|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online June 25, 2007
doi: 10.1242/10.1242/dev.02864



1 División de Genética, Universidad Miguel Hernández,
Campus de San Juan, Ctra. de Valencia s/n, 03550-San Juan de Alicante,
Spain.
2 Instituto de Biología Molecular y Celular de Plantas (CSIC-UPV), Avda.
de los Naranjos s/n, 46022-Valencia, Spain.
Author for correspondence (e-mail:
laborda{at}umh.es)
Accepted 25 April 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis, Fruit development, Pattern formation, ASYMMETRIC LEAVES 1, BREVIPEDICELLUS (KNAT1), Class I KNOX genes
| INTRODUCTION |
|---|
|
|
|---|
The MADS-box gene FRUITFULL (FUL) represses the
expression in valves of genes involved in valve margin development
(Ferrándiz et al.,
2000a
; Liljegren et al.,
2004
), the MADS-box genes SHATTERPROOF (SHP1 and
SHP2) (Liljegren et al.,
2000
), and their downstream genes ALCATRAZ (ALC)
and INDEHISCENT (IND), both of which code for basic
helix-loop-helix (bHLH) domain proteins
(Rajani and Sundaresan, 2001
;
Liljegren et al., 2004
). In
this way, FUL prevents valves from adopting a valve margin fate
(Ferrándiz et al.,
2000a
; Liljegren et al.,
2004
). The FUL and SHP genes are induced by the
cooperating activities of FILAMENTOUS FLOWER (FIL)
(Chen et al., 1999
;
Sawa et al., 1999a
;
Sawa et al., 1999b
) and
YABBY3 (YAB3) (Siegfried
et al., 1999
), two genes belonging to the YABBY family involved in
abaxial tissue specification, and JAGGED (JAG), a gene that
encodes a putative transcription factor with a single C2H2 zinc-finger domain
and promotes growth in lateral organs
(Dinneny et al., 2004
;
Ohno et al., 2004
). These
genes probably act in a concentration-dependent manner, in such a way that
activation of FUL would require high levels of their products, while
SHP expression would be induced by lower levels
(Dinneny et al., 2005
). The
homeobox gene REPLUMLESS (RPL) downregulates valve margin
genes in the replum (Roeder et al.,
2003
; Liljegren et al.,
2004
) by repressing the expression of FIL, YAB3 and
JAG (Dinneny et al.,
2005
). This gene, also designated BELLRINGER
(BLR), PENNYWISE (PNY) and VAAMANA
(VAN), interacts with the class I KNOTTED1-like homeobox
(KNOX) genes SHOOTMERISTEMLESS (STM),
BREVIPEDICELLUS (BP, also known as KNAT1) and
KNAT6 to regulate meristem function
(Byrne et al., 2003
;
Smith and Hake, 2003
;
Bhatt et al., 2004
).
The mechanism by which leaf founder cells are distinguished from stem cells
of the meristem involves downregulation at positions of leaf initiation of
class I KNOX genes (Lincoln et al.,
1994
; Dockx et al.,
1995
; Long et al.,
1996
; Semiarti et al.,
2001
), and the subsequent expression of the ASYMMETRIC
LEAVES genes (AS1 and AS2)
(Byrne et al., 2000
;
Byrne et al., 2002
).
AS1 codes for a myb transcription factor
(Byrne et al., 2000
;
Sun et al., 2002
), and
AS2 encodes a protein containing the LATERAL ORGAN BOUNDARIES domain
(Iwakawa et al., 2002
;
Shuai et al., 2002
). Both
AS genes interact in the same pathway to promote the differentiation
of leaf cells by maintaining the repression of BP, KNAT2 and
KNAT6. Thus, in the absence of any of the AS products, these three
KNOX genes are misexpressed in leaves
(Byrne et al., 2000
;
Ori et al., 2000
;
Semiarti et al., 2001
;
Xu et al., 2003
).
