|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 23 May 2007
doi: 10.1242/dev.02863
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Department MCB, Division of GGD, Center for Integrative Genomics, University
of California, Berkeley, CA 94720, USA.
2 Department of Developmental Genetics, National Institute of Genetics, 1111
Yata, Mishima 411-8540, Japan.
3 Brookdale Department of Molecular, Cell and Developmental Biology, Box 1020,
Mount Sinai School of Medicine, New York, NY 10029, USA.
4 Department of Entomology, University of California, Davis, CA 95616,
USA.
* Author for correspondence (e-mail: mlevine{at}berkeley.edu)
Accepted 3 April 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Mosquito, Anopheles gambiae, Embryo, Gastrulation, Amnion, Serosa, Gene network, Sog, Dpp, Zen, Dorsal-ventral patterning
| INTRODUCTION |
|---|
|
|
|---|
The Dorsal gradient regulates over 50 target genes in a
concentration-dependent manner
(Stathopoulos and Levine,
2002
). Approximately 40 of the genes encode sequence-specific
transcription factors (TF) or components of signal transduction (ST) pathways
that impinge on the activities of the TFs. Dorsal target enhancers have been
identified for about half of these genes, and the DNA binding sites recognized
by many of the TFs have been determined (reviewed by
Stathopoulos and Levine,
2005
). This information has permitted the construction of a
detailed gene network, or circuit diagram, containing nearly 200 functional
interconnections among the 40 TF and ST Dorsal target genes
(Levine and Davidson,
2005
).
It is our long-term goal to understand how changes in the
Drosophila dorsal-ventral (DV) patterning network produce diverse
gastrulation profiles in different insects. In the present study we compare
dorsal-ventral patterning in Drosophila melanogaster and the malaria
mosquito, Anopheles gambiae. Both insects are members of the same
order, Diptera, but are highly divergent and last shared a common ancestor
200 million years ago (Gailey et al.,
2006
). Genome turnover is so extensive that homologous enhancers
do not display any vestige of sequence similarity. By contrast, sequence
conservation is readily detected among extensively divergent vertebrates such
as humans and pufferfish (Santini et al.,
2003
). Despite the turnover in the noncoding sequences of
divergent insects, there is extensive conservation of the segmentation gene
network, which serves to establish broadly similar body plans. For example,
altered patterns in gap gene expression are balanced by compensatory changes
in the regulation of downstream pair-rule genes
(Goltsev et al., 2004
).
Classical embryological studies revealed broad similarities in DV
patterning among diverse Diptera (see
Sander, 1975
). However,
notable differences were detected in the formation of the extraembryonic
membranes (EMs). Specifically, higher dipterans such as D.
melanogaster contain one EM, the amnioserosa
(Demerec, 1950
), whereas lower
dipterans, such as mosquitoes, contain distinct amnion and serosa tissues
(Christophers, 1960
;
Davis, 1967
;
Guichard, 1971
;
Idris, 1960
;
Ivanova-Kazas, 1949
). Indeed,
most insects contain separate tissues, suggesting that the formation of the
single aminoserosa is a derived characteristic
(Schmidt-Ott, 2000
;
Stauber et al., 1999
). The
analysis of segmentation gene expression in A. gambiae and
specifically the repression of individual eve stripes in the
presumptive serosa suggested early divergence in the DV patterning of the EMs
of D. melanogaster and A. gambiae
(Goltsev et al., 2004
).
Here, we extend the previous analysis of segmentation to obtain a detailed picture of early dorsal-ventral patterning in A. gambiae. Particular efforts focus on the analysis of Dorsal target genes governing mesoderm invagination and the patterning of the ectoderm. Evidence is presented that the patterning of the ventral half of the embryo, the mesoderm and ventral neurogenic ectoderm, is highly conserved in A. gambiae and D. melanogaster. By contrast, the patterning of the dorsal ectoderm exhibits many differences.
The dorsal ectoderm of D. melanogaster produces just two cell
types, dorsal epidermis and the amnioserosa. The latter tissue arises from a
restricted region of the dorsal-most ectoderm, along the dorsal midline. In
A. gambiae, the dorsal ectoderm is significantly expanded, and the
dorsal midline is subdivided into distinct amnion and serosa lineages. The
expansion of the dorsal ectoderm can be explained by a broadening in the
domain of Dpp (BMP) signaling (reviewed by
Podos and Ferguson, 1999
) in
the early A. gambiae embryo. Evidence is presented that this
expansion results, in part, from the restricted expression of the Dpp
inhibitor, Sog, within the presumptive mesoderm. In Drosophila, sog
is expressed in a broad pattern that encompasses the entire neurogenic
ectoderm (Francois et al.,
1994
). This broad sog pattern restricts Dpp signaling to
the dorsal midline (Ashe and Levine,
1999
; Decotto and Ferguson,
2001
; Eldar et al.,
2002
; Holley et al.,
1995
; Marques et al.,
1997
; Mizutani et al.,
2005
; Shimmi et al.,
2005
), whereas the ventrally restricted sog pattern in
A. gambiae appears to produce a broader domain of Dpp signaling. The
broad sog pattern in Drosophila is driven by an intronic
enhancer containing optimal Dorsal binding sites
(Markstein et al., 2002
). An
analogous enhancer in A. gambiae contains low-affinity sites, and
when expressed in transgenic D. melanogaster embryos it recapitulates
restricted expression in the mesoderm, similar to the endogenous A.
gambiae pattern. Thus, the interconversion of high- and low-affinity
Dorsal binding sites appears to produce altered threshold responses to the
Dorsal gradient. We discuss how subtle changes in the Dorsal patterning
network can convert separate serosa and amnion tissues into a single
tissue.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning and injection of DNA fragments
Mosquito DNA was derived from the Anopheles gambiae Kisumu strain.
