were generated by PCR from RI ES
cell DNA. For Pygo1, primers (5' to 3') used for PCR
were: 5' forward, GTGAAGGAGAGATGGATAAGTATG; 5' reverse,
TAGACCCTAACCACCT ACAAG; exon forward, GGTTAGGGTCTATGTGCTGG; exon reverse,
TCACCAAATCTCTGTTCTACAC; 3' forward, TGTGTAGAACAGAGATTTGGTG; and 3'
reverse, CAGTGAAGAAAGAGGGTCAG.
For Pygo2, primers (5' to 3') used for PCR were: GCCTGGGTTGCTTGTCTTCTG and CCACCTTACTTGTGTGTGA GGATACATAC; CCAAGTCCCAGCATCTCTTAC and CCAGTCATACCAGCAACAAG; and exon sequences TGGGTGCTGGGAACAGAAC and CAACAACAACAGAAGACAAGC.
Targeting constructs were electroporated into ES cells, selected colonies picked and expanded and ES cell lines screened for correct gene targeting as follows. For the Pygo2 gene, a 1634 bp single-copy flanking probe was prepared by PCR (using primers 5'-CTTCAACATCCACTTCTTCAGTCTTTC-3' and 5'-TGACACCCACACAGCCATCTTC-3') and used to probe a Southern blot of BstEII-digested ES DNA. An 8 kb band indicated incorrect targeting, whereas a 9.7 kb band indicated correct targeting. In addition, the Southern blot was hybridized with a neomycin resistance gene (Neo) probe to insure that there was a single insertion of the targeting construct. We also performed PCR with the primers 5'-GCTCCTTTCCCTTCCTTTTTGAG-3' and 5'-ACCAGCAACAAGAAGAATCCAGGC-3' to insure that the enclosed loxP sequence was not deleted by targeting recombination. The end of the insertion that was not confirmed by Southern blotting was checked by PCR using 5'-CTCTGATCCTCACACTTTAG-3' and 5'-GCATACATTATACGAAGTTATGG-3', which gave the 5769 bp product indicative of correct targeting. Screening of Pygo1 ES cell lines was performed by PCR only, first amplifying ES DNA with one external flanking and one internal flanking primer (5'-GCGGATAGGCAGCAGAGAACG and 5'-GGTCGGAGTTTGGATTCGGTG-3', respectively). In addition, we performed PCR with 5'-AAGCGTGCCTCATCTCCATCCCTAAG-3' and 5'-GCCCTCCCCGACGTTTATATTG-3' to confirm retention of the enclosed loxP sequence following targeting.
Germline Pygo1- and Pygo2-null alleles were generated by mating
heterozygous floxed mice with CMV-cre mice
(Schwenk et al., 1995
).
Primers used for genotyping PCR were:
Pygo2-null, forward (F) 5'-CCTGGATTCTTGTTGCTGGTATG-3' and reverse (R) 5'-AAGGTATTTGGTGCTCCGAGGG-3';
Pygo2 WT or floxed, F 5'-TGTCTTGATGACAGCGTTTAGCC-3' and R 5'-AGATTCAGTAAGCTGAGCCTGGTG-3';
Pygo1-null, F 5'-AGTTTGAAATAGCGACGAGTTTGAG-3' and R 5'-CACTTCTGCCCCTCTCTTTGC-3'; and
Pygo1 WT or floxed, F 5'-AAGCGTGCCTCATCTCCATCCCTAAG-3' and R 5'-GCCCTCCCCGACGTTTATATTG-3'.
Tissue labeling
Immunofluorescence (IF) labeling was performed as previously described
(Smith et al., 2005
). Primary
antibodies were: anti-Pax6 (1:1000, Covance PRB-278P), anti-ß-catenin
C-terminus (1:2500, Sigma C2206), anti-GFP-Alexa Fluor 594 (1:1000, Molecular
Probes A-21311), anti-ß-crystallin (1:5000, generated in our laboratory),
anti-Ap2
(1:500, Iowa Hybridoma Bank 3b5) and anti-Sox2 (1:1000,
Chemicon AB5603). Human PYGO2 antiserum (1:5000)
(Popadiuk et al., 2006
) was
pre-adsorbed with Pygo2-/- mouse embryo powder (4 mg
powder per 1 µl antisera) at 4°C for 4 hours. Alexa Fluor secondary
antibodies were used at 1:1000 to 1:8000 (A-11072, A-11020, A-11070, A-11017,
A-12381, Molecular Probes). For visualization of nuclei we used the Hoechst
33342 counterstain (Sigma B-2261). Pygo2 IF required an antigen retrieval
method as previously described (Robinson
and Vandre, 2001
). Embryos were stained for ß-galactosidase
(ß-gal) activity as described previously
(Smith et al., 2005
).
Reverse transcription-polymerase chain reaction (RT-PCR)
RNA from isolated tissues was purified using the RNAqueous-4PCR Kit (Ambion
1914) and RT-PCR performed using the OneStep RT-PCR Kit (Qiagen 210212).
Semi-nested primers were used for a second round of PCR amplification. Primers
used were: Pygo2, F 5'-CCCTGAAAAGAAGCGAAGAA-3' and R
5'-AACTTCCTCCAGCCCATTTT-3'; Pygo2, second round R
5'-AACTTCCTCCAGCCCATTTT-3'. PCR products were verified by
restriction enzyme digestion.