As early as 1790, Goethe advanced the hypothesis that floral organs are
modified vegetative leaves (Coen,
2001
). This hypothesis has found strong support in genetic and
molecular research carried out during the last 15 years, such as the
transformation of floral organs into carpelloid leaf-like organs in a triple
mutant lacking the ABC homeotic functions
(Bowman et al., 1991
), and the
transformation of vegetative leaves into floral organs by the ectopic
expression of SEPALLATA and floral homeotic genes
(Honma and Goto, 2001
;
Pelaz et al., 2001
).
Interestingly, AS genes are also expressed in carpels
(Byrne et al., 2000
;
Sun et al., 2002
). However,
despite the probable foliar evolutionary origin of this organ
(Friedman et al., 2004
), the
role of AS1 and AS2 in the downregulation of class I KNOX
genes in carpels remains unclear. In this report, we show that AS1
also negatively regulates BP in ovary tissues. Thus, in as1
mutants, BP is misexpressed in the ovary, causing an increase in
replum size and a slight reduction in valve width. We also show a strong
interaction between loss-of-function alleles in AS1 and FUL,
so that double mutants exhibit very large repla and a small valve region.
These phenotypes can be interpreted as a shift of valve margins to more
lateral positions in the ovary. Our results, showing that BP is
expressed in the replum but not in valves and that this gene positively
regulates RPL expression, together with the phenotype caused by
BP misexpression, strongly suggest that class I KNOX genes play a
crucial role in replum development. A model is presented that accounts for the
function of these and other genes in patterning the ovary.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plant genetics
Multiple mutants were identified among the F2 from the
characteristic mutant phenotype caused by individual mutations: leaf phenotype
for as alleles, inflorescence phenotype for rpl alleles,
fruit phenotype for ful-1, and the downward-pointing fruit phenotype
for bp-1. The wild-type KNAT2 allele was genotyped using two
primers, KNAT2-1F (GACGTTTCAGTGTCGTACTGG) and KNAT2-1R
(CAAGCCTCTTGGCCATCAAGC), flanking the Ds transposon. The
knat2 homozygous plants did not yield any PCR product, and all their
offspring showed resistance to kanamycin. Partial introgression in Col
background of the 35S::BP construct and the as1-1 bp-1
genotype was achieved by crossing twice to Col and as1-1,
respectively, to obtain 35S::BP (2xCol) and as1-1 bp-1
(2xCol) plants.
Student t-tests were performed on the data set of Fig. 2. In every case, the null hypothesis (Ho) to be tested was that the lines being compared showed the same phenotype. Tests of statistical significance are included in the supplementary material (see Table S1 in the supplementary material).
Microscopy
Light microscopy and scanning electron microscopy (SEM) were performed as
previously described (Ripoll et al.,
2006
). For GUS staining, samples were treated for 15 minutes in
90% ice-cold acetone, and then washed for 5 minutes with washing buffer (25 mM
sodium phosphate; 5 mM potassium ferrocyanide; 5 mM potassium ferricyanide; 1%
Triton X-100), vacuum infiltrated for 10 minutes in staining buffer (washing
buffer with 2 mM X-Gluc) and incubated overnight at 37°C. Phloroglucinol
staining was done as previously described
(Liljegren et al., 2000
).
In situ hybridization was carried out as described by Ferrándiz and
co-workers (Ferrándiz et al.,
2000b
). A 369 bp fragment from AS1 was amplified by PCR
with the primers AS1-7 (GTAGCGAGAGTGTGTTCTTGTC) and AS1-8
(CAGGGGCGGTCTAATCTGC) and cloned into the pGEM-T vector (Promega). Two
micrograms of NcoI-linearized plasmid were used to generate a
DIG-labeled antisense riboprobe. A sense DIG-labeled riboprobe was generated
after digestion with SpeI.
Quantitative real-time PCR
RNA was extracted using the Qiagen RNeasy Plant Minikit, and DNA
contamination was removed using the Qiagen RNase-free DNase Set.
Reverse-transcription was performed from 1 µg RNA using the SuperScript
First Strand kit (Invitrogen). Real-time PCR was performed using the Sybr
Green PCR Master Mix (Applied Bioscience) in a volume of 20 µl on an ABI
Prism 7000 System (Applied Bioscience). ELONGATION FACTOR 1-
(EF1-
, AT5G60390) was used as an internal control to normalize
for variation in the amount of cDNA template
(Frigerio et al., 2006
).