We partially resequenced the sog locus to correct for the gaps in the
mosquito genome assembly (Fig. S3 in supplementary material). The A.
gambiae sog enhancer fragments were amplified from genomic DNA with the
following primers:
Fragment 1: ACCAGGTCGTGTGCAGCTCGCGTATGGTCTT, GGCGTGCGAGCTCTTGCGTCTCCTACGCAG;
Fragment 2: GAGAACCGGTAATGGTCTAGCCGCCAA, GCAACCCCAACAACAACTCTGTTCACA;
Fragment 3: TGGTAGCACTTCGCACATTCGAGTTAG, TCAGCATCGACGATGCAATACCATACG;
Fragment 4: GCCGGTACGTGGTAGAGTGGCAGAGTA, CTGACCAGACGGCAGACCACGGTAGAA;
Fragment 5: TCTGATATGTCTGGGACGGTGTGTTGT, CTGGATGTTCGCATCACGTCTTCCTCT.
PCR products were cloned into a [-42evelacZ]-pCaSpeR vector
(Small et al., 1992
). The
exact coding sequence for the A. gambiae zen gene was determined by
RACE using an A. gambiae embryonic cDNA Marathon library. The coding
sequence was amplified with the following pair of primers:
ATAAAGTTTCTGTTAAGCAACTGCAGTAA, CCAGATGTCGTAGTACCCATTATATGGTAA.
PCR products were cloned into the pUAST
(Brand and Perrimon, 1993
)
expression vector. Constructs were introduced into the D.
melanogaster germline by microinjection as described previously
(Ip et al., 1992
). Between
three and nine independent transgenic lines were obtained for each
construct.
Whole-mount in situ hybridization
Mosquito embryos were collected and fixed as described previously
(Goltsev et al., 2004
).
Hybridization probes were prepared against specific A. gambiae genes
identified by reciprocal BLAST analyses. The hybridization probes were
generated by RT-PCR amplification from embryonic RNA. A 26 bp tail encoding
the T7 RNA polymerase promoter (TAATACGACTCACTATAGGGAGA) was included on the
5' side of the reverse primer. PCR products were purified with the
Qiagen PCR purification kit and used directly as templates for in vitro
transcription reactions. The following primer pairs were used to amplify each
of the indicated A. gambiae segmentation genes. (The T7 promoter
sequence is denoted by the symbol [T7].):
twi: CTTATACTGGACATTAGTGGAGCCGGTT, AAG[T7]GGAAGCTAGCCGGAGCGTCTGTATCTT;
sna: CCACACCTCGTTCAACTCGTACCTTTCGTC, AAG[T7]TGGCATGAAGCTGTCCTCCGAGATGTT;
sim: AGCGTCAATCATACGACTCACCACCTCGTA, AAG[T7]TAGAACATAGTTGACGCTAACGATACA;
vnd: CCGGTGCTGACCTGGTCGCCGCTGCTGTTT, AAG[T7]GG ACCGCCGTCAGCAGGTCGTGCGGTT;
brk: CCAGTTCAAGCTGCAGGTGCTCGACTCGTA, AAG[T7]TC CGGCTAATGTTGTACTTGGTCGCGA;
ind: TTCTAGTGGACTCGTTAATCAGTGATAAGC, AAG[T7]AGTGCGTACGATCTTCTGCTGATCGTT;
dpp: ACGCTAGTCGAGATAGAGAAGAACCTTCT, AAG[T7]CCGCAGCCAACGACCGTCATGTCCTGGTA;
tkv: CTGCTACTGCGAGGGCCACTGTCCGGGCAA, AAG[T7]GAGTCCGTCTCGAGCTTGACGAGCGTT;
zen: TCGCTGCTGACAGTTATATTGGTTCAACTA, AAG[T7]ATCATTATCGAGAGATGTGCTACAAGCCT;
hnt: CAGATGCAGGATGTGCCGCCCACGCCGGCC, AAG[T7]GGCGGTAGCTCAGCATCGCCCGACACCACGC;
tup: CGCTTATCCTTGTGCGTTGGATGCGGCGGTC, AAG[T7]CCATGTGCGAACCGATCGGAGGACCTGGCC;
Doc1: ACCGTCAGCAAATGTTGCAACGGATACCAG, AAG[T7]CGAGGAGGAGGTGTTGTTGCAGCCCATCTT;
ems: CTGGCGGCCCAGTTCCAGGCGGCCGCCCTT, AAG[T7]TCGGACAGTCGTCCATGTCGATGAACT;
hb: GGCTCGGACTGTGAGGATGGCTCGTACGAT, AAG[T7]CAGGTACGGGAACAGTGGCAGACTGCCGTT;
ttk: ATGGTGCAAACGAATCCGCTGCTCGGTACT, AAG[T7]CGCGAACGGACATCTCTGTGAGTGCTT;
sog: TGCCAGTTTGGCAAGACCATACGCGAGCTG, AAG[T7]CTTCTCGCACTTGTACTGCTGGTGGTCGCA;
tld: TGCTTGCGGAGGTCAGCTGGACACGCCGAA, AAG[T7]CTGATGTGGCTCAATATCGAACACATTGAA;
rho: CGGGTTCTTCGTCTACCACTCACTCACGTT, AAG[T7]ATACCTCTTCACTTTCCTCCTCTAGCCTCT.
Antibodies and staining for pSMAD
Rabbit anti-pMad antibody was kindly provided by P. ten Dijke (Leiden
University Medical Center, Leiden, Netherlands). D. melanogaster and
A. gambiae embryos were fixed as described previously
(Goltsev et al., 2004
).
Primary antibodies were used at a dilution of 1:200. Secondary anti-rabbit
antibodies conjugated to alkaline phosphatase (Jackson ImmunoResearch) were
used for staining.
Scanning electron microscopy
Fly and mosquito embryos were fixed as for in situ hybridization. The
embryos were subsequently post-fixed in 25% glutaraldehyde for 30 minutes,
dehydrated and dried. Embryos were coated with gold-palladium and observed
with a JOEL JSM 5800LV scanning electron microscope.