Quantification of lens size
Equatorial lens diameter was measured on images of E12.5 cryosections and
expressed as a ratio to optic cup diameter. The data were represented on a box
plot generated using SPSS software. Statistical significance was determined by
one-way ANOVA analysis.
Quantification of the Pax6:Ap2
IF signal ratio
To measure the level of Pax6 IF signal in lens placode, we compared the
Pax6 signal intensity with that of Ap2
, an internal, unchanging
control. Captured images were exported first to Photoshop (Adobe), where
control and mutant images from a single labeling experiment were combined.
This multi-panel figure was then exported to ImageJ, line intervals drawn
through the placodal nuclei and red and green channel intensity histograms
obtained as shown in Fig. 4M,N
and Fig. 5M,N. To normalize the
Pax6 signal to that of Ap2
, the intensity profiles for the red
(Ap2
) and green (Pax6) channels for control samples were adjusted so as
to be coincident. Since this procedure was performed on an image file that
contained both control and mutants, normalization for each was identical.
Given that intensity profiles for control samples were arbitrarily coincident,
the Pax6:Ap2
intensity ratio was close to 1. For all samples, average
intensity values from the placodal line intervals for the red and green
channels were obtained and expressed as a ratio representing a single sample.
Ratios from multiple control and mutant samples were then combined to produce
the box plot shown in Fig.
5L.
| RESULTS |
|---|
|
|
|---|
|
A lens defect in Pygo2-/- has an early origin
Microophthalmia in the Pygo2-null mice is caused by a lens
development defect. In all day-of-birth Pygo2-/-
homozygotes we observed a dramatic, albeit variable, lens phenotype ranging
from a small lens (Fig. 2B) to
no lens (Fig. 2C). Optic cups
of homozygous mutants were misshapen with abnormal retinal folds and excess
mesenchymal cells (Fig. 2B,C).
Lamination and differentiation of retina and retinal pigmented epithelium
appeared grossly normal (Fig.
2B,C). Similar optic cup folding has been reported in other
mutants with lens development defects
(Ashery-Padan et al., 2000
;
Medina-Martinez et al., 2005
;
Smith et al., 2005
) and is
likely to be a secondary consequence of reduced lens volume.
|
Pygo1 has little if any role in lens development
Pygo1 homozygotes have no detectable lens defects (data not
shown). To determine whether Pygo1 might compensate for loss of Pygo2, we
assessed lens size in a Pygo1, Pygo2 allelic series in E12.5 embryos.
For each genotype, we measured both eyes of at least five embryos. The data
(Fig. 2K) are presented as the
ratio of lens to optic cup diameter in a box plot. We used the box plot for
all lens size quantification because it provides a visual representation of
all the data. In a box plot, the horizontal black line is the median value,
the box represents the interquartile range (25%-75% of the distribution) and
the line bars the minimum and maximum values. This showed that the lens size
of WT control (Pygo1+/+; Pygo2+/+) and
Pygo1-/-; Pygo2+/- embryos were not different,
but that any embryo homozygous for Pygo2 showed dramatically reduced
lens size. Although combining Pygo1 heterozygosity or homozygosity
and Pygo2 homozygosity produced a trend of smaller lenses, this was
not a statistically significant change. This indicates that Pygo1 has
little role in lens development.
Pygo2 enhances placodal Pax6 expression
Pax6 has an essential, cell-autonomous function in development of the lens
(Ashery-Padan et al., 2000
;
Collinson et al., 2000
) and is
sufficient to stimulate the formation of ectopic lenses if overexpressed
(Altmann et al., 1997
;
Chow et al., 1999
). As detailed
in the Introduction, models of lens induction suggest that there are two
phases of Pax6 expression, of which the placodal phase (defined as
Pax6placode) is dependent on earlier Pax6 activity in the
head ectoderm (defined as Pax6pre-placode). Using Pax6 as
a lens induction marker, we determined whether lens induction is affected in
the Pygo2-null mice.
|
Pax6 expression in the lens placode is regulated by both the
ectoderm enhancer (EE) and other transcriptional control elements that may
include the SIMO element (Kleinjan et al.,
2002
). In Le-cre transgenic mice, both Cre recombinase
and GFP are expressed under control of the EE from the Pax6 gene.
Le-cre therefore functions as a reporter for the EE activity of
Pax6 (Ashery-Padan,
2000
). To determine whether Pygo2 regulates Pax6
transcription through the EE, we assessed GFP signal levels in Le-cre;
Pygo2-/- embryos at E9.5. This showed that, compared with
control Le-cre; Pygo2+/+ embryos
(Fig. 3G), Le-cre;
Pygo2-/- embryos (Fig.
3H) had much lower levels of GFP signal. In
Pygo2-/- mutants, Sox2 expression appeared unaffected
(Fig. 3I,J). These data
indicate that, directly or indirectly, Pygo2 regulates Pax6 expression through
the EE (see model in Fig. 7D
for a summary of findings).
The activity of Pygo2 regulating Pax6 expression upstream of the EE raised the possibility that Pygo2 was positioned in a pathway between the early (Pax6pre-placode) and late (Pax6placode) phases of Pax6 expression. To test this possibility, we determined whether Pygo2 immunoreactivity was changed in Pax6Sey/Sey embryos in which Pax6pre-placode is absent. Immunolabeling in E10.5 cryosections showed no change in the level or distribution of Pygo2 (Fig. 3K,L), even though eye development was arrested. This suggests that Pygo2 functions in parallel to Pax6pre-placode in regulating Pax6 expression through the EE (Fig. 7D).