Primers RPL-F (AAGGGCTTGGCTCTTCGATC) and RPL-R (TCTGTATCTGTTGGATAAGGATGCA)
were used to amplify a 51 bp fragment from RPL cDNA. The reported
values are averages of two biological replicates, each one composed of three
technical replicates. To calculate relative expression levels, RPL
transcript levels were normalized relative to the standard EF1-
using the equation
CT=CT(RPL) -
CT(EF1-
). Relative expression levels were
calculated applying the formula 2-[
CT
(35S::BP) -
CT (No-0)].
| RESULTS |
|---|
|
|
|---|
We compared fruits of as1-1 and Col, and found that the mutant displayed slightly altered siliques with a moderate bumpy appearance (Fig. 1A,B). A closer inspection of these fruits showed that they had developed enlarged repla (Fig. 1C,D). Cross sections revealed that mutant repla contained more cells than those of the wild type, as seen in the outer layer of the replum (Fig. 1E,F; Fig. 2; see Table S1 in the supplementary material). Unlike the case in the replum, the number of outer epidermal cells in mutant valves was smaller (Fig. 2; see Table S1 in the supplementary material), causing a reduction in valve width, which was the most likely reason for the bumpy aspect of the fruits. This phenotype was observed irrespective of the genetic background, as the as1-104 mutant, homozygous for a null allele of AS1 in Ler background (see Fig. S1 in the supplementary material), also showed large repla and a reduction in valve width (Fig. 1G-L; Fig. 2; see Table S1 in the supplementary material). In addition, fruits of as2-1 displayed the same phenotype as seen in those of as1-1 (Fig. 1M), suggesting that both genes collaborate in the same pathway of fruit patterning.
|
BP is involved in the fruit phenotype of as1 mutants
Misexpression of class I KNOX genes appears as a possible cause for the
fruit phenotypes observed in as1-1 and as2-1 mutants. Thus,
we examined the effect on the fruit of the 35S::BP construct, in the
original No-0 background and after its partial introgression in Col
[35S::BP (2xCol) plants]. These plants displayed a phenotype similar
to that seen in as1-1 fruits (Fig.
1N; see Table S1 in the supplementary material). Repla were wider
than those of wild-type plants and showed an increased cell number, while the
valves exhibited a small reduction in size because of the lower number of
cells (Fig. 2; see Table S1 in
the supplementary material). Numbers of cells in valves and repla of wild-type
segregants of the introgression in Col of the 35S::BP construct
(valve=63±3.9, n=20; replum=8±0.9, n=20) were
also clearly different from those seen in 35S::BP and
35S::BP (2xCol) plants (see Table S1 in the supplementary
material).
To further investigate the role of BP in the mutant phenotype, we
obtained double mutants carrying as1-1 and the null allele
bp-1, which were inspected after two backcrosses with Col [as1-1
bp-1 (2xCol) plants], as well as as1-104 bp-1 plants in
Ler background. The alteration produced in fruits by both
as1 mutations was partially alleviated in the double mutants. Repla
were narrow, practically reverting to the appearance of the wild type
(Fig. 1O,P), and numbers of
cells in both repla and valves were different from those of the as1
mutants (Fig. 2; see Table S1
in the supplementary material). This partial rescue suggests that factors
redundant with BP are also involved in the fruit mutant phenotype of
as1-1, and the other class I KNOX genes can be considered good
candidates for such a redundant activity. A possible candidate is the
KNAT2 gene, which is expressed in the wild-type replum
(Ori et al., 2000
;
Pautot et al., 2001
). However,
the knat2 allele did not modify the phenotypes of as1-1 and
as1-1 bp-1 fruits (see Fig. S4E-H in the supplementary material).