Computational identification of shared motifs and enhancers
A Dorsal position weighted matrix
(Papatsenko and Levine, 2005
)
was used to identify potential Dorsal binding clusters at the Anopheles
sog locus. The recently developed ClusterDraw software was used for this
analysis (Zinzen et al.,
2006
).
|
| RESULTS |
|---|
|
|
|---|
Mesoderm invagination has been studied by analyzing the expression of
twist, an early determinant of mesoderm fate
(Boulay et al., 1987
;
Thisse, 1987
). This approach
was used in staged A. gambiae embryos which were hybridized with a
digoxigenin-labeled twist antisense RNA probe, and then mounted in
plastic and sectioned (Fig.
1B). twist staining is restricted to the ventral-most 25%
of the embryo circumference, as seen in D. melanogaster. There is
transient apical constriction of the mesoderm plate
(Fig. 1Bc), followed by the
appearance of a shallow groove along the ventral midline. There is no
organized involution of the mesoderm, but instead, individual mesoderm cells
undergo progressive ingression during germband elongation
(Fig. 1Bd-f). This ingression
is similar to that seen in mutant D. melanogaster embryos lacking
fog-concertina signaling. In these mutants, there is a
severe reduction of the ventral furrow and mesoderm cells fail to invaginate
(Costa et al., 1994
;
Dawes-Hoang et al., 2005
).
Nonetheless, many of the mutant embryos survive because of ingression of the
mesoderm during elongation. Interestingly, the A. gambiae genome
lacks a clear homologue of the fog gene (see Discussion).
Conservation of the neurogenic ectoderm
A number of marker genes were analyzed to determine whether there have been
significant changes in the DV patterning network responsible for the mesoderm
and neurogenic ectoderm in flies and mosquitoes
(Fig. 2). Despite the different
modes of mesoderm invagination, the overall limits of the presumptive mesoderm
are quite similar in flies and mosquitoes
(Fig. 2A-D). In both cases, the
twist and snail expression patterns are restricted to the
ventral-most regions destined for later ingression during elongation. As in
D. melanogaster, the snail pattern has somewhat sharper
lateral borders than those seen for twist
(Fig. 2C; compare with A).
sim expression is restricted to single lines of cells immediately
straddling the snail borders (Fig.
2E,F). These lines coincide with the ventral-most regions of the
neurogenic ectoderm, and the cells will form specialized mesectodermal
derivatives along the ventral midline of the nerve cord
(Martin-Bermudo et al.,
1995
).
In D. melanogaster, intermediate and low levels of the Dorsal
gradient lead to sequential patterns of vnd and ind
expression, which pattern the medial and lateral portions of the future nerve
cord (McDonald et al., 1998
;
Weiss et al., 1998
). Similar
sequential patterns are seen for the corresponding genes in A.
gambiae (Fig. 2I,J; data
not shown). The ind pattern has a segmental periodicity in A.
gambiae (Fig. 2I), but is
otherwise similar to the expression pattern seen in D. melanogaster
(Fig. 2J).
The brinker gene encodes a transcriptional repressor that is a
component of the Dpp (BMP) signaling pathway in the D. melanogaster
embryo (Campbell and Tomlinson,
1999
; Jazwinska et al.,
1999
). It is activated in ventral and lateral regions of the
neurogenic ectoderm, in a pattern similar to vnd
(Fig. 2H). Once again, a
comparable pattern is seen in A. gambiae
(Fig. 2G). Overall, the
preceding results suggest that the initial patterning of the mesoderm and
neurogenic ectoderm depend on similar mechanisms in the fly and mosquito
embryos. The only clear difference is the formation of a coherent ventral
furrow and invaginated mesodermal tube in D. melanogaster.
Distinct patterning of the dorsal ectoderm
There is a clear difference in the dorsal ectoderm of D.
melanogaster and A. gambiae embryos. The A. gambiae
embryo is enclosed by the serosa, an external cuboidal layer of cells that
forms an extraembryonic membrane (Fig.
3B,D,E,F; blue arrows in B and D, pseudo-colored blue in F). There
is also a separate amnion that connects the embryo proper to the serosa (e.g.
Fig. 3D,F - red arrow in D and
pseudo-colored red in F) and therefore resides between the external serosa and
the germband. The establishment of a double-layered extraembryonic envelope is
a highly dynamic process, well described for a number of diverse insects
(reviewed by Schmidt-Ott,
2005
) (see also van der Zee et
al., 2005
). The electron micrograph in
Fig. 3A and the DIC image in
Fig. 3D show the initial phases
of germband elongation in the mosquito. At this stage the caudal regions of
the germband begin to migrate beneath the serosa and the double-layered
topology of the extraembryonic membrane is established. The EMs have not yet
extended to ventral regions (Fig.
3A). Later, the amnion continues to migrate over the germband
stretching the serosa around the embryo
(Fig. 3B,E,F). Finally, the
A. gambiae embryo becomes fully enclosed, whereby the amnion and
serosa fuse along the ventral midline of the germband.
|
|
Early separation of serosa and aminon lineages
A variety of dorsal patterning genes were examined in A. gambiae
embryos in an effort to determine the basis for the formation of distinct
ectodermal derivatives. For example hindsight (hnt; also
known as peb - Flybase) (Frank
and Rushlow, 1996
) is expressed along the dorsal midline of D.
melanogaster embryos (Fig.
4B), while tailup (tup)
(Thor and Thomas, 1997
) is
expressed in a broader pattern that encompasses both the presumptive
amnioserosa and dorsolateral ectoderm (Fig.
4D). The hnt expression pattern seen in A.
gambiae is similar to that detected in D. melanogaster, although
there is a marked expansion in the dorsal-ventral limits of the presumptive
extra-embryonic territory (Fig.