Pygo2 functions cell autonomously in lens induction
Pygo2 expression in all components of the eye primordium raised the
question of which expression domains might be crucial for lens development. We
generated conditional Pygo2 mutants using Cre recombinase transgenes
that were expressed in different components of the early eye. The expression
patterns of these Cre transgenes are summarized in
Fig. 7C. As mentioned, the
Le-cre transgene relies on the EE from Pax6 for expression
in the PLE from E8.75 onwards.
Using anti-Pygo2 antibodies, we showed that in Le-cre; Pygo2flox/- embryos, Pygo2 was consistently lost from the E9.5 lens placode (Fig. 3M,N). In some cases, we detected a few Pygo2-positive placodal cells (Fig. 3N, arrowhead). At E10.5, Pygo2 immunoreactivity was absent from the mutant lens pit (data not shown). To assess phenotype severity in Le-cre; Pygo2flox/- embryos, we quantified lens size at E12.5 (Fig. 3O-Q). This showed that despite consistent evidence of Pygo2flox deletion with Le-cre, E12.5 lens size was only mildly reduced, as compared with either WT or Le-cre embryos, and did not reach the severity of the null (Fig. 3Q). This indicates that Pygo2 has a cell-autonomous function in lens development but also implies that additional Pygo2-expressing domains contribute.
Mesenchymal Pygo2 has a cell non-autonomous role in lens induction
To assess the role of mesenchymal Pygo2 in lens development we
generated mice in which Pygo2flox was deleted with the
Wnt1-cre driver (Danielian et
al., 1998
). The Wnt1 gene is expressed in the region of
dorsal neural tube that is the origin of neural crest, and can be used to
conditionally delete floxed alleles in the neural crest-derived OM. This can
be demonstrated using the Z/EG GFP reporter mouse
(Novak et al., 2000
) in
conjunction with Wnt1-cre at both E8.5
(Fig. 4A,B) and E9.5
(Fig. 4C,D), OM cells are GFP
positive. This includes the narrow band of mesenchyme separating presumptive
lens and retinal epithelia at E8.5 (Fig.
4B), as well as mesenchyme adjacent to the optic vesicle after
epithelial contact at E9.5 (Fig.
4D). GFP-positive cells also label for the transcription factor
Ap2
(Tcfap2a - Mouse Genome Informatics), a marker of both PLE and OM
(Zhang et al., 1996
;
Nottoli et al., 1998
)
(Fig. 4B,D).
Immunolabeling showed that the OM of Wnt1-cre,
Pygo2flox/- embryos is Pygo2 negative
(Fig. 4E,F). Small clusters of
cells within the periocular region that remained Pygo2 positive correspond to
blood vessels (Fig. 4F, arrows)
that are not derived from Wnt1-cre-expressing cells
(Fig. 4D, asterisks).
Quantification of lens size in Wnt1-cre; Pygo2flox/-
embryos at E12.5 (Fig. 4G-J)
revealed a mild reduction approximately as severe as the phenotype in
Le-cre; Pygo2flox/- embryos
(Fig. 5O). Consistent with this
mild phenotype, we observed a slight reduction in the levels of Pax6
immunoreactivity in the lens placode of Wnt1-cre;
Pygo2flox/- embryos (Fig.
4K-N). Though consistently observed, this reduction could be
subtle and was best detected in double-labeled samples in which Ap2
immunoreactivity served as an unchanging internal control
(Fig. 4K,L, red). Detection of
Pax6 in the overlaid red channel gave most placodal nuclei a yellow color
(Fig. 4K,L). Where Pax6
expression levels were reduced - in the temporal one third of the placodal
ectoderm - there was a `red-shift' (Fig.
4L, bracket). These changes can be detected in the color
intensities across line intervals through the lens placode
(Fig. 4M,N). Reduced Pax6
labeling levels can be quantified by representing Pax6 and Ap2
average
labeling intensities across the placodal line interval as a ratio
(Fig. 5P; see Materials and
methods for details). These data indicate that mesenchymal Pygo2 participates
in lens development by regulating placodal Pax6 expression, either through
mesenchymal-epithelial signaling or by enhancing the lens-inducing capacity of
the optic vesicle. As with Le-cre conditional mutants, the severity
of the Wnt1-cre; Pygo2flox/- phenotype did not
match that of the null (Fig.
5O).
Pygo2 in PLE and OM combine to regulate Pax6 and lens development
With the above data, we reasoned that the severe lens phenotype in the
Pygo2-null mutant might be reconstructed by conditional deletion of
Pygo2 in both PLE and OM. We compared two strategies for conditional
deletion. First, we simply combined the Le-cre and Wnt1-cre
drivers with Pygo2flox/- and determined the severity of
the lens phenotype. This showed that although the phenotype (data not shown)
was more severe (Fig. 5O), the
dramatic phenotype of the Pygo2-null was not reproduced.
