|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 May 2007
doi: 10.1242/dev.02860
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cutaneous Biology Research Center, Massachusetts General Hospital, 149 13th
street, Charlestown, MA 02129, USA.
2 Developmental and Cell Biology Department, University of California, Irvine,
5205 McGaugh Hall, Irvine, CA 92697, USA.
* Author for correspondence (e-mail: kristin.white{at}cbrc2.mgh.harvard.edu)
Accepted 11 April 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Phosphatidylserine, Engulfment, Apoptosis, Drosophila
| INTRODUCTION |
|---|
|
|
|---|
A number of proteins are known to bind to PS on the surface of apoptotic
cells, and some have been shown to bridge apoptotic cells to molecules on the
surface of phagocytes. These bridging molecules include annexin V, annexin I,
milk fat globule EGF-like protein 8 (MFGE8), Developmental endothelial locus-1
(DEL-1) and growth arrest-specific 6 (GAS6)
(Vermes et al., 1995
;
Scott et al., 2001
;
Hanayama et al., 2002
;
Arur et al., 2003
;
Hanayama et al., 2004
).
In contrast to bridging molecules, a phagocyte receptor that directly binds
PS on apoptotic cells has been described
(Fadok et al., 2000
). In this
work, a monoclonal antibody that blocked apoptotic cell uptake in a
PS-dependent manner was identified. The epitope recognized by the antibody was
isolated by phage display and the gene encoding this epitope was identified as
the PS receptor (PSR). PSR was predicted to be a type II membrane spanning
protein. Expression of PSR in cells that normally do not engulf apoptotic
cells increased their efficiency of engulfment
(Fadok et al., 2000
). In
addition, PSR was found to have a role in the inhibition of inflammatory
cytokine release after apoptotic cell engulfment
(Hoffmann et al., 2001
;
Huynh et al., 2002
). These
studies suggested that PSR might be a key regulator of the response of
phagocytes to apoptotic cells.
Gene knockout models of the PSR gene in mouse (Jmjd6-Mouse Genome
Informatics), Caenorhabditis elegans (psr-1-Wormbase) and
zebrafish (jmjd6-ZFIN) have been reported, but these studies do not
unequivocally implicate PSR in engulfment. Conflicting phenotypes have been
reported from three PSR knockouts in mice
(Li et al., 2003
;
Bose et al., 2004
;
Kunisaki et al., 2004
).
Perinatal lethality was observed in all three knockouts; however, different
effects on the proliferation and differentiation of certain tissues, as well
as on apoptotic cell engulfment, were observed. Defects in apoptotic cell
engulfment were found in two studies, but not in a third
(Li et al., 2003
;
Bose et al., 2004
;
Kunisaki et al., 2004
).
Disruption of the PSR gene in C. elegans showed a very slight
inhibition of apoptotic cell engulfment
(Wang et al., 2003
).
Unengulfed apoptotic cells were also observed in zebrafish during development
(Hong et al., 2004
). More
recently, no engulfment defect or altered response to apoptotic cells was
observed in a fibroblast line established from PSR-deficient mice
(Mitchell et al., 2006
).
An additional issue in understanding PSR function has been disagreement
regarding the localization of the PSR protein. Original reports indicated a
potential transmembrane domain in the protein
(Fadok et al., 2000
). PSR also
contains a region of homology to a jumonji C (JmjC) domain that has been
implicated in modifying nuclear proteins
(Ayoub et al., 2003
). A fusion
protein of mammalian PSR to GFP was shown to localize to the nucleus of cells
(Cui et al., 2004
;
Mitchell et al., 2006
).
Hydra PSR is also localized to the nucleus and has a JmjC domain with
similarity to a 2-oxoglutarate and Fe (II)-dependent oxygenase factor
inhibiting hypoxia-inducible factor (FIH)
(Cikala et al., 2004
). These
results suggest that the putative PSR resides in the nucleus, rather than
acting as a cell surface receptor for apoptotic cells.
Given these conflicting results, we investigated the function of the highly
conserved PSR homolog (dPSR) in Drosophila, to determine if we could
find a role for dPSR in engulfment or in other developmental events. In the
fly embryo, the majority of apoptotic cells are engulfed and degraded by
circulating phagocytic hemocytes, referred to as macrophages
(Tepass et al., 1994
).
Membrane proteins involved in the uptake of apoptotic cells have been
identified in Drosophila. croquemort, a homolog of the mammalian
scavenger receptor CD36, was identified as a hemocyte protein important for
engulfment of apoptotic cells (Franc et
al., 1999
). draper, a homolog of the ced-1 gene
in C. elegans, has also been identified as a phagocyte protein
important for apoptotic cell engulfment
(Freeman et al., 2003
;
Manaka et al., 2004
).