4A; prospective serosa is marked by red oval). By contrast, the
tup pattern in A. gambiae is dramatically different from
that seen in D. melanogaster - it is excluded from the prospective
serosa and restricted to the future amnion
(Fig. 4C).
The T-box genes Dorsocross1 (Doc1) and Doc2 are
involved in amnioserosa development and expressed along the dorsal midline and
in a transverse stripe near the cephalic furrow of gastrulating D.
melanogaster embryos (Reim et al.,
2003
) (Fig. 4F).
The Doc1 and Doc2 orthologues in A. gambiae exhibit
restricted expression in the presumptive amnion
(Fig. 4E,G; the white arrow in
G indicates the amnion), similar to the tup pattern. The expression
patterns of the two genes are identical but only Doc1 is shown. They
are initially expressed in a broad dorsal domain (data not shown) but come to
be repressed in the serosa. There is also a head stripe of expression
comparable to the D. melanogaster pattern
(Fig. 4E). Additional
dorsal-ventral patterning genes are also expressed in a restricted pattern
within the developing amnion (see Fig. S1 in supplementary material). Overall,
the early expression patterns of tup, Doc1 and Doc2 (and
additional patterning genes) foreshadow the subdivision of the dorsal ectoderm
into separate serosa and amnion lineages in Anopheles.
Altered expression of Dpp signaling components in Anopheles embryos
In D. melanogaster, the patterning of the dorsal ectoderm depends
on Dpp and Zen, along with a variety of genes encoding Dpp signaling
components, such as the Thickveins (Tkv) receptor. Most of the corresponding
genes are expressed in divergent patterns in A. gambiae embryos
(Fig. 5). For example,
dpp and tkv are initially expressed throughout the dorsal
ectoderm (data not shown), but become excluded from the presumptive serosa and
restricted to the amnion (Fig.
5A,C). By contrast, both genes have broad, nearly uniform
expression patterns in the dorsal ectoderm of D. melanogaster embryos
(Fig. 5B,D).
There is an equally dramatic change in the zen expression pattern. In A. gambiae, expression is restricted to the presumptive serosa territory, even at the earliest stages of development (Fig. 5E,G). By contrast, zen is initially expressed throughout the dorsal ectoderm of cellularizing embryos in D. melanogaster (Fig. 5F), and becomes restricted to the dorsal midline by the onset of gastrulation (Fig. 5H). Thus, the dpp/tkv and zen expression patterns are essentially complementary in A. gambiae embryos, but extensively overlap in Drosophila (see below).
|
|
Different segmentation genes were examined in an effort to identify
putative serosa-specific repressors. For example, the gap gene
hunchback (hb) is initially expressed in the anterior
regions of A. gambiae embryos, in a similar pattern to that seen in
D. melanogaster (Bender et al.,
1988
; Lehmann and
Nusslein-Volhard, 1987
), but by the onset of gastrulation a novel
pattern arises within the presumptive serosa
(Goltsev et al., 2004
).
hb expression has also been seen in the developing serosa of other
insects, including a primitive fly (Clogmia) and the flour beetle,
Tribolium (Stauber et al.,
2002
; Wolff et al.,
1995
).
Two additional segmentation genes behave like hb, empty spiracles
(ems) and tramtrack (ttk)
(Fig. 6A,C). ems is
involved in head patterning in D. melanogaster
(Dalton et al., 1989
). Its
expression is limited to a single stripe in anterior regions of cellularizing
D. melanogaster embryos (Fig.
6B). Staining is seen in a comparable anterior region of A.
gambiae embryos (Fig. 6A),
but a second site of expression - not seen in Drosophila - is also
detected in the presumptive serosa.
Ttk is a maternal repressor that helps establish the expression limits of
several pair-rule stripes (Read et al.,
1992
). It is ubiquitously expressed throughout the early D.
melanogaster embryo (Fig.
6D), but has a tightly localized expression pattern within the
presumptive serosa of A. gambiae embryos
(Fig. 6C). Thus, novel patterns
of ems and ttk expression are consistent with the
possibility that serosa-specific repressors help subdivide the dorsal ectoderm
into separate serosa and amnion lineages in A. gambiae embryos (see
Discussion).
Altered sog and tolloid expression patterns
The analysis of dorsal-ventral patterning genes identified two critical
differences between the pre-gastrular fly and mosquito embryos. First, there
are separate serosa and amnion lineages in A. gambiae, but just a
single amnioserosa in D. melanogaster. Second, there is an expansion
in the limits of the dorsal ectoderm in A. gambiae as compared with
the D. melanogaster embryo. Localized repressors might help explain
the former observation of separate lineages, but do not provide a basis for
the expansion of the dorsal ectoderm.
In D. melanogaster, the limits of Dpp signaling are established by
the repressor Brinker (Jazwinska et al.,
1999
) and the inhibitor Sog
(Francois et al., 1994
).
Genetic studies suggest that Sog is the more critical determinant in early
embryos. It is related to Chordin, which inhibits BMP signaling in vertebrates
(Francois and Bier, 1995
), and
is expressed in broad lateral stripes encompassing the entire neurogenic
ectoderm (Fig. 7B)
(Markstein et al., 2002
). The
secreted Sog protein directly binds Dpp, and blocks its ability to interact
with the Tkv receptor (e.g. Shimmi et al.,
2005
). However, Sog-Dpp complexes are proteolytically processed by
the Tolloid (Tld) metalloprotease
(Mullins, 1998
), which is
expressed throughout the dorsal ectoderm of early Drosophila embryos
(Fig. 7G)
(Marques et al., 1997
). Tld
helps ensure that high levels of the Dpp signal are released at the dorsal
midline located far from the restricted source of the inhibitor Sog
(Shimmi et al., 2005
).