As a second strategy for conditional deletion of Pygo2 in both
presumptive lens and OM, we employed the Ap2
-cre
mouse line (Macatee et al.,
2003
). In this line, Cre recombinase is expressed from the
endogenous Ap2
locus. Since this was generated via insertion
of an internal ribosome entry sequence and cre into the 3'
untranslated region of Ap2
, production of Ap2
should be
unaffected (Macatee et al.,
2003
). The advantage of using Ap2
-cre
compared with the Wnt1-cre, Le-cre combination is that
Ap2
-cre is expressed throughout the head surface
ectoderm of the mouse from approximately E8.0
(Fig. 7C). This precedes
Le-cre expression in ectoderm by nearly 24 hours and so allows us to
determine whether expression of Pygo2 in this domain might be crucial.
Generation of Ap2
-cre; Z/EG embryos indicated
that, as anticipated (Macatee et al.,
2003
), GFP-positive cells are found in the head surface ectoderm
and OM at E8.5 (Fig. 5A,B), as
well as in the lens placode and OM at E9.5
(Fig. 5C,D). Pygo2 labeling of
cryosections from Ap2
-cre; Pygo2flox/-
embryos revealed that Pygo2 immunoreactivity was absent from both presumptive
lens and OM at E9.5 (Fig.
5A,B), indicating that Ap2
-cre was
effective. Although the E12.5 lens phenotype in Ap2
-cre;
Pygo2flox/- embryos was the most severe of any of the
conditional deletion mutants, it still did not reach the severity of the null.
This could be observed in whole-mount embryos
(Fig. 5G,I) and in eye region
sections of whole mounts (Fig.
5H,J), and was apparent from lens size quantification
(Fig. 5O). This quantification
indicates that the phenotype severity in Ap2
-cre;
Pygo2flox/- embryos is greater than in the Le-cre;
Wnt1-cre; Pygo2flox/- (a statistical trend) or in either of
the single Cre-driver mutants (statistically significant). Combined, these
data indicate that Pygo2 in pre-placodal ectoderm, in lens placode and in OM,
all participate in lens development cooperatively.
Importantly, we observed a reduced level of Pax6 expression in the E9.5
lens placode of Ap2
-cre; Pygo2flox/-
embryos (Fig. 5K-N). As
described above, this change was easiest to observe when Pax6 labeling
(Fig. 5K,L, green) was overlaid
with Ap2
labeling (Fig.
5K,L, red). As described in Materials and methods, reduced Pax6
labeling levels can be quantified (Fig.
5P). Notably, the Pax6:Ap2
ratio was lower in the
Ap2
-cre than Wnt1-cre conditional, and
higher than in the germline null. This is entirely consistent with the
severity of the E12.5 lens size phenotype in each mutant
(Fig. 5O) and with a
cooperative action of ectodermal and OM Pygo2 in lens development. By
elimination, we anticipate that combined conditional deletion of
Pygo2flox in presumptive lens, OM and optic vesicle, would
result in reconstruction of the null phenotype.
|
To validate the BatlacZ reporter results for cells of the OM, we performed ß-catenin loss- and gain-of-function experiments using the Wnt1-cre driver. In litters of E8.5 embryos that showed BatlacZ expression in the OM, littermates with the OM-specific ß-catenin gain-of-function genotype BatlacZ; Wnt1-cre; Catnb+/lox(ex3) showed dramatically enhanced lacZ staining of OM cells (Fig. 6A,B). By contrast, in embryos with the ß-catenin loss-of-function genotype BatlacZ; Wnt1-cre; Catnbtm2Kem/tm2Kem, lacZ staining was absent from the OM (Fig. 6C,D). These data show that BatlacZ can be used as a model Wnt pathway target gene in the OM.
|
If the OM activity of Pygo2 in lens development is a Wnt pathway function then we would expect deletion of Pygo2 or ß-catenin in OM cells to produce similar lens development defects. We generated Wnt1-cre; Catnbtm2Kem/tm2Kem embryos and showed that ß-catenin immunoreactivity was absent from the OM at E9.5 (Fig. 6G,H) and that, as shown earlier (Fig. 6A,B), when BatlacZ was incorporated the response was absent at E8.5. Interestingly, unlike the OM-conditional deletion of Pygo2 where placodal Pax6 levels were reduced (Fig. 4K-N, Fig. 5P), the level of placodal Pax6 with OM-conditional deletion of ß-catenin was unchanged (Fig. 6G,H, green). As a second measure of lens development, we allowed some litters to progress until E12.5 (Fig. 6I-L) and quantified lens size (Fig. 7B). This showed that in contrast to OM deletion of Pygo2 where lens size is reduced (Fig. 7B), loss of ß-catenin in the OM had no effect (Fig. 7B). Since there is no possibility of Wnt pathway function in the OM in the absence of ß-catenin, this suggests that although Pygo2 can regulate a model Wnt pathway target gene, its function in lens development is independent of Wnt pathway activity.
| DISCUSSION |
|---|
|
|
|---|
In which signaling pathways does Pygo2 function during lens development?
Drosophila Pygopus was identified as a core component of the
Wingless pathway (Belenkaya et al.,
2002
; Kramps et al.,
2002
; Parker et al.,
2002
). Pygopus has been shown to interact directly with
Armadillo/ß-catenin in the nucleus and to regulate transcription of
Wingless target genes (Thompson,
2004
; Tolwinski and Wieschaus,
2004
; Townsley et al.,
2004
; Hoffmans et al.,
2005
; Stadeli and Basler,
2005
). Analysis in Xenopus has shown that Pygopus is
required for Wnt signaling in a vertebrate
(Belenkaya et al., 2002
;
Lake and Kao, 2003
). In
Drosophila, pygopus loss-of-function phenocopies Wg pathway defects
(Belenkaya et al., 2002
;
Parker et al., 2002
;
Thompson et al., 2002
). In the
mouse, general Wnt pathway loss-of-function (for example in the Lrp6
mutant mouse) (Pinson et al.,
2000
) also results in severe, mid-gestational developmental
defects. Here we show the contrasting result that deletion of Pygo1
and Pygo2 in the mouse results in a relatively mild phenotype
distinct from Wnt pathway loss-of-function.