This suggests that either KNAT2 does not participate in the fruit
mutant phenotype conferred by the as1-1 allele or that KNAT2
is completely redundant with another class I KNOX family gene.
|
|
|
We used a reporter line for RPL, the BLR::GUS line
(Byrne at al., 2003
), to
examine the expression of the gene in wild-type and 35S::BP plants.
In order to compare both expressions in homogeneous genetic backgrounds, we
studied GUS staining in two kinds of F1 individuals carrying the
BLR::GUS construct in heterozygosis, those resulting from a cross
between BLR::GUS and 35S::BP plants
(35S::BP/+;BLR::GUS/+ plants) and those
resulting from a cross between BLR::GUS and No-0 plants
(+/+;BLR::GUS/+ plants). RPL
expression in the wild type was confined to the replum, with the strongest
signal at stage 12 (Fig. 4A),
as previously reported (Roeder et al.,
2003
). Plants containing the 35S::BP construct exhibited
ectopic expression of BLR::GUS in cotyledons, leaves, valves and
valve margins (Fig. 4A-D),
which indicates that BP positively regulates the expression of the
RPL promoter. This activation was confirmed by quantitative real-time
PCR (qRT-PCR), which showed an increase of RPL transcripts in
35S::BP plants compared with the No-0 accession (see Fig. S3 in the
supplementary material).
|
We then obtained as1 rpl double mutants to investigate whether the overexpression of class I KNOX genes affects the replumless phenotype caused by rpl alleles. Thirteen out of 24 repla of the as1-1 rpl-2 double mutant exhibited a wild-type phenotype (Fig. 4H,L), whereas the remaining 11 showed a moderate mutant phenotype (not shown), indicating a partial rescue of rpl-2 repla by as1-1. The as1-1 allele also rescued replum development when combined with rpl-1. Thus, outer repla of the as1-1 rpl-1 double mutant, both in ER and er backgrounds, displayed either a wild-type (Fig. 4I) or a moderate mutant (Fig. 4J) phenotype. This suggests that, in the absence of RPL, an excess of class I KNOX products may prevent, either directly or indirectly, the expression of valve margin identity genes in the replum. In addition, the number of outer epidermal cells in valves of as1-1 rpl-2 fruits (48.3±5.2; n=18) was similar to those of as1-1 and 35S::BP plants (Fig. 2), indicating that RPL plays no role in the reduced valve width of these plants.
Synergistic interaction between as1 and ful mutant alleles
BP is expressed in the presumptive replum and valve margin, and
might have a role in controlling pattern formation in these tissues. In this
sense, the fruit phenotype caused by the as1-1 mutation and the
resulting overexpression of BP could be interpreted as a lateral
shift of the borders between the territories of the replum and the valves in
the ovary, which would result in replum expansion, a consequent change in the
positions of the valve margins, and a modest reduction in valve size.
According to this hypothesis, eliminating FUL, a gene important for
valve development, in a background that overexpresses BP should
result in a synergistic interaction, severely affecting both replum and
valves, owing to a greater shift of the borders.
After pollination, ful-1 fails to appropriately differentiate and
elongate its valve cells, because of the ectopic expression of valve margin
identity genes (Ferrándiz et al.,
2000a
; Liljegren et al.,
2004
). Consequently, mutant siliques are small in size and show
compressed and creased repla (Fig.
5A,C), a phenotype that can also be interpreted in terms of a
shift in the boundaries between valves and replum, giving rise to the small
valves and large repla of ful-1. As predicted, the as1-104
ful-1 double mutant displayed extremely small valves, and very large,
rough and distorted repla, indicating a strong enhancement of the phenotypes
of the two single mutants both in valves and replum
(Fig. 5B,D), and favoring the
hypothesis that BP overexpression affects the positioning of the
borders between valves and replum. The same phenotype was also observed in
as1-1 ful-1, 35S::BP ful-1 and as2-1 ful-1 fruits (see Fig.
S5 in the supplementary material).