The expression patterns of the sog and tld genes in A. gambiae are very different from those seen in D. melanogaster (Fig. 7). sog expression is primarily detected in the ventral mesoderm, although low levels of sog transcripts might extend into the ventral-most regions of the neurogenic ectoderm (Fig. 7A,F). This pattern is more restricted across the dorsal-ventral axis than the D. melanogaster sog pattern (Fig. 7B). tld expression is restricted to lateral regions of A. gambiae embryos (Fig. 7C,H) and is excluded from the dorsal ectoderm, which is the principal site of expression in Drosophila (Fig. 7G). These significant changes in the sog and tld expression patterns might account, at least in part, for the expanded limits of Dpp signaling in the dorsal ectoderm of A. gambiae embryos (see Discussion).
|
|
There is a marked expansion of the pMad expression domain in A.
gambiae embryos as compared with Drosophila
(Fig. 7D,E). The domain
encompasses the entire presumptive serosa and extends into portions of the
presumptive amnion. The dpp and tkv expression patterns are
downregulated in the presumptive serosa
(Fig. 5A,C), nonetheless, the
pMad staining pattern clearly indicates that this is the site of peak Dpp
signaling activity. The early expression of both dpp and tkv
encompasses the entire dorsal ectoderm. It would appear that peak Dpp
signaling is somehow maintained in the developing serosa even after the
downregulation of dpp and tkv expression in this tissue (see
Discussion). A similar scenario is seen in the Drosophila embryo, in
that there is downregulation of both dpp and tkv expression
along the dorsal midline of gastrulating embryos (e.g.
Affolter et al., 1994
).
The A. gambiae sog enhancer
To determine the basis for expanded Dpp signaling we identified and
characterized a sog enhancer in A. gambiae. The D.
melanogaster enhancer is located in the first intron of the sog
transcription unit (Fig. 8D).
It is
300 bp in length and contains four evenly spaced, optimal Dorsal
binding sites (Markstein et al.,
2002
). These sites permit activation of sog expression by
low levels of the Dorsal gradient; however, closely linked Snail repressor
sites inactivate the enhancer in the ventral mesoderm. A putative A.
gambiae enhancer was identified by scanning the sog locus for
potential clusters of Dorsal binding sites. The recently developed
cluster-draw program was used for this purpose since it successfully
identified a sim enhancer in the honeybee, Apis mellifera,
which is even more divergent than Anopheles
(Zinzen et al., 2006
). The
best putative Dorsal binding cluster was identified within the first intron of
the A. gambiae sog locus (Fig.
8C). Several genomic DNA fragments were tested for enhancer
activity, but only this cluster was found to activate gene expression in
transgenic Drosophila embryos (summarized in
Fig. 8D).
Two different genomic DNA fragments, 3.7 kb and 1.1 kb, that encompass the intronic binding cluster were tested in transgenic embryos (see Fig. 8D). Both fragments were attached to a lacZ reporter gene containing the core eve promoter from D. melanogaster, and both direct lacZ expression in the presumptive mesoderm (Fig. 8A,B; data not shown). They exhibit the same restricted dorsal-ventral limits of expression as that seen for the endogenous sog gene in A. gambiae, although the smaller fragment produces ventral stripes whereas the larger fragment directs a more uniform pattern (not shown). The change in the dorsal-ventral limits - broad expression in D. melanogaster and restricted expression in A. gambiae - might be due to the quality of individual Dorsal binding sites in the two enhancers (see Discussion).
| DISCUSSION |
|---|
|
|
|---|
|
Evolution of extra-embryonic morphology
D. melanogaster is somewhat unusual in having an amnioserosa,
rather than separate serosa and amnion tissues as seen in most insects
(Dearden et al., 2000
;
Panfilio et al., 2006
;
Stauber et al., 2002
;
van der Zee et al., 2005
). In
certain mosquitoes the serosa secretes an additional proteinaceous membrane
that provides extra protection against desiccation
(Harwood, 1958
;
Harwood and Horsfall, 1959
).
The changes in gene expression in the D. melanogaster and A.
gambiae dorsal ectoderm provide a basis for understanding the
evolutionary transition of two dorsal tissues in A. gambiae into a
novel single tissue in higher dipterans.
The D. melanogaster amnioserosa expresses a variety of regulatory
genes, including Doc1/2 and tup. The expression of most of
these genes is restricted in the presumptive amnion of the A. gambiae
embryo. zen is the only dorsal patterning gene, among those tested,
that exhibits restricted expression in the serosa. Several segmentation genes
have a similar pattern, and one of these, ttk, encodes a known
repressor. Ectopic expression of Ttk causes a variety of patterning defects in
Drosophila embryos, including disruptions in head involution and
germband elongation that might arise from alterations in the amnioserosa
(Read et al., 1992
). We
propose that zen activates ttk in the serosa of A.
gambiae embryos. The encoded repressor might subdivide the dorsal
ectoderm into separate serosa and amnion tissues by inhibiting the expression
of Doc1/2 and tup in the serosa. The loss of this putative
zen-ttk regulatory linkage might be sufficient to allow Dpp signaling
to activate tup and Doc1/2 throughout the dorsal ectoderm,
thereby transforming separate serosa and amnion tissues into a single
amnioserosa. According to this scenario, the loss of zen binding
sites in ttk regulatory sequences might be responsible for the
evolutionary transition of the amnioserosa (summarized in
Fig. 9; see below).
Expansion of the dorsal ectoderm territory
The formation of separate amnion and serosa tissues is not the only
distinguishing feature of A. gambiae embryos when compared with
D. melanogaster. There is also a significant expansion in the overall
limits of the dorsal ectoderm. This can be explained, in part, by distinct
patterns of sog expression.
The broad expression limits of the Sog inhibitor are responsible for
restricting Dpp/pMad signaling to the dorsal midline of the D.
melanogaster embryo (summarized in
Fig. 9A). This pattern depends
on a highly sensitive response of the sog intronic enhancer to the
lowest levels of the Dorsal gradient. The Dorsal binding sites in the
sog enhancer are optimal sites, possessing perfect matches to the
idealized position weighted matrix of Dorsal recognition sequences
(Papatsenko and Levine, 2005
).