During early eye development, there are multiple roles for the Wnt pathway.
In zebrafish, the Wnt pathway antagonizes eye specification as a step in
defining eye fields (Cavodeassi et al.,
2005
). Later, when the basic components of the eye are formed, Wnt
pathway responses serve to restrict the domain of surface ectoderm that can
form lens; compromising Wnt signaling in surface ectoderm results in the
formation of ectopic lentoid bodies (Smith
et al., 2005
). This activity might be analogous to the function of
the Wingless pathway in the fly, where it suppresses formation of eye in favor
of head cuticle (Treisman and Rubin,
1995
). The phenotype of the Lrp6 mutant mouse also
implies that Wnt signaling has an important function in maintaining the lens
epithelium during later lens development
(Stump et al., 2003
).
Here we show that the neural crest-derived OM is Wnt pathway responsive. In
the mouse, a layer of OM a few cells thick separates the presumptive lens and
retinal epithelia from approximately E8.0 until E9.0, when the distal
epithelium of the optic vesicle makes close contact with the presumptive lens
(Kaufman, 1992
). Throughout
this period, the OM expresses both the validated Wnt reporter BatlacZ
(Nakaya et al., 2005
) and
TOPGAL (DasGupta and Fuchs,
1999
). When combined with the observation that BatlacZ
expression is reduced upon OM-conditional Pygo2 deletion, we
conclude, as might be anticipated
(Belenkaya et al., 2002
;
Kramps et al., 2002
;
Parker et al., 2002
;
Thompson, 2004
;
Tolwinski and Wieschaus, 2004
;
Townsley et al., 2004
;
Hoffmans et al., 2005
;
Stadeli and Basler, 2005
) that
Pygo2 has a Wnt pathway function.
However, Wnt pathway activity of Pygo2 is apparently not required for its
role in lens development. Assessing lens development in the
mesenchyme-specific conditional deletion of Pygo2 showed that the
crucial lens development marker Pax6 is reduced in the PLE and that by E12.5
the lens is small. By contrast, conditional deletion of
ß-catenin in the OM had no impact on Pax6 levels in PLE, nor on
lens size at E12.5. A comparison of the consequences of OM deletion of
Pygo2 and ß-catenin for lens development indicates that
although Pygo2 can function in the Wnt pathway, this activity is not important
for lens development. By inference, mesenchymal Pygo2 must function in another
pathway to influence lens development. Similarly, the absence of a Wnt pathway
response in the lens placode, but a role for placodal Pygo2 in lens
development, suggests a non-Wnt pathway function in this tissue as well. These
conclusions are consistent with non-Wnt pathway functions for
Drosophila Pygopus (Belenkaya et
al., 2002
; Parker et al.,
2002
). Like Drosophila Pygopus, mouse Pygo2 is expressed
more broadly than the locations of Wnt pathway activity
(Parker et al., 2002
;
Li et al., 2004
).
In the mouse, Pygo2 in OM enhances development of the lens
Embryological manipulations have indicated that neural crest-derived OM
suppresses lens formation and is important in determining where and when a
lens can form. In the chick, culture of isolated head ectoderm results in an
expanded expression domain of the lens marker
-crystallin; recombining
head ectoderm with head mesenchyme suppresses this response
(Sullivan et al., 2004
).
Mesenchymal suppression of lens fate might also explain much earlier studies
in which removal of neural plate regions resulted in formation of ectopic
lenses (von Woellwarth, 1961
).
In the chick, neural crest-derived head mesenchyme has been clearly identified
as the lens-suppressive population (Bailey
et al., 2006
). This is dramatically illustrated by the formation
of an ectopic lens when the neural folds are removed. This ectopic lens forms
in a region of ectoderm posterior to the eye
(Bailey et al., 2006
) that in
the mouse corresponds to a domain where the Pax6 EE is active
(Williams et al., 1998
;
Dimanlig et al., 2001
). Though
this study implicates Fgf signaling in promoting the identity of other
placodal structures in ectoderm previously specified for lens, the identity of
mesenchymal signals that directly suppress lens formation is unclear.
|
|
Regional deletion of the Pygo2 conditional allele has indicated
that Pygo2 in multiple tissues contributes to lens development. Deletion of
Pygo2flox with Wnt1-cre
(Danielian et al., 1998
)
(Fig. 7C) indicates that Pygo2
in neural crest-derived OM positively influences lens development. In one
model, this could occur by direct signaling of OM to presumptive lens
(Fig. 7D) or, conceivably,
indirectly through enhancement of the ability of the optic vesicle to induce
lens. Either way, the end result is Pygo2-dependent upregulation of
Pax6placode. The more-severe lens phenotype occurring when
Wnt1-cre is combined with the post-induction placodal ectoderm-driver
Le-cre (Fig. 7C)
indicates that mesenchymal and placodal Pygo2 cooperate
(Fig. 7D). A comparison of that
outcome with the Ap2
-cre conditional (where deletion
also occurs in pre-placodal ectoderm, Fig.