Through analysis of a mutant for dPSR, we determined that dPSR is not required for the engulfment of apoptotic cells by macrophages in the developing embryo. However, we have detected a role for dPSR in protection from apoptosis. We found that increased dPSR inhibited apoptosis, while flies that lack dPSR showed inappropriate apoptosis during eye development. This protection from apoptosis appears to involve suppression of the apoptosis regulator Head involution defective (Hid; also known as Wrinkled-FlyBase). In addition, activation of the c-Jun-NH2 terminal kinase (JNK) pathway suppresses phenotypes caused by dPSR overexpression, suggesting that dPSR may act to suppress the JNK pathway. These results provide an alternative explanation for phenotypes observed in PSR knockouts in other model organisms.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of UAS-PSR flies
The cDNA for dPSR (CG5383) was excised from cDNA clone LD25827 (Invitrogen)
using BglII and XhoI, and ligated into the BglII
and XhoI restriction sites in the multi-cloning region of the pPUAST
vector. Transgenic flies were generated by the Transgenic Fly Core Facility of
the Cutaneous Biology Research Center at Massachusetts General Hospital.
Generation of dPSRFM1 flies
The P(EP)561 element was mobilized with
2-3. PCR mapping was
performed to determine loss of dPSR using various primers. DNA was isolated
from dPSRFM1 homozygous flies for inverse PCR using the
method described by E. J. Rehm on the Berkley Drosophila Genome Project
website
(http://www.fruitfly.org/about/methods/inverse.pcr.html).
Briefly, DNA was isolated, digested with Sau3A, and recircularized.
The DNA was then amplified via PCR with primers PSR1: ATGGTGTCGTCCATGTTGAG and
PSR12: ACCATTGCCATCACCCAGAA. The resulting 450 bp band was cloned using the TA
cloning kit (Invitrogen), and plasmids were sequenced. The breakpoint was
determined to delete 627 bases of coding sequence from the initiator ATG and
included some remaining P element. Primers designed to amplify DNA on the
other side of the P-element insertion indicated that the sequence of the
upstream gene remained intact.
PSR:ECFP fusion vector construction
The cDNA encoding PSR was amplified with
5'-TCCAGATCTATGAGCGAGGAATTCAAGCTGCCC and
3'-AGCGTCGACGAGGAACGCGATGATCCGCCCATGGA primers and cloned into the
BglII and XhoI sites of the pECFP-N1 vector (Clontech) to
create a PSR:ECFP fusion. The PSR:ECFP was excised with BglII and
NotI and cloned into the BamHI and NotI sites of
the pIE-1 vector (Novagen). S2 cells were transfected using 5 µg DNA and
Cellfectin reagent (Invitrogen) in 1 ml serum-free Schneiders S2 media
(Gibco). After 3 days in complete media, the cells were stained with 5
µg/ml Hoechst 33342 (Molecular Probes) and visualized using fluorescence
microscopy.
Apoptosis and engulfment assays
Acridine Orange staining was done according to White et al.
(White et al., 1994
). To
assess engulfment, embryos were fixed and apoptotic cells were visualized by
staining with 7-aminoactinomycin D (Franc
et al., 1999
), or TUNEL (described below). The embryos were
examined by confocal microscopy to visualize srp-hemo GFP-labeled hemocytes
and the punctate 7-AAD-or TUNEL-labeled apoptotic nuclei. At least five single
hemocytes from a minimum of eight embryos of each genotype were scored for
engulfment from similar regions of age-matched dPSRFM1
homozygous embryos. The phagocytic index was calculated as the mean number of
corpses per hemocyte for each genotype.
Immunohistochemistry
To assess pupal eye morphology, eye discs were taken from pupae at the
indicated time after puparium formation at 25°C, dissected in 0.1 M sodium
phosphate buffer (PB), and stained with a 1:20 dilution of mouse anti-Discs
large antibody 4F3 (Developmental Studies Hybridoma Bank) overnight in PB with
0.1% Triton-X-100 (PBT) and 5% goat serum. The discs were washed three times
in PBT for 10 minutes each, and then incubated with a 1:200 dilution of goat
anti-mouse FITC conjugate (Jackson Immunochemicals) in PBT and 5% goat serum
overnight at 4°C. The discs were washed three times for 10 minutes each
and mounted using Fluormount-G (Southern Biotechnologies Associates). The
discs were visualized by confocal microscopy.
Differentiation and proliferation in third instar eye discs were assayed by staining yw, dPSRFM1, or w; GMR-GAL4/UAS-dPSR; + third instar eye discs with anti-phosphohistone antibody (1:200, Upstate), and rat anti-ElaV antiserum (1:200, Developmental Studies Hybridoma Bank), followed by secondary antibodies, goat anti-mouse FITC conjugate (1:200, Molecular Probes) and goat anti-rat Alexa 568 conjugate (1:200, Molecular Probes). The discs were visualized by confocal microscopy.
In situ hybridization
Fixed embryos were subjected to in situ hybridization using an antisense
riboprobe specific to dPSR, and compared to a sense probe as described by
Grether et al. (Grether et al.,
1995
).
Reverse transcription PCR
Total RNA was isolated from 100 third instar larval eye discs of the
indicated genotype. Equal amounts of total RNA were reverse transcribed using
an oligo dT primer and MMLV reverse transcriptase (Ambion). The cDNA encoding
dPSR was then amplified using Platinum Taq (Invitrogen) with primers PSRF
(5'-ATCCACATTGATCCACTGGG-3') and PSRR
(5'-AGCTTGAATTGCTGGAGCTG-3').