By contrast, the A. gambiae intronic sog enhancer
contains low-quality Dorsal binding sites, similar to those seen in the
regulatory sequences of genes activated by peak levels of the Dorsal gradient,
such as twist. The binding sites in the D. melanogaster sog
enhancer have an average score of
10. By contrast, the best sites in the
A. gambiae sog enhancer have scores in the 6.5-7 range, typical of
enhancers that mediate expression in the mesoderm in response to high levels
of the Dorsal gradient (Fig.
9B). Although we did not explicitly test every potential
regulatory sequence in the A. gambiae sog locus, none of the putative
Dorsal binding clusters in the vicinity of the gene possess the quality
required for activation by low levels of the Dorsal gradient in the neurogenic
ectoderm. Thus, the narrow limits of sog expression in A.
gambiae embryos can be explained by the occurrence of low-quality Dorsal
binding sites, along with the loss of Snail repressor sites.
|
In Drosophila, tld is regulated by a 5' silencer element
that prevents the gene from being expressed in ventral and lateral regions in
response to high and low levels of the Dorsal gradient. This silencing
activity is due to close linkage of Dorsal binding sites and recognition
sequences for `co-repressor' proteins (e.g.
Ratnaparkhi et al., 2006
). Our
preliminary studies suggest that Dorsal activates the A. gambiae tld
gene, possibly by the loss of co-repressor binding sites in the 5'
enhancer (Kirov et al.,
1993
).
We propose that there are at least two distinct threshold readouts of Dpp signaling in the dorsal ectoderm of A. gambiae embryos. Type 1 target genes, such as hb, ems, ttk and zen, are activated by high levels and thereby restricted to the presumptive serosa. Type 2 target genes, such as tup and Doc1/2, can be activated - in principle - by both high and low levels of Dpp signaling in the presumptive serosa and amnion. However, these target enhancers contain binding sites for one or more type 1 repressors expressed in the serosa. Our favorite candidate repressor is Ttk. Perhaps the type 2 tup enhancer contains optimal pMad activator sites as well as binding sites for the localized repressor Ttk, which keeps tup expression off in the serosa and restricted to the amnion (see diagram in Fig. 9C). As discussed earlier, the simple loss of ttk regulation by the Dpp signaling network might be sufficient to account for the evolutionary conversion of separate serosa and amnion tissues into a single amnioserosa. Localization of this single tissue within a restricted domain along the dorsal midline would arise from concomitant dorsal shifts in the sog and tld expression patterns.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/13/2415/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Affolter, M., Nellen, D., Nussbaumer, U. and Basler, K. (1994). Multiple requirements for the receptor serine/threonine kinase thick veins reveal novel functions of TGF beta homologs during Drosophila embryogenesis. Development 120,3105 -3117.[Abstract]
Ashe, H. L. and Levine, M. (1999). Local inhibition and long-range enhancement of Dpp signal transduction by Sog. Nature 398,427 -431.[CrossRef][Medline]
Bender, M., Horikami, S., Cribbs, D. and Kaufman, T. C. (1988). Identification and expression of the gap segmentation gene hunchback in Drosophila melanogaster. Dev. Genet. 9, 715-732.[CrossRef][Medline]
Boulay, J. L., Dennefeld, C. and Alberga, A. (1987). The Drosophila developmental gene snail encodes a protein with nucleic acid binding fingers. Nature 330,395 -398.[CrossRef][Medline]
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Campbell, G. and Tomlinson, A. (1999). Transducing the Dpp morphogen gradient in the wing of Drosophila: regulation of Dpp targets by brinker. Cell 96,553 -562.[CrossRef][Medline]
Christophers, S. R. (1960). Aedes aegyptae (L.) the Yellow Fever Mosquito. Cambridge: Cambridge University Press.
Costa, M., Wilson, E. T. and Wieschaus, E. (1994). A putative cell signal encoded by the folded gastrulation gene coordinates cell shape changes during Drosophila gastrulation. Cell 76,1075 -1089.[CrossRef][Medline]
Dalton, D., Chadwick, R. and McGinnis, W.
(1989). Expression and embryonic function of empty spiracles: a
Drosophila homeo box gene with two patterning functions on the
anterior-posterior axis of the embryo. Genes Dev.
3,1940
-1956.
Davis, C. W. C. (1967). A comparative study of larval embryogenesis in the mosquito Culex fatigans Wiedemann (Diptera: Cilicidae) and the sheep-fly Lucilia sericata Meigen (Diptera Calliphoridae). II. Description of embryonic development. Aust. J. Zool. 18,547 -579.
Dawes-Hoang, R. E., Parmar, K. M., Christiansen, A. E., Phelps,
C. B., Brand, A. H. and Wieschaus, E. F. (2005). folded
gastrulation, cell shape change and the control of myosin localization.
Development 132,4165
-4178.
Dearden, P., Grbic, M., Falciani, F. and Akam, M. (2000). Maternal expression and early zygotic regulation of the Hox3/zen gene in the grasshopper Schistocerca gregaria. Evol. Dev. 2,261 -270.[CrossRef][Medline]
Decotto, E. and Ferguson, E. L. (2001). A
positive role for Short gastrulation in modulating BMP signaling during
dorsoventral patterning in the Drosophila embryo.
Development 128,3831
-3841.
Demerec, M. (1950). Biology of Drosophila. New York/London: John Wiley/Chapman & Hall.