7C) suggests that this domain is also involved. This is consistent
with a function for Pygo2 in parallel with
Pax6pre-placode (Fig.
7D). It is interesting to note that Pygo2 influences lens
development through the EE, as do both Fgf receptor and Bmp7 signaling
(Lang, 2004
). It will be
interesting to determine whether the non-Wnt activity of Pygo2 resides in one
of these pathways.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Altmann, C. R., Chow, R. L., Lang, R. A. and Hemmati-Brivanlou, A. (1997). Lens induction by Pax-6 in Xenopus laevis. Dev. Biol. 185,119 -123.[CrossRef][Medline]
Aota, S., Nakajima, N., Sakamoto, R., Watanabe, S., Ibaraki, N. and Okazaki, K. (2003). Pax6 autoregulation mediated by direct interaction of Pax6 protein with the head surface ectoderm-specific enhancer of the mouse Pax6 gene. Dev. Biol. 257, 1-13.[CrossRef][Medline]
Ashery-Padan, R., Marquardt, T., Zhou, X. and Gruss, P.
(2000). Pax6 activity in the lens primordium is required for lens
formation and for correct placement of a single retina in the eye.
Genes Dev. 14,2701
-2711.
Bailey, A. P., Bhattacharyya, S., Bronner-Fraser, M. and Streit, A. (2006). Lens specification is the ground state of all sensory placodes, from which FGF promotes olfactory identity. Dev. Cell 11,505 -517.[CrossRef][Medline]
Belenkaya, T. Y., Han, C., Standley, H. J., Lin, X., Houston, D.
W. and Heasman, J. (2002). pygopus Encodes a nuclear protein
essential for wingless/Wnt signaling. Development
129,4089
-4101.
Bell, S. M., Schreiner, C. M., Waclaw, R. R., Campbell, K.,
Potter, S. S. and Scott, W. J. (2003). Sp8 is crucial for
limb outgrowth and neuropore closure. Proc. Natl. Acad. Sci.
USA 100,12195
-12200.
Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P., Sommer, L., Boussadia, O. and Kemler, R. (2001). Inactivation of the beta-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128,1253 -1264.[Abstract]
Cavodeassi, F., Carreira-Barbosa, F., Young, R. M., Concha, M. L., Allende, M. L., Houart, C., Tada, M. and Wilson, S. W. (2005). Early stages of zebrafish eye formation require the coordinated activity of Wnt11, Fz5, and the Wnt/beta-catenin pathway. Neuron 47,43 -56.[CrossRef][Medline]
Chow, R. L., Altmann, C. R., Lang, R. A. and Hemmati-Brivanlou, A. (1999). Pax6 induces ectopic eyes in a vertebrate. Development 126,4213 -4222.[Abstract]
Collinson, J. M., Hill, R. E. and West, J. D. (2000). Different roles for Pax6 in the optic vesicle and facial epithelium mediate early morphogenesis of the murine eye. Development 127,945 -956.[Abstract]
Danielian, P. S., Muccino, D., Rowitch, D. H., Michael, S. K. and McMahon, A. P. (1998). Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr. Biol. 8,1323 -1326.[CrossRef][Medline]
DasGupta, R. and Fuchs, E. (1999). Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126,4557 -4568.[Abstract]
Dimanlig, P. V., Faber, S. C., Auerbach, W., Makarenkova, H. P. and Lang, R. A. (2001). The upstream ectoderm enhancer in Pax6 has an important role in lens induction. Development 128,4415 -4424.[Medline]
Eastman, Q. and Grosschedl, R. (1999). Regulation of LEF-1/TCF transcription factors by Wnt and other signals. Curr. Opin. Cell Biol. 11,233 -240.[CrossRef][Medline]
Faber, S. C., Dimanlig, P., Makarenkova, H. P., Shirke, S., Ko, K. and Lang, R. A. (2001). Fgf receptor signaling plays a role in lens induction. Development 128,4425 -4438.[Medline]
Furuta, Y. and Hogan, B. L. M. (1998). BMP4 is
essential for lens induction in the mouse embryo. Genes
Dev. 12,3764
-3775.
Gotoh, N., Ito, M., Yamamoto, S., Yoshino, I., Song, N., Wang,
Y., Lax, I., Schlessinger, J., Shibuya, M. and Lang, R. A.
(2004). Tyrosine phosphorylation sites on FRS2alpha responsible
for Shp2 recruitment are critical for induction of lens and retina.
Proc. Natl. Acad. Sci. USA
101,17144
-17149.
Grindley, J. C., Davidson, D. R. and Hill, R. E. (1995). The role of Pax-6 in eye and nasal development. Development 121,1433 -1442.[Abstract]
Harada, N., Tamai, Y., Ishikawa, T., Sauer, B., Takaku, K., Oshima, M. and Taketo, M. M. (1999). Intestinal polyposis in mice with a dominant stable mutation of the beta-catenin gene. EMBO J. 18,5931 -5942.[CrossRef][Medline]
He, X., Semenov, M., Tamai, K. and Zeng, X.
(2004). LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin
signaling: arrows point the way. Development
131,1663
-1677.