TUNEL labeling
Cell death in embryos was assayed using the In Situ Cell Death Detection
Kit, TMR red (Roche). Embryos were dechorionated and fixed at the interface of
heptane and 4% formaldehyde for 20 minutes, and then devitillinized with
methanol for 2 minutes. Embryos were washed once with methanol, twice with
ethanol (2 minutes each), and incubated in 70% ethanol overnight at -20°C.
The embryos were washed with 30% ethanol for 10 minutes and twice with PBS for
10 minutes each, and then permeabilized with 0.3% Triton X-100 for 20 minutes
and incubated in PBS + 0.1% Triton X-100 (PBST) with 1:1000 anti-GFP antibody
(Invitrogen) overnight at 4°C. The embryos were washed three times in PBST
for 10 minutes each, and incubated with secondary antibody (Alexa
488-conjugated donkey antirabbit antibody, Molecular Probes), in 50 µl
TUNEL labeling mix/enzyme solution, overnight at 4°C. The embryos were
washed three times in PBST for 10 minutes, mounted in Fluormount, and
visualized with confocal microscopy. To assure that TUNEL signal was specific
to apoptotic cells, H99 homozygous embryos that lack cell death were analyzed
and found to lack TUNEL staining.
Pupal eye discs were dissected at 49 hours after pupation, fixed in 4% formaldehyde in PBS for 20 minutes, and stained as described for anti-Discs large. The TUNEL reaction was carried out for 2 hours at 37°C. The Alexa 488-conjugated goat anti-mouse secondary antibody was added directly to the TUNEL labeling solution. The discs were then washed three times in PBST, mounted with Fluormount and visualized under confocal microscopy.
|
| RESULTS |
|---|
|
|
|---|
Our screens identified several genomic regions with possible defects in
engulfment. Embryos homozygous for Df(3R)5C1
contained numerous unclustered AO-positive cells
(Fig. 1B). Interestingly, this
deletion includes the gene encoding the Drosophila homolog of the
putative phosphatidylserine receptor, dPSR
(Fadok et al., 2000
). The
predicted Drosophila gene encodes a 408 amino acid protein that is
70% identical and 82% similar to the human gene, with conservation extending
throughout the gene (data not shown). This prompted us to further examine the
role of this gene in engulfment. We generated dPSR mutants by
P-element excision of EP(561), a P-element insertion 101 bp 5' of
dPSR (Fig. 1D). Five
imprecise excision mutants of dPSR were generated. The strain
dPSRFM1 was found to be a deletion that removed sequence
from the P-element insertion into the gene, deleting the coding sequence for
the first 210 amino acids of dPSR, while a portion of the P element
and the upstream gene remained (Fig.
1D).
Homozygous dPSRFM1 flies were viable and fertile with no obvious morphological defects and were established as a homozygous line for further analysis. We found that dPSR is ubiquitously expressed in wild-type embryos, but not expressed in dPSRFM1 embryos (see Fig. S1A,B in the supplementary material), indicating that dPSRFM1 is likely to be a null mutation. In addition, no expression of dPSR could be detected by RT-PCR in eye discs from third instar dPSRFM1 larvae, whereas dPSR was expressed in control eye discs (see Fig. S1C in the supplementary material).
PSR is not important for apoptotic cell engulfment
To determine the requirement for dPSR in apoptotic cell engulfment, we
examined dPSRFM1 embryos by AO staining and found that the
numbers and pattern of clustered apoptotic cells was similar to those seen in
wild-type flies (Fig. 1C). This
indicates that the AO-positive cell clustering phenotype detected in the
Df(3R)5C1 embryos is not due to deletion of the
dPSR gene alone.
To quantify apoptotic cell engulfment in wild-type and mutant embryos, we
analyzed the number of apoptotic cells per macrophage using srp hemo-GAL4,
UAS-src-EGFP (Srp-hemo GFP). In these animals, GFP is expressed
specifically in macrophages (Bruckner et
al., 2004
). The number of GFP-labeled macrophages and apoptotic
cells was similar in wild-type and dPSRFM1 embryos (see
Fig. S2 in the supplementary material). We counted the number of engulfed cell
corpses, marked by 7-aminoactinomycin D or TUNEL staining, in macrophages of
similarly staged embryos. Importantly, we did not detect a decrease in
apoptotic cell engulfment by macrophages in dPSRFM1
embryos (Fig. 2A,B). These data
indicate that dPSR is not required for apoptotic cell clearance by macrophages
in the developing embryo.
Drosophila PSR is a nuclear protein
If Drosophila PSR functions in macrophages to recognize dying
cells, one would expect this protein to be localized to the cell surface.
However, analysis of the sequence of dPSR using PSORT II predicts that dPSR is
a nuclear protein (Nakai and Horton,
1999
). This was consistent with reports that mammalian and
Hydra PSR contain nuclear localization signals and significant
homology to nuclear proteins (Cikala et
al., 2004
; Cui et al.,
2004
; Mitchell et al.,
2006
). To determine whether Drosophila PSR is localized
to the nucleus, the sequence was fused to the N-terminus of ECFP and expressed
in S2 cells under a constitutive promoter. ECFP alone was found throughout the
cell (Fig. 3A), while PSR:ECFP
was found to colocalize with the DNA stain Hoechst 33342
(Fig. 3B-D). These data
indicated that dPSR is likely to be localized to the nucleus of
Drosophila cells, and is unlikely to act as a cell surface receptor
for apoptotic cells.