Eldar, A., Dorfman, R., Weiss, D., Ashe, H., Shilo, B. Z. and Barkai, N. (2002). Robustness of the BMP morphogen gradient in Drosophila embryonic patterning. Nature 419,304 -308.[CrossRef][Medline]
Francois, V. and Bier, E. (1995). Xenopus chordin and Drosophila short gastrulation genes encode homologous proteins functioning in dorsal-ventral axis formation. Cell 80, 19-20.[CrossRef][Medline]
Francois, V., Solloway, M., O'Neill, J. W., Emery, J. and Bier,
E. (1994). Dorsal-ventral patterning of the Drosophila embryo
depends on a putative negative growth factor encoded by the short gastrulation
gene. Genes Dev. 8,2602
-2616.
Frank, L. H. and Rushlow, C. (1996). A group of genes required for maintenance of the amnioserosa tissue in Drosophila.Development 122,1343 -1352.[Abstract]
Gailey, D. A., Billeter, J. C., Liu, J. H., Bauzon, F.,
Allendorfer, J. B. and Goodwin, S. F. (2006). Functional
conservation of the fruitless male sex-determination gene across 250 Myr of
insect evolution. Mol. Biol. Evol.
23,633
-643.
Goltsev, Y., Hsiong, W., Lanzaro, G. and Levine, M. (2004). Different combinations of gap repressors for common stripes in Anopheles and Drosophila embryos. Dev. Biol. 275,435 -446.[CrossRef][Medline]
Guichard, M. (1971). Etude in vivo du developpment embryonnaire de Culex pipiens. Comparaison avec Calliphora erythrocephala (Diptera). Ann. Soc. Entomol. Fr. 7,325 -341.
Harwood, R. F. (1958). Development, structure, and function of coverings of eggs of floodwater mosquitoes. II. Postovarian structure. Ann. Entomol. Soc. Am. 51,464 -471.
Harwood, R. F. and Horsfall, W. R. (1959). Development, structure and function of coverings of eggs of floodwater mosquitoes. III. Functions of coverings. Ann. Entomol. Soc. Am. 52,113 -116.
Holley, S. A., Jackson, P. D., Sasai, Y., Lu, B., De Robertis, E. M., Hoffmann, F. M. and Ferguson, E. L. (1995). A conserved system for dorsal-ventral patterning in insects and vertebrates involving sog and chordin. Nature 376,249 -253.[CrossRef][Medline]
Idris, B. E. M. (1960). Die Entwicklung im normalen Ei von Culex Pipiens L. (Diptera). Z. Morphol. Okol. Tiere 49,387 -429.[CrossRef]
Ip, Y. T., Park, R. E., Kosman, D., Bier, E. and Levine, M.
(1992). The dorsal gradient morphogen regulates stripes of
rhomboid expression in the presumptive neuroectoderm of the Drosophila embryo.
Genes Dev. 6,1728
-1739.
Ivanova-Kazas, O. M. (1949). Embryonic development of Anopheles maculipennis. Izv. Akad. Nauk SSSR Biol. 2,140 -170.
Jazwinska, A., Kirov, N., Wieschaus, E., Roth, S. and Rushlow, C. (1999). The Drosophila gene brinker reveals a novel mechanism of Dpp target gene regulation. Cell 96,563 -573.[CrossRef][Medline]
Keller, R. E. (1981). An experimental analysis of the role of bottle cells and the deep marginal zone in gastrulation of Xenopus laevis. J. Exp. Zool. 216,81 -101.[CrossRef][Medline]
Kirov, N., Zhelnin, L., Shah, J. and Rushlow, C. (1993). Conversion of a silencer into an enhancer: evidence for a co-repressor in dorsal-mediated repression in Drosophila. EMBO J. 12,3193 -3199.[Medline]
Lehmann, R. and Nusslein-Volhard, C. (1987). hunchback, a gene required for segmentation of an anterior and posterior region of the Drosophila embryo. Dev. Biol. 119,402 -417.[CrossRef][Medline]
Lenardo, M. J. and Baltimore, D. (1989). NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58,227 -229.[CrossRef][Medline]
Leptin, M. and Grunewald, B. (1990). Cell shape changes during gastrulation in Drosophila. Development 110, 73-84.[Abstract]
Leptin, M., Casal, J., Grunewald, B. and Reuter, R. (1992). Mechanisms of early Drosophila mesoderm formation. Dev. Suppl. 1992,23 -31.
Levine, M. and Davidson, E. H. (2005). Gene
regulatory networks for development. Proc. Natl. Acad. Sci.
USA 102,4936
-4942.
Markstein, M., Markstein, P., Markstein, V. and Levine, M.
S. (2002). Genome-wide analysis of clustered Dorsal binding
sites identifies putative target genes in the Drosophila embryo.
Proc. Natl. Acad. Sci. USA
99,763
-768.
Marques, G., Musacchio, M., Shimell, M. J., Wunnenberg-Stapleton, K., Cho, K. W. and O'Connor, M. B. (1997). Production of a DPP activity gradient in the early Drosophila embryo through the opposing actions of the SOG and TLD proteins. Cell 91,417 -426.[CrossRef][Medline]
Martin-Bermudo, M. D., Carmena, A. and Jimenez, F. (1995). Neurogenic genes control gene expression at the transcriptional level in early neurogenesis and in mesectoderm specification. Development 121,219 -224.[Abstract]
McDonald, J. A., Holbrook, S., Isshiki, T., Weiss, J., Doe, C.
Q. and Mellerick, D. M. (1998). Dorsoventral patterning in
the Drosophila central nervous system: the vnd homeobox gene specifies ventral
column identity. Genes Dev.
12,3603
-3612.