Hill, R. E., Favor, J., Hogan, B. L., Ton, C. C., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D. and van Heyningen, V. (1991). Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 354,522 -525.[CrossRef][Medline]
Hoffmans, R., Stadeli, R. and Basler, K. (2005). Pygopus and legless provide essential transcriptional coactivator functions to Armadillo/beta-Catenin. Curr. Biol. 15,1207 -1211.[CrossRef][Medline]
Joyner, A. L. I. (ed.) (1995). Gene Targeting: A Practical Approach (The Practical Approach Series). New York: IRL Press at Oxford University Press.
Kamachi, Y., Uchikawa, M., Tanouchi, A., Sekido, R. and Kondoh,
H. (2001). Pax6 and SOX2 form a co-DNA-binding partner
complex that regulates initiation of lens development. Genes
Dev. 15,1272
-1286.
Kaufman, M. H. (1992). The Atlas of Mouse Development. San Diego: Academic Press.
Kleinjan, D. A., Seawright, A., Schedl, A., Quinlan, R. A.,
Danes, S. and van Heyningen, V. (2001). Aniridia-associated
translocations, DNase hypersensitivity, sequence comparison and transgenic
analysis redefine the functional domain of PAX6. Hum. Mol.
Genet. 10,2049
-2059.
Kleinjan, D. A., Seawright, A., Elgar, G. and van Heyningen, V. (2002). Characterization of a novel gene adjacent to PAX6, revealing synteny conservation with functional significance. Mamm. Genome 13,102 -107.[CrossRef][Medline]
Kramps, T., Peter, O., Brunner, E., Nellen, D., Froesch, B., Chatterjee, S., Murone, M., Zullig, S. and Basler, K. (2002). Wnt/wingless signaling requires BCL9/legless-mediated recruitment of pygopus to the nuclear beta-catenin-TCF complex. Cell 109, 47-60.[CrossRef][Medline]
Lake, B. B. and Kao, K. R. (2003). Pygopus is required for embryonic brain patterning in Xenopus. Dev. Biol. 261,132 -148.[CrossRef][Medline]
Lang, R. A. (2004). Pathways regulating lens induction in the mouse. Int. J. Dev. Biol. 48,783 -791.[CrossRef][Medline]
Li, B., Mackay, D. R., Ma, J. and Dai, X. (2004). Cloning and developmental expression of mouse pygopus 2, a putative Wnt signaling component. Genomics 84,398 -405.[CrossRef][Medline]
Liu, H., Mohamed, O., Dufort, D. and Wallace, V. A. (2003). Characterization of Wnt signaling components and activation of the Wnt canonical pathway in the murine retina. Dev. Dyn. 227,323 -334.[CrossRef][Medline]
Macatee, T. L., Hammond, B. P., Arenkiel, B. R., Francis, L.,
Frank, D. U. and Moon, A. M. (2003). Ablation of specific
expression domains reveals discrete functions of ectoderm- and
endoderm-derived FGF8 during cardiovascular and pharyngeal development.
Development 130,6361
-6374.
Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P.,
Broccoli, V., Hassan, A. B., Volpin, D., Bressan, G. M. and Piccolo, S.
(2003). Mapping Wnt/beta-catenin signaling during mouse
development and in colorectal tumors. Proc. Natl. Acad. Sci.
USA 100,3299
-3304.
Medina-Martinez, O., Brownell, I., Amaya-Manzanares, F., Hu, Q.,
Behringer, R. R. and Jamrich, M. (2005). Severe defects in
proliferation and differentiation of lens cells in Foxe3 null mice.
Mol. Cell. Biol. 25,8854
-8863.
Mosimann, C., Hausmann, G. and Basler, K. (2006). Parafibromin/Hyrax activates Wnt/Wg target gene transcription by direct association with beta-catenin/Armadillo. Cell 125,327 -341.[CrossRef][Medline]
Nakaya, M. A., Biris, K., Tsukiyama, T., Jaime, S., Rawls, J. A.
and Yamaguchi, T. P. (2005). Wnt3alinks left-right
determination with segmentation and anteroposterior axis elongation.
Development 132,5425
-5436.
Nottoli, T., Hagopian-Donaldson, S., Zhang, J., Perkins, A. and
Williams, T. (1998). AP-2-null cells disrupt morphogenesis of
the eye, face, and limbs in chimeric mice. Proc. Natl. Acad. Sci.
USA 95,13714
-13719.
Novak, A., Guo, C., Yang, W., Nagy, A. and Lobe, C. G. (2000). Z/EG, a double reporter mouse line that expresses enhanced green fluorescent protein upon Cre-mediated excision. Genesis 28,147 -155.[CrossRef][Medline]
Nusse, R. (2005). Wnt signaling in disease and in development. Cell Res. 15, 28-32.[CrossRef][Medline]
Parker, D. S., Jemison, J. and Cadigan, K. M.
(2002). Pygopus, a nuclear PHD-finger protein required for
Wingless signaling in Drosophila. Development
129,2565
-2576.
Pinson, K. I., Brennan, J., Monkley, S., Avery, B. J. and Skarnes, W. C. (2000). An LDL-receptor-related protein mediates Wnt signalling in mice. Nature 407,535 -538.[CrossRef][Medline]
Popadiuk, C. M., Xiong, J., Wells, M. G., Andrews, P. G.,
Dankwa, K., Hirasawa, K., Lake, B. B. and Kao, K. R. (2006).
Antisense suppression of pygopus2 results in growth arrest of epithelial
ovarian cancer. Clin. Cancer Res.
12,2216
-2223.