As the ful-1 mutation is caused by a Ds transposon
carrying a GUS enhancer trap element that has a transcription pattern that
mimics the expression domain of the FUL gene, we studied the GUS
expression pattern driven by the FUL promoter in ful-1,
as1-104 and as1-104 ful-1 fruits. Expression of the FUL
enhancer trap in the ful-1 single mutant was restricted to the valve
region (Fig. 5F), as previously
reported (Gu et al., 1998
),
and the same expression pattern was detected in as1-104 plants that
carried the ful-1 allele in heterozygosis
(Fig. 5E). This expression
remained unchanged in double mutant siliques in which GUS staining was also
detected in the aberrant valves (Fig.
5G). Interestingly, the comparison of GUS staining in the single
and double mutants clearly showed the different sizes of valves and repla. The
valve region was much more reduced in as1-104 ful-1 than in the
single mutants, while the opposite occurred with the replum, which was much
larger in the double mutant (Fig.
5E-G).
As shown above, RPL does not contribute to the reduction in cell numbers in the valves of as1-1 and 35S::BP siliques, as the number of outer epidermal cells in valves of these fruits is similar to those of as1-1 rpl-2 plants. However, this observation does not exclude the possibility that RPL might participate in the fruit phenotype caused by as1 null alleles in the absence of FUL function. To examine this, we crossed the as1-1 rpl-1 double mutant, in ER background, with ful-1 to obtain the as1-1 ful-1 rpl-1 triple mutant in both ER and er backgrounds. Siliques from these plants exhibited a more moderate mutant phenotype, both in valves and replum, than those of the as1-104 ful-1 double mutant (Fig. 5H,I). This result indicates that RPL participates in the strong phenotype of as1 ful-1 and 35S::BP ful-1 siliques, along with BP and other class I KNOX genes.
| DISCUSSION |
|---|
|
|
|---|
AS function represses BP in the gynoecium
The mechanism involved in patterning the ovary shows interesting
similarities to events that occur at the shoot apex to pattern the apical
meristem and lateral organs. In the gynoecium, the activities of FIL,
YAB3 and JAG promote valve and valve margin development, while
RPL represses the expression of these genes in the replum, ensuring
the formation of this tissue (Dinneny et
al., 2005
). In the shoot apex, the antagonistic activities of
meristematic genes and lateral organ-expressed genes allow meristem
maintenance, restricting organogenesis to the organ primordium. Thus,
RPL is expressed in the meristem, where its product binds most class
I KNOX proteins (STM, BP and KNAT6) to regulate developmental processes
(Byrne et al., 2003
;
Smith and Hake, 2003
;
Bhatt et al., 2004
), whereas
FIL, YAB3 and JAG are exclusively transcribed in lateral
organs. Interestingly, several class I KNOX genes are expressed in the replum
(this work) (Long et al.,
1996
; Pautot et al.,
2001
), a tissue that seems to have meristematic properties,
because it gives rise to the placenta, where ovules are produced. All this
suggests that the replum displays some kind of meristematic attributes
(Roeder and Yanofsky, 2006
),
while the valves are more related to leaf blades.
The AS genes are expressed in leaf primordia, where they repress
BP, KNAT2 and KNAT6
(Byrne et al., 2000
;
Ori et al., 2000
;
Semiarti et al., 2001
), but
not the related STM gene, which, in turn, negatively regulates
AS1 and AS2, so that neither of these genes is transcribed
in the meristem (Byrne et al.,
2002
). Similarly, in the gynoecium, AS1 is expressed in
valves, where it also represses BP, which is transcribed only in the
replum and valve margin. Thus, as1 alleles cause ectopic expression
of BP in valves, giving rise to an abnormal fruit phenotype.
Accordingly, plants carrying the 35S::BP transgene display this same
phenotype, in such a way that overexpression of the BP gene alone
could account for the As1- fruit phenotype. Nevertheless, removal
of BP function in the as1 background does not completely
rescue the mutant phenotype, suggesting that other class I KNOX genes may also
be misexpressed in as1 pistils. Mutations in AS2 produce the
same fruit phenotype as as1 alleles, suggesting that this gene
interacts with AS1 in the pistil to repress class I KNOX genes, as it
does in leaves (Byrne at al.,
2002
; Xu et al.,
2003
). Moreover, AS1 is also expressed in the replum,
although at lower levels, and this seems to be necessary to restrain
BP transcripts below certain levels, as the intensity of GUS staining
in the replum of plants carrying KNAT1::GUS-1 clearly increases in an
as1 background. Although the overlapping expression of AS1
and BP in the replum may appear contradictory with previous studies
carried out in leaves (Byrne at al.,
2000
; Ori et al.,
2000
), the activities of these two genes are not necessarily
exclusive, as both are expressed in the leaves of several mutants
(Kumaran et al., 2002
;
Hay et al., 2006
).