A role for PSR in protection from cell death
In addition to its role in apoptotic cell recognition and engulfment, work
on PSR in mammalian systems suggest that PSR is important for other processes
such as proper development and TGF-ß release
(Hoffmann et al., 2001
;
Bose et al., 2004
). To explore
the signaling pathways activated by PSR, we generated transgenic flies that
expressed dPSR under control of the GAL4-UAS system
(Brand and Perrimon, 1993
).
Expression of dPSR under two different ubiquitous promoters, Act5c-GAL4 and
Tub-P-GAL4, resulted in a rotated male genital defect similar to that seen in
mutants of the hid gene (Fig.
4A-C) (Abbott and Lengyel,
1991
). hid is one of a cluster of genes important for
regulating developmental apoptosis in the fly. Loss of hid results in
semi-lethality, with adult escapers showing a rotated male genital phenotype
and a lack of wing blade fusion resulting from lack of cell death
(White et al., 1994
). A
genital rotation phenotype has also been observed in flies that express the
baculovirus pan-caspase inhibitor p35, confirming a role for apoptosis in the
correct orientation of the developing male genital disc
(Macias et al., 2004
). We also
observed the rotation defect in flies that lack dronc
(Nc-FlyBase), an initiator caspase
(Fig. 4D)
(Xu et al., 2005
). This
further indicates a role for cell death in this phenotype.
|
|
|
To further test the hypothesis that dPSR can protect from apoptosis, we examined the effects of increasing or decreasing dPSR function on cell death induced by the overexpression of proapoptotic genes in the eye. If dPSR promotes cell survival in the eye, then increased dPSR should suppress apoptosis and loss of dPSR should enhance apoptosis. We co-expressed dPSR in the eye with the pro-apoptotic proteins Hid- or Grim. Co-expression of dPSR suppressed the small rough eye induced by expression of Hid, resulting in an average increase in eye size of 19% (P=0.0002). The rough eye induced by Grim was also suppressed when dPSR was coexpressed (Fig. 5A-D).
To determine whether loss of dPSR enhances death, we examined the effect of removing dPSR on Rpr-, Hid- or Grim-induced cell killing in the developing eye. We found that deletion of one copy of dPSR enhanced the rough eye of GMR-Rpr, GMR-Hid or GMR-Grim. Loss of both copies of dPSR further enhanced this death (Fig. 6A-I). Taken together, these results suggest that the normal function of dPSR in the eye is to suppress cell death.
|
|
Proliferation and differentiation were also normal in these discs, as
assessed by anti-phosphohistone and anti-Elav antibody staining, respectively
(data not shown) (Robinow and White,
1991
).
During pupal life, the characteristic hexagonal lattice structure of the
adult eye is formed. The cells that make up each ommatidial unit can be
observed using anti-Discs large, an antibody to a septate junction protein
that labels cell membranes (Parnas et al.,
2001
). During the formation of the hexagonal lattice, many extra
interommatidial cells undergo apoptosis, leaving 12 lattice cells per
ommatidium (Brachmann and Cagan,
2003
). The apoptosis of these extra cells and formation of the
lattice is normally complete by 30 hours after puparium formation (APF)
(Brachmann and Cagan, 2003
). In
wild-type pupal eye discs, a characteristic hexagonal lattice pattern of the
secondary and tertiary pigment cells of the ommatidial clusters is observed
(Fig. 7A). At 40 hours APF,
pupal eye development was normal in the mutants and a characteristic hexagonal
lattice of interommatidial cells was seen
(Fig. 7D). By 50 hours APF we
detected loss of interommatidial cells, which in some cases resulted in
ommatidial fusions (Fig. 7B,C).
The loss of cells was not uniform, as some parts of the eye discs appeared
normal at this time. To determine if the loss of the lattice cells was due to
apoptotic death of these cells, we performed TUNEL staining of eye discs at 49
hours APF. We observed TUNEL-stained nuclei below the plane of the lattice in
mutant discs (Fig. 7I,J). In
contrast to the loss of cells seen in the absence of dPSR,
overexpression of dPSR in the eye led to the appearance of extra lattice cells
(Fig. 7E). These data indicate
that dPSR functions to regulate apoptosis during the pupal phase of eye
development.
dPSR inhibits apoptosis upstream of Hid
To test directly whether the ectopic death seen in dPSR mutants
was due to Hid-dependent apoptosis, we examined the effect of loss of
hid on the dPSRFM1 pupal eye phenotype. We found
that the absence of both hid and dPSR resulted in extra
interommatidial cells, similar to that seen in the absence of hid
alone (Kurada and White, 1998
)
(Fig. 7F,G). These results
indicate that the increased apoptosis in dPSR-null eyes is due to
Hid-dependent apoptosis.
|
|
dPSR inhibits apoptosis upstream of JNK activity
The JNK pathway has previously been shown to regulate Hid activity and
apoptosis during development (Moreno et
al., 2002
). The JNK pathway has also been shown to be important
for the proper rotation of the developing male genitalia, a process that
requires apoptosis (Macias et al.,
2004
). Increasing JNK activity by removing one copy of its
negative regulator, Puckered (Puc), suppresses a genital rotation defect
observed in males heterozygous for the H99 deletion, which deletes
hid, grim and rpr
(Macias et al., 2004
).