Robinson, J. M. and Vandre, D. D. (2001). Antigen retrieval in cells and tissues: enhancement with sodium dodecyl sulfate. Histochem. Cell Biol. 116,119 -130.[Medline]
Schwab, K., Patterson, L., Hartman, H., Song, N., Lang, R., Lin, X. and Potter, S. (2007). Pygo1 and Pygo2 roles in Wnt signaling in mammalian kidney development. BMC Biol. (in press).
Schwenk, F., Baron, U. and Rajewsky, K. (1995).
A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene
segments including deletion in germ cells. Nucleic Acids
Res. 23,5080
-5081.
Smith, A. N., Miller, L. A., Song, N., Taketo, M. M. and Lang, R. A. (2005). The duality of beta-catenin function: a requirement in lens morphogenesis and signaling suppression of lens fate in periocular ectoderm. Dev. Biol. 285,477 -489.[CrossRef][Medline]
Spemann, H. (1901). Uber Correlationen in der Entwickelung des Auges. Verh. Anat. Ges. 15, 61-79.
Stadeli, R. and Basler, K. (2005). Dissecting nuclear Wingless signalling: recruitment of the transcriptional co-activator Pygopus by a chain of adaptor proteins. Mech. Dev. 122,1171 -1182.[CrossRef][Medline]
Stump, R. J., Ang, S., Chen, Y., von Bahr, T., Lovicu, F. J., Pinson, K., de Iongh, R. U., Yamaguchi, T. P., Sassoon, D. A. and McAvoy, J. W. (2003). A role for Wnt/beta-catenin signaling in lens epithelial differentiation. Dev. Biol. 259, 48-61.[CrossRef][Medline]
Sullivan, C. H., Braunstein, L., Hazard-Leonards, R. M., Holen, A. L., Samaha, F., Stephens, L. and Grainger, R. M. (2004). A re-examination of lens induction in chicken embryos: in vitro studies of early tissue interactions. Int. J. Dev. Biol. 48,771 -782.[CrossRef][Medline]
Thompson, B. J. (2004). A complex of Armadillo, Legless, and Pygopus coactivates dTCF to activate wingless target genes. Curr. Biol. 14,458 -466.[CrossRef][Medline]
Thompson, B., Townsley, F., Rosin-Arbesfeld, R., Musisi, H. and Bienz, M. (2002). A new nuclear component of the Wnt signalling pathway. Nat. Cell Biol. 4, 367-373.[CrossRef][Medline]
Tolwinski, N. S. and Wieschaus, E. (2004). A nuclear escort for beta-catenin. Nat. Cell Biol. 6, 579-580.[CrossRef][Medline]
Townsley, F. M., Cliffe, A. and Bienz, M. (2004). Pygopus and Legless target Armadillo/beta-catenin to the nucleus to enable its transcriptional co-activator function. Nat. Cell Biol. 6,626 -633.[CrossRef][Medline]
Treisman, J. E. and Rubin, G. M. (1995). wingless inhibits morphogenetic furrow movement in the Drosophila eye disc. Development 121,3519 -3527.[Abstract]
von Woellwarth, C. (1961). Die Rolle des Neuralleistenmaterials und der Temeratur bei der Determination der Augenlinse. Embryologica Nagoya 6,219 -242.
Wawersik, S., Purcell, P., Rauchman, M., Dudley, A. T., Robertson, E. J. and Maas, R. (1999). BMP7 acts in murine lens placode development. Dev. Biol. 207,176 -188.[CrossRef][Medline]
Willert, K., Brown, J. D., Danenberg, E., Duncan, A. W., Weissman, I. L., Reya, T., Yates, J. R., 3rd and Nusse, R. (2003). Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423,448 -452.[CrossRef][Medline]
Williams, S. C., Altmann, C. R., Chow, R. L., Hemmati-Brivanlou, A. and Lang, R. A. (1998). A highly conserved lens transcriptional control element from the Pax-6 gene. Mech. Dev. 73,225 -229.[CrossRef][Medline]
Zhang, J., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., Plehn-Dujowich, D., McMahon, A. P., Flavell, R. A. and Williams, T. (1996). Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381,238 -241.[CrossRef][Medline]
Zhang, X., Friedman, A., Heaney, S., Purcell, P. and Maas, R.
L. (2002). Meis homeoproteins directly regulate Pax6 during
vertebrate lens morphogenesis. Genes Dev.
16,2097
-2107.
Related articles in Development:
This article has been cited by other articles:
![]() |
B. Gu, P. Sun, Y. Yuan, R. C. Moraes, A. Li, A. Teng, A. Agrawal, C. Rheaume, V. Bilanchone, J. M. Veltmaat, et al. Pygo2 expands mammary progenitor cells by facilitating histone H3 K4 methylation J. Cell Biol., June 1, 2009; 185(5): 811 - 826. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Mieszczanek, M. de la Roche, and M. Bienz A role of Pygopus as an anti-repressor in facilitating Wnt-dependent transcription PNAS, December 9, 2008; 105(49): 19324 - 19329. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G.P. Andrews, M. W. Kennedy, C. M. Popadiuk, and K. R. Kao Oncogenic Activation of the Human Pygopus2 Promoter by E74-Like Factor-1 Mol. Cancer Res., February 1, 2008; 6(2): 259 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Y. Sokol and K. A. Wharton Jr WNTers in La Jolla Development, October 1, 2007; 134(19): 3393 - 3399. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||