Do class I KNOX genes confer replum identity?
Along the mediolateral axis, RPL is the only gene that has so far
been shown to play a role in replum differentiation. However, several multiple
mutant backgrounds lacking RPL function, such as as1 rpl, shp1
shp2 rpl, jag rpl and fil rpl, develop basically normal repla
(this work) (Roeder et al.,
2003
; Dinneny et al.,
2005
), indicating that this gene is not indispensable for replum
formation. Therefore, there must be other gene function(s) involved in the
elaboration of the basal pattern for replum identity.
Although there are no conclusive data, several lines of argument support
the idea that class I KNOX genes might play this role. First, these genes are
transcribed in the replum, but not in valves. This is the case for
STM (Long et al.,
1996
), KNAT2 (Pautot
et al., 2001
) and BP (this work). Second, the
overexpression of BP, both in as1 mutants and
35S::BP plants, increases the size of the replum, whereas the valve
territory appears slightly reduced, suggesting that BP promotes
replum development and has an opposing role in valve formation. Third,
BP activates the expression of RPL, a gene that plays a
crucial role in the replum. This function of BP may be redundantly
carried out by other class I KNOX genes, as the expression of RPL is
not affected in a bp mutant background
(Smith and Hake, 2003
). And
fourth, BP interacts with RPL in the replum, as the bp-9
rpl-2 double mutant shows a stronger replumless phenotype than
rpl-2.
Despite this putative function of BP in replum development, no
mutant phenotype in this tissue has been found to be caused by a null
bp allele. A likely reason for this behavior is the known functional
redundancy among class I KNOX genes (Byrne
at al., 2002
). Thus, BP function in the replum of
bp mutants could be assumed by STM, as their products share
high homology (Byrne at al.,
2002
), or by KNAT6, which acts redundantly with
STM in the shoot apical meristem
(Belles-Boix et al., 2006
).
Regrettably, the redundancy among the members of this gene family precludes a
functional analysis with loss-of-function mutations, since this strategy
should require the isolation of multiple mutant lines lacking a shoot apical
meristem.
|
We now add AS and class I KNOX genes to the model
(Fig. 6). AS1 is
expressed at high levels in valves and at lower levels in the replum, thus
preventing the expression of class I KNOX genes in valves while maintaining
the products of these genes below certain levels in the replum. This function
(AS function in Fig.
6) would be brought about in collaboration with AS2, as
as2 alleles produce the same fruit phenotype as as1
mutations. We propose that the territories of valve and replum become
established by the opposing activities of valve factors
(FIL/JAG activity) and replum factors (class I KNOX genes),
while the valve margin forms in a narrow stripe in which both valve and replum
factors are expressed. Valve factors should be working through a gradient,
with the strongest activity in the middle of the valve, coinciding with the
lateral plane of the ovary, in strong agreement with the role of the
FIL/JAG activity in inducing, by means of a
concentration-dependent mechanism, the expression of FUL and
SHP genes in adjacent domains, valve and valve margin, respectively
(Dinneny et al., 2005
). In
addition, we hypothesize that class I KNOX genes would be expressed at the
highest level in the replum, while low levels of FIL and YAB3 proteins should
exert a partial downregulation on this family of genes in the valve margin,
because this repression is known to occur in leaves
(Kumaran et al., 2002
). This
model is a variation of the basic French flag model for pattern formation
(Wolpert, 1969
), whereby three
territories would be determined by the contribution of the opposing gradients
of two antagonistic factors.