Inhibition of JNK by overexpression of Puc can also induce rotated genitalia
(Macias et al., 2004
). These
data support the model that decreased JNK activity suppresses Hid activity,
resulting in similar rotation defects to those seen in hid
mutants.
To determine whether the JNK pathway has a role in the rotated genital phenotype induced by dPSR expression, we examined the effect of loss of one copy of puc on the dPSR overexpression phenotype. Loss of one copy of puc almost completely suppressed the rotated genital phenotype resulting from increased dPSR. The mis-rotation phenotype was seen in 52% (336/642) of dPSRoverexpressing flies, but in only 1.6% (8/496) of flies that overexpress dPSR but have one copy of puc disrupted (Fig. 8A). Thus, the dPSR anti-apoptotic effects are counteracted by increasing JNK pathway activity, suggesting that dPSR may suppress Hid activity by suppressing the JNK pathway (Fig. 8B).
| DISCUSSION |
|---|
|
|
|---|
PSR may not be involved in engulfment
In addition to the original cell-based studies supporting a role for PSR in
engulfment, gene ablation experiments in a variety of models also provide some
evidence for a role for PSR in this process. PSR gene ablation in C.
elegans resulted in a delay in the engulfment of apoptotic cells, as
evidenced by the presence of more cell corpses in the mutant animals
(Wang et al., 2003
). In two of
the three reported murine PSR gene-knockout models, defects in apoptotic cell
engulfment were reported (Li et al.,
2003
; Kunisaki et al.,
2004
).
We found no evidence for a role of dPSR in engulfment in
Drosophila. Evidence against a role for PSR in engulfment also comes
from two other knockout models and from data on the localization of the
protein. One of the reported mouse knockouts showed no difference in
engulfment of apoptotic cells by macrophages in the mutant, although
PSR-/- macrophages were generally inhibited in their release of
pro- and anti-inflammatory cytokines (Bose
et al., 2004
). In addition, fibroblast lines established from
PSR-/- embryos showed no defect in apoptotic cell engulfment or in
their response to apoptotic cells
(Mitchell et al., 2006
).
Zebrafish lacking PSR accumulated dead cells, but were not definitively shown
to have defects in apoptotic cell engulfment
(Hong et al., 2004
). Finally,
localization data from our work and from a number of labs strongly supports a
nuclear localization for the protein (Ayoub
et al., 2003
; Cui et al.,
2004
; Mitchell et al.,
2006
). This is not consistent with a role for PSR as a surface
receptor for the recognition for apoptotic cells, although PS could
theoretically modulate the activity of this protein within the cell.
PSR could be required for cell differentiation and survival
Our observations support a role for dPSR in cell survival. In zebrafish,
reduction of PSR resulted in an increase in the number of apoptotic cells
present during development (Hong et al.,
2004
). In particular, the brains of these fish were shrunken and
had an increase in apoptotic cells. In two of the mouse knockout models an
increase in apoptotic cells was detected
(Li et al., 2003
;
Kunisaki et al., 2004
).
However, all three knockouts resulted in perinatal lethality, with defects in
differentiation in a variety of tissues
(Li et al., 2003
;
Bose et al., 2004
;
Kunisaki et al., 2004
). We
speculate that defects in engulfment detected in some of the gene ablation
models could reflect a role for PSR in the proper differentiation of
macrophages. Increased apoptosis seen in our studies and by others might also
be due to defects in proper differentiation in the absence of
PSR.
What insight can be gained from our studies into the function of dPSR in
differentiation and cell survival? We have shown that increased dPSR results
in a cell survival phenotype that is suppressed by activation of the JNK
pathway, while loss of dPSR results in apoptosis, activated by the
cell death regulator Hid, a known target of JNK activation in apoptosis
(McEwen and Peifer, 2005
).
Taken together, these data suggest that dPSR may normally act to suppress JNK
activation of Hid-induced apoptosis.
JNK activation is important for many processes in cells, including cell
death, proliferation and differentiation. A role for JNK in apoptosis was
found in many mammalian cell types (Yang
et al., 1997
; Dong et al.,
1998
; Tournier et al.,
2000
). Data from mouse knockouts of JNK also suggest a role for
JNK in proliferation and differentiation
(Dong et al., 1998
;
Tournier et al., 2000
). In
addition, JNK activation in dying cells is required for proliferative signals
originating from apoptotic cells in Drosophila
(Ryoo et al., 2004
).
Interestingly, defects in proliferation and differentiation of many tissues
were observed in mice that lack PSR (Li et
al., 2003
; Bose et al.,
2004
; Kunisaki et al.,
2004
). Taken together with our observations of increased cell
death in dPSR mutant flies, these observations suggest that some of
the phenotypes seen in mouse and fish models of PSR gene ablation might be due
to inappropriate activation of the JNK pathway.
Role of PSR in Drosophila development
Based on our genetic assays, we propose that one function of dPSR is to
suppress Hid activation. Flies that lack dPSR show increased
apoptosis in the developing pupal eye, which is suppressed in the absence of
hid, while overexpression of dPSR results in ectopic cell survival.