Mizutani, C. M., Nie, Q., Wan, F. Y., Zhang, Y. T., Vilmos, P., Sousa-Neves, R., Bier, E., Marsh, J. L. and Lander, A. D. (2005). Formation of the BMP activity gradient in the Drosophila embryo. Dev. Cell 8,915 -924.[CrossRef][Medline]
Moussian, B. and Roth, S. (2005). Dorsoventral axis formation in the Drosophila embryo - shaping and transducing a morphogen gradient. Curr. Biol. 15,R887 -R899.[CrossRef][Medline]
Mullins, M. C. (1998). Holy Tolloido: Tolloid cleaves SOG/Chordin to free DPP/BMPs. Trends Genet. 14,127 -129.[CrossRef][Medline]
Panfilio, K. A., Liu, P. Z., Akam, M. and Kaufman, T. C. (2006). Oncopeltus fasciatus zen is essential for serosal tissue function in katatrepsis. Dev. Biol. 292,226 -243.[CrossRef][Medline]
Papatsenko, D. and Levine, M. (2005).
Quantitative analysis of binding motifs mediating diverse spatial readouts of
the Dorsal gradient in the Drosophila embryo. Proc. Natl. Acad.
Sci. USA 102,4966
-4971.
Persson, U., Izumi, H., Souchelnytskyi, S., Itoh, S., Grimsby, S., Engstrom, U., Heldin, C. H., Funa, K. and ten Dijke, P. (1998). The L45 loop in type I receptors for TGF-beta family members is a critical determinant in specifying Smad isoform activation. FEBS Lett. 434,83 -87.[CrossRef][Medline]
Podos, S. D. and Ferguson, E. L. (1999). Morphogen gradients: new insights from DPP. Trends Genet. 15,396 -402.[CrossRef][Medline]
Ratnaparkhi, G. S., Jia, S. and Courey, A. J.
(2006). Uncoupling dorsal-mediated activation from
dorsal-mediated repression in the Drosophila embryo.
Development 133,4409
-4414.
Read, D., Levine, M. and Manley, J. L. (1992). Ectopic expression of the Drosophila tramtrack gene results in multiple embryonic defects, including repression of even-skipped and fushi tarazu. Mech. Dev. 38,183 -195.[CrossRef][Medline]
Reim, I., Lee, H. H. and Frasch, M. (2003). The
T-box-encoding Dorsocross genes function in amnioserosa development
and the patterning of the dorsolateral germ band downstream of Dpp.Development 130,3187
-3204.
Rubin, G. M. and Spradling, A. C. (1982).
Genetic transformation of Drosophila with transposable element vectors.
Science 218,348
-353.
Sander, K. (1975). Pattern specification in the insect embryo. Ciba Found. Symp. 29,241 -263.[Medline]
Santini, S., Boore, J. L. and Meyer, A. (2003).
Evolutionary conservation of regulatory elements in vertebrate Hox gene
clusters. Genome Res.
13,1111
-1122.
Schmidt-Ott, U. (2000). The amnioserosa is an apomorphic character of cyclorrhaphan flies. Dev. Genes Evol. 210,373 -376.[CrossRef][Medline]
Schmidt-Ott, U. (2005). Insect serosa: a head line in comparative developmental genetics. Curr. Biol. 15,R245 -R247.[CrossRef][Medline]
Shimmi, O., Umulis, D., Othmer, H. and O'Connor, M. B. (2005). Facilitated transport of a Dpp/Scw heterodimer by Sog/Tsg leads to robust patterning of the Drosophila blastoderm embryo. Cell 120,873 -886.[CrossRef][Medline]
Small, S., Blair, A. and Levine, M. (1992). Regulation of even-skipped stripe 2 in the Drosophila embryo. EMBO J. 11,4047 -4057.[Medline]
Stathopoulos, A. and Levine, M. (2002). Dorsal gradient networks in the Drosophila embryo. Dev. Biol. 246, 57-67.[CrossRef][Medline]
Stathopoulos, A. and Levine, M. (2004). Whole-genome analysis of Drosophila gastrulation. Curr. Opin. Genet. Dev. 14,477 -484.[CrossRef][Medline]
Stathopoulos, A. and Levine, M. (2005). Genomic regulatory networks and animal development. Dev. Cell 9, 449-462.[CrossRef][Medline]
Stauber, M., Jackle, H. and Schmidt-Ott, U.
(1999). The anterior determinant bicoid of Drosophila is a
derived Hox class 3 gene. Proc. Natl. Acad. Sci. USA
96,3786
-3789.
Stauber, M., Prell, A. and Schmidt-Ott, U.
(2002). A single Hox3 gene with composite bicoid and zerknullt
expression characteristics in non-Cyclorrhaphan flies. Proc. Natl.
Acad. Sci. USA 99,274
-279.
Thisse, B., Stoetzel, C., El Messal, M. and Perrin-Schmitt,
F. (1987). Genes of the Drosophila maternal dorsal group
control the specific expression of the zygotic gene twist in presumptive
mesodermal cells. Genes Dev.
1, 709-715.
Thor, S. and Thomas, J. B. (1997). The Drosophila islet gene governs axon pathfinding and neurotransmitter identity. Neuron 18,397 -409.[CrossRef][Medline]
van der Zee, M., Berns, N. and Roth, S. (2005). Distinct functions of the Tribolium zerknullt genes in serosa specification and dorsal closure. Curr. Biol. 15,624 -636.[CrossRef][Medline]
Weiss, J. B., Von Ohlen, T., Mellerick, D. M., Dressler, G.,
Doe, C. Q. and Scott, M. P. (1998). Dorsoventral patterning
in the Drosophila central nervous system: the intermediate neuroblasts
defective homeobox gene specifies intermediate column identity.
Genes Dev. 12,3591
-3602.
Wolff, C., Sommer, R., Schroder, R., Glaser, G. and Tautz, D. (1995). Conserved and divergent expression aspects of the Drosophila segmentation gene hunchback in the short germ band embryo of the flour beetle Tribolium. Development 121,4227 -4236.[Abstract]
Zinzen, R. P., Cande, J., Ronshaugen, M., Papatsenko, D. and Levine, M. (2006). Evolution of the ventral midline in insect embryos. Dev. Cell 11,895 -902.[CrossRef][Medline]
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||