According to our model, in as1 and 35S::BP fruits, class
I KNOX genes become overexpressed in the replum region and are ectopically
transcribed in valves, where they antagonize the FIL/JAG
activity, resulting in a shift in the position of the valve margin along the
mediolateral axis. Moreover, lack of outer replum in 35S::FUL fruits
(Ferrándiz et al.,
2000a
), the synergistic relationship between as1 and
ful alleles (this work), and the reduction of the mutant phenotype in
the triple as1 ful rpl with respect to the as1 ful double
mutant (this work) suggest that FUL has an inhibitory role on
RPL, and perhaps on class I KNOX genes as well. The model also
accounts for previous results. For instance, fil mutants show a large
replum, yet FIL is not expressed in this domain
(Dinneny et al., 2005
). A
possible explanation is that a fall in FIL/JAG activity
would produce an expansion of the expression of the counteracting replum
genes, causing a shift in valve margin position. In 35S::FUL fruits,
the ectopic expression of FUL would inhibit replum gene function,
allowing FIL/JAG activity to exert its role throughout the
ovary.
This work provides further information on the connection between leaf and
carpel development, through the establishment of the possible functions of
BP and AS1 in fruit patterning. The pleiotropic behavior of
these two genes is founded in their expression in several organs, the
different morphologies of which could be explained by changes in the
regulation of the genes, by different responses of their target genes and/or
by the participation of other interacting genes. This same argument may be
extended to the different contribution of one gene in two species. A recent
work has demonstrated that a rice ortholog of RPL participates in
seed shattering and that a punctual mutation in its regulatory sequence is
involved in loss of seed shattering and domestication of this cereal
(Konishi et al., 2006
). Thus,
although the dehiscence zone in the Arabidopsis fruit and the
abscission layer at the base of the rice grain are structures that do not
share the same botanical origin, both require RPL function for their
formation. Understanding the contribution of specific genes in the formation
of different structures will help to unravel the evolutionary relationships
both between organs and between species.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/14/2663/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Division of Biological Sciences, University of California
San Diego, La Jolla, CA 92093, USA ![]()
Present address: Unidad de Reproducción Asistida, Clínica
Vistahermosa, Avda. de Denia 103, 03015-Alicante, Spain ![]()
| REFERENCES |
|---|
|
|
|---|
Balanzá, V., Navarrete, M., Trigueros, M. and
Ferrándiz, C. (2006). Patterning the female side of
Arabidopsis: the importance of hormones. J. Exp.
Bot. 57,3457
-3469.
Belles-Boix, E., Hamant, O., Witiak, S. M., Morin, H., Tras, J.
and Pautot, V. (2006). KNAT6: An
Arabidopsis homeobox gene involved in meristem activity and organ
separation. Plant Cell
18,1900
-1907.
Bhatt, A. M., Etchells, J. P., Canales, C., Lagodienko, A. and Dickinson, H. (2004). VAAMANA-a BEL1-like homeodomain protein, interacts with KNOX proteins BP and STM and regulates inflorescence stem growth in Arabidopsis. Gene 328,103 -111.[CrossRef][Medline]
Bowman, J. L., Smyth, D. R. and Meyerowitz, E. M. (1991). Genetic interactions among floral homeotic genes of Arabidopsis. Development 112, 1-20.[Abstract]
Bowman, J. L., Baum, S. F., Eshed, Y., Putterill, J. and Alvarez, J. (1999). Molecular genetics of gynoecium development in Arabidopsis. Curr. Top. Dev. Biol. 45,155 -205.[Medline]
Byrne, M. E., Barley, R., Curtis, M., Arroyo, J. M., Dunham, M., Hudson, A. and Martienssen, R. A. (2000). ASYMMETRIC LEAVES1 mediates leaf patterning and stem cell function in Arabidopsis. Nature 408,967 -971.[CrossRef][Medline]
Byrne, M. E., Simorowsky, J. and Martienssen, R. A. (2002). ASYMMETRIC LEAVES1 reveals knox gene redundancy in Arabidopsis. Development 129,1957 -1965.[Medline]
Byrne, M. E., Groover, A. T., Fontana, J. R. and Martienssen, R.