Hid function is required for the death of the interommatidial cells in the
pupal retina (Kurada and White,
1998
). Our results also showed that expression of dPSR can inhibit
death induced by the expression of Hid- or Grim in the eye, and that loss of
dPSR enhances Rpr-, Hid- or Grim-induced death in the eye.
Interestingly, loss of one copy of hid can also suppress cell death
induced by Rpr or Hid expression in the eye
(Bergmann et al., 1998
;
Kurada and White, 1998
).
Therefore alterations of dPSR levels in the eye may be altering Hid activity
to modify the Grim- and Rprinduced eye phenotypes.
JNK activation has been shown to increase hid activity
(McEwen and Peifer, 2005
).
However, Hid activity is also modulated by activation of the Ras/Erk pathway
(Bergmann et al., 1998
;
Kurada and White, 1998
). Ras
activation results in the survival of ectopic interommatidial cells, through
the downregulation of Hid activity (Miller
and Cagan, 1998
). Ectopic Ras activation also results in genital
rotation defects, similar to those seen with dPSR overexpression
(Macias et al., 2004
). This
suggests that PSR overexpression might activate the Ras/Erk pathway. Based on
our data, it is not clear whether dPSR might activate Ras and thus suppress
JNK activity, whether dPSR could suppress JNK and thus activate Ras, or
whether dPSR might act independently in an opposing manner on the JNK and Ras
pathways.
By examining the function of dPSR in the Drosophila system, we have provided new insight into the controversy regarding this protein. Although we do not find evidence that this protein plays a role in engulfment, we have found that it is important in cell survival. This is consistent with phenotypes seen in gene ablation models in other organisms. Furthermore, we have shown that dPSR affects the JNK pathway, and this may provide a clue as to its diverse functions in mammals.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/13/2407/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abbott, M. K. and Lengyel, J. A. (1991).
Embryonic head involution and rotation of male terminalia require the
Drosophila locus head involution defective. Genetics
129,783
-789.[Abstract]
Abrams, J. M., White, K., Fessler, L. I. and Steller, H.
(1993). Programmed cell death during Drosophila embryogenesis.
Development 117,29
-43.
Arur, S., Uche, U. E., Rezaul, K., Fong, M., Scranton, V.,
Cowan, A. E., Mohler, W. and Han, D. K. (2003). Annexin I is
an endogenous ligand that mediates apoptotic cell engulfment. Dev.
Cell 4,587
-598.[CrossRef][Medline]
Ayoub, N., Noma, K., Isaac, S., Kahan, T., Grewal, S. I. and
Cohen, A. (2003). A novel jmjC domain protein modulates
heterochromatization in fission yeast. Mol. Cell.
Biol. 23,4356
-4370.
Bergmann, A., Agapite, J., McCall, K. and Steller, H.
(1998). The Drosophila gene hid is a direct molecular target of
ras-dependent survival signaling. Cell
95,331
-341.[CrossRef][Medline]
Bose, J., Gruber, A. D., Helming, L., Schiebe, S., Wegener, I.,
Hafner, M., Beales, M., Kontgen, F. and Lengeling, A. (2004).
The phosphatidylserine receptor has essential functions during embryogenesis
but not in apoptotic cell removal. J. Biol.
3, 15.[CrossRef][Medline]
Brachmann, C. B. and Cagan, R. L. (2003).
Patterning the fly eye: the role of apoptosis. Trends
Genet. 19,91
-96.[CrossRef][Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted
gene expression as a means of altering cell fates and generating dominant
phenotypes. Development
118,401
-415.[Abstract]
Brown, S., Heinisch, I., Ross, E., Shaw, K., Buckley, C. D. and
Savill, J. (2002). Apoptosis disables CD31-mediated cell
detachment from phagocytes promoting binding and engulfment.
Nature 418,200
-203.[CrossRef][Medline]
Bruckner, K., Kockel, L., Duchek, P., Luque, C. M., Rorth, P.
and Perrimon, N. (2004). The PDGF/VEGF receptor controls
blood cell survival in Drosophila. Dev. Cell
7, 73-84.[CrossRef][Medline]
Chen, P., Nordstrom, W., Gish, B. and Abrams, J. M.
(1996). grim, a novel cell death gene in Drosophila.
Genes Dev. 10,1773
-1782.
Cikala, M., Alexandrova, O., David, C. N., Proschel, M.,
Stiening, B., Cramer, P. and Bottger, A. (2004). The
phosphatidylserine receptor from Hydra is a nuclear protein with potential
Fe(II) dependent oxygenase activity. BMC Cell Biol.
5, 26.[CrossRef][Medline]
Cui, P., Qin, B., Liu, N., Pan, G. and Pei, D.
(2004). Nuclear localization of the phosphatidylserine receptor
protein via multiple nuclear localization signals. Exp. Cell
Res. 293,154
-163.[CrossRef][Medline]
Dong, C., Yang, D. D., Wysk, M., Whitmarsh, A. J., Davis, R. J.
and Flavell, R. A. (1998). Defective T cell differentiation
in the absence of Jnk1. Science
282,2092
-2095.
Fadok, V. A., Bratton, D. L., Frasch, S. C., Warner, M. L. and
Henson, P. M. (1998). The role of phosphatidylserine in
recognition of apoptotic cells by phagocytes. Cell Death
Differ. 5,551
-562.[CrossRef][Medline]
Fadok, V. A., Bratton, D. L., Rose, D. M., Pearson, A.,
Ezekewitz, R. A. and Henson, P. M. (2000). A receptor for
phosphatidylserine-specific clearance of apoptotic cells.
Nature 405,85
-90.[CrossRef][Medline]
Franc, N. C., Heitzler, P., Ezekowitz, R. A. and White, K.
(1999). Requirement for croquemort in phagocytosis of apoptotic
cells in Drosophila. Science
284,1991
-1994.
Freeman, M. (1996). Reiterative use of the EGF
receptor triggers differentiation of all cell types in the Drosophila eye.
Cell 87,651
-660.[CrossRef][Medline]
Freeman, M. R., Delrow, J., Kim, J., Johnson, E. and Doe, C.
Q. (2003). Unwrapping glial biology: Gcm target genes
regulating glial development, diversification, and function.
Neuron 38,567
-580.[CrossRef][Medline]
Grether, M. E., Abrams, J. M., Agapite, J., White, K. and
Steller, H. (1995). The head involution defective gene of
Drosophila melanogaster functions in programmed cell death. Genes
Dev. 9,1694
-1708.
Hanayama, R., Tanaka, M., Miwa, K., Shinohara, A., Iwamatsu, A.
and Nagata, S. (2002). Identification of a factor that links
apoptotic cells to phagocytes. Nature
417,182
-187.[CrossRef][Medline]
Hanayama, R., Tanaka, M., Miwa, K. and Nagata, S.
(2004). Expression of developmental endothelial locus-1 in a
subset of macrophages for engulfment of apoptotic cells. J.
Immunol. 172,3876
-3882.
Hoffmann, P. R., deCathelineau, A. M., Ogden, C. A., Leverrier,
Y., Bratton, D. L., Daleke, D. L., Ridley, A. J., Fadok, V. A. and Henson, P.
M. (2001). Phosphatidylserine (PS) induces PS
receptor-mediated macropinocytosis and promotes clearance of apoptotic cells.
J. Cell Biol. 155,649
-659.
Hong, J. R., Lin, G. H., Lin, C. J., Wang, W. P., Lee, C. C.,
Lin, T. L. and Wu, J. L. (2004). Phosphatidylserine receptor
is required for the engulfment of dead apoptotic cells and for normal
embryonic development in zebrafish. Development
131,5417
-5427.
Huynh, M. L., Fadok, V. A. and Henson, P. M.
(2002). Phosphatidylserine-dependent ingestion of apoptotic cells
promotes TGF-beta1 secretion and the resolution of inflammation. J.
Clin. Invest. 109,41
-50.[CrossRef][Medline]
Kunisaki, Y., Masuko, S., Noda, M., Inayoshi, A., Sanui, T.,
Harada, M., Sasazuki, T. and Fukui, Y. (2004). Defective
fetal liver erythropoiesis and T lymphopoiesis in mice lacking the
phosphatidylserine receptor. Blood
103,3362
-3364.
Kurada, P. and White, K. (1998). Ras promotes
cell survival in Drosophila by downregulating hid expression.
Cell 95,319
-329.[CrossRef][Medline]
Li, M. O., Sarkisian, M. R., Mehal, W. Z., Rakic, P. and
Flavell, R. A. (2003). Phosphatidylserine receptor is
required for clearance of apoptotic cells. Science
302,1560
-1563.
Macias, A., Romero, N. M., Martin, F., Suarez, L., Rosa, A. L.
and Morata, G. (2004). PVF1/PVR signaling and apoptosis
promotes the rotation and dorsal closure of the Drosophila male terminalia.
Int. J. Dev. Biol. 48,1087
-1094.[CrossRef][Medline]
Manaka, J., Kuraishi, T., Shiratsuchi, A., Nakai, Y., Higashida,
H., Henson, P. and Nakanishi, Y. (2004). Draper-mediated and
phosphatidylserine-independent phagocytosis of apoptotic cells by Drosophila
hemocytes/macrophages. J. Biol. Chem.
279,48466
-48476.
Martin-Blanco, E., Gampel, A., Ring, J., Virdee, K., Kirov, N.,
Tolkovsky, A. M. and Martinez-Arias, A. (1998). puckered
encodes a phosphatase that mediates a feedback loop regulating JNK activity
during dorsal closure in Drosophila. Genes Dev.
12,557
-570.
McEwen, D. G. and Peifer, M. (2005). Puckered,
a Drosophila MAPK phosphatase, ensures cell viability by antagonizing
JNK-induced apoptosis. Development
132,3935
-3946.
Miller, D. T. and Cagan, R. L. (1998). Local
induction of patterning and programmed cell death in the developing Drosophila
retina. Development 125,2327
-2335.[Abstract]
Mitchell, J. E., Cvetanovic, M., Tibrewal, N., Patel, V.,
Colamonici, O. R., Li, M. O., Flavell, R. A., Levine, J. S., Birge, R. B. and
Ucker, D. S. (2006). The presumptive phosphatidylserine
receptor is dispensable for innate anti-inflammatory recognition and clearance
of apoptotic cells. J. Biol. Chem.
281,5718
-5725.
Moreno, E., Yan, M. and Basler, K. (2002).
Evolution of TNF signaling mechanisms: JNK-dependent apoptosis triggered by
Eiger, the Drosophila homolog of the TNF superfamily. Curr.
Biol. 12,1263
-1268.[CrossRef][Medline]
Nakai, K. and Horton, P. (1999). PSORT: a
program for detecting sorting signals in proteins and predicting their
subcellular localization. Trends Biochem. Sci.
24, 34-36.[CrossRef][Medline]
Parnas, D., Haghighi, A. P., Fetter, R. D., Kim, S. W. and
Goodman, C. S. (2001). Regulation of postsynaptic structure
and protein localization by the Rhotype guanine nucleotide exchange factor
dPix. Neuron 32,415
-424.[CrossRef][Medline]
Robinow, S. and White, K. (1991).
Characterization and spatial distribution of the ELAV protein during
Drosophila melanogaster development. J. Neurobiol.
22,443
-461.[CrossRef][Medline]
Ryoo, H. D., Gorenc, T. and Steller, H. (2004).
Apoptotic cells can induce compensatory cell proliferation through the JNK and
the Wingless signaling pathways. Dev. Cell
7, 491-501.[CrossRef][Medline]
Schlegel, R. A. and Williamson, P. (2001).
Phosphatidylserine, a death knell. Cell Death Differ.
8, 551-563.[CrossRef][Medline]
Scott, R. S., McMahon, E. J., Pop, S. M., Reap, E. A.,
Caricchio, R., Cohen, P. L., Earp, H. S. and Matsushima, G. K.
(2001). Phagocytosis and clearance of apoptotic cells is mediated
by MER. Nature 411,207
-211.[CrossRef][Medline]
Tepass, U., Fessler, L. I., Aziz, A. and Hartenstein, V.
(1994). Embryonic origin of hemocytes and their relationship to
cell death in Drosophila. Development
120,1829
-1837.[Abstract]
Tournier, C., Hess, P., Yang, D. D., Xu, J., Turner, T. K.,
Nimnual, A., Bar-Sagi, D., Jones, S. N., Flavell, R. A. and Davis, R. J.
(2000). Requirement of JNK for stress-induced activation of the
cytochrome c-mediated death pathway. Science
288,870
-874.
van den Eijnde, S. M., Boshart, L., Baehrecke, E. H., De Zeeuw,
C. I., Reutelingsperger, C. P. and Vermeij-Keers, C.
(1998). Cell surface exposure of phosphatidylserine during
apoptosis is phylogenetically conserved. Apoptosis
3, 9-16.[CrossRef][Medline]
Verhoven, B., Schlegel, R. A. and Williamson, P.
(1995). Mechanisms of phosphatidylserine exposure, a phagocyte
recognition signal, on apoptotic T lymphocytes. J. Exp.
Med. 182,1597
-1601.
Vermes, I., Haanen, C., Steffens-Nakken, H. and
Reutelingsperger, C. (1995). A novel assay for apoptosis.
Flow cytometric detection of phosphatidylserine expression on early apoptotic
cells using fluorescein labelled Annexin V. J. Immunol.
Methods 184,39
-51.[CrossRef][Medline]
Wang, X., Wu, Y. C., Fadok, V. A., Lee, M. C., Gengyo-Ando, K.,
Cheng, L. C., Ledwich, D., Hsu, P. K., Chen, J. Y., Chou, B. K. et al.
(2003). Cell corpse engulfment mediated by C. elegans
phosphatidylserine receptor through CED-5 and CED-12.
Science 302,1563
-1566.
White, K., Grether, M. E., Abrams, J. M., Young, L., Farrell, K.
and Steller, H. (1994). Genetic control of programmed cell
death in Drosophila. Science
264,677
-683.
Wing, J. P., Zhou, L., Schwartz, L. M. and Nambu, J. R.
(1998). Distinct cell killing properties of the Drosophila
reaper, head involution defective, and grim genes. Cell Death
Differ. 5,930
-939.[CrossRef][Medline]
Xu, D., Li, Y., Arcaro, M., Lackey, M. and Bergmann, A.
(2005). The CARDcarrying caspase Dronc is essential for most, but
not all developmental cell death in Drosophila.
Development 132,2125
-2134.
Yang, D. D., Kuan, C. Y., Whitmarsh, A. J., Rincon, M., Zheng,
T. S., Davis, R. J., Rakic, P. and Flavell, R. A. (1997).
Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking
the Jnk3 gene. Nature
389,865
-870.[CrossRef][Medline]
Zhou, L., Schnitzler, A., Agapite, J., Schwartz, L. M., Steller,
H. and Nambu, J. R. (1997). Cooperative functions of the
reaper and head involution defective genes in the programmed cell death of
Drosophila central nervous system midline cells. Proc. Natl. Acad.
Sci. USA 94,5131
-5136.
This article has been cited by other articles:
![]() |
L. A. Johnston Competitive Interactions Between Cells: Death, Growth, and Geography Science, June 26, 2009; 324(5935): 1679 - 1682. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Schlegel and P. Williamson P.S. to PS (Phosphatidylserine) Pertinent Proteins in Apoptotic Cell Clearance Sci. Signal., October 16, 2007; 2007(408): pe57 - pe57. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||