A. (2003). Phyllotactic pattern and stem cell fate are
determined by the Arabidopsis homeobox gene BELLRINGER.Development 130,3941
-3950.
Chen, Q., Atkinson, A., Otsuga, D., Christensen, T., Reynolds, L. and Drews, G. N. (1999). The Arabidopsis FILAMENTOUS FLOWER gene is required for flower formation. Development 126,2715 -2726.[Abstract]
Chuck, G., Lincoln, C. and Hake, S. (1996). KNAT1 induces lobed leaves with ectopic meristems when overexpressed in Arabidopsis. Plant Cell 8,1277 -1289.[Abstract]
Coen, E. (2001). Goethe and the ABC model of flower development. C. R. Acad. Sci. III Sci. Vie 324,523 -530.
Dinneny, J. R. and Yanofsky, M. F. (2005). Drawing lines and borders: how the dehiscent fruit of Arabidopsis is patterned. BioEssays 27,42 -49.[CrossRef][Medline]
Dinneny, J. R., Yadegari, R., Fischer, R. L., Yanofsky, M. F.
and Weigel, D. (2004). The role of JAGGED in shaping
lateral organs. Development
131,1101
-1110.
Dinneny, J. R., Weigel, D. and Yanofsky, M. F.
(2005). A genetic framework for fruit patterning in
Arabidopsis thaliana. Development
132,4687
-4696.
Dockx, J., Quaedvlieg, N., Keultjes, G., Kock, P., Weisbeek, P. and Smeekens, S. (1995). The homeobox gene ATK1 of Arabidopsis thaliana is expressed in the shoot apex of the seedling and in flowers and inflorescence stems of mature plants. Plant Mol. Biol. 28,723 -737.[CrossRef][Medline]
Ferrándiz, C. (2002). Regulation of
fruit dehiscence in Arabidopsis. J. Exp. Bot.
53,2031
-2038.
Ferrándiz, C., Pelaz, S. and Yanofsky, M. F. (1999). Control of carpel and fruit development in Arabidopsis. Annu. Rev. Biochem. 68,321 -354.[CrossRef][Medline]
Ferrándiz, C., Liljegren, S. J. and Yanofsky, M. F.
(2000a). Negative regulation of the SHATTERPROOF genes
by FRUITFULL during Arabidopsis fruit development.
Science 289,436
-438.
Ferrándiz, C., Gu, Q., Martienssen, R. and Yanofsky, M. F. (2000b). Redundant regulation of meristem identity and plant architecture by FRUITFULL, APETALA1 and CAULIFLOWER.Development 127,725 -734.[Abstract]
Friedman, W. E., Moore, R. C. and Purugganan, M. D.
(2004). The evolution of plant development. Am. J.
Bot. 91,1726
-1741.
Frigerio, M., Alabadí, D., Pérez-Gómez, J.,
García-Cárcel, L., Phillips, A. L., Hedden, P. and
Blázquez, M. A. (2006). Transcriptional regulation of
gibberellin metabolism genes by auxin signaling in Arabidopsis.Plant Physiol. 142,553
-563.
Gu, Q., Ferrándiz, C., Yanofsky, M. F. and Martienssen, R. (1998). The FRUITFULL MADS-box gene mediates cell differentiation during Arabidopsis fruit development. Development 125,1509 -1517.[Abstract]
Hay, A., Barkoulas, M. and Tsiantis, M. (2006).
ASYMMETRIC LEAVES1 and auxin activities converge to repress
BREVIPEDICELLUS expression and promote leaf development in
Arabidopsis. Development
133,3955
-3961.
Honma, T. and Goto, K. (2001). Complexes of MADS-box proteins are sufficient to convert leaves into floral organs. Nature 409,525 -529.[CrossRef][Medline]
Iwakawa, H., Ueno, Y., Semiarti, E., Onouchi, H., Kojima, S.,
Tsukaya, H., Hasebe, M., Soma, T., Ikezaki, M., Machida, C. et al.
(2002). The ASYMMETRIC LEAVES2 gene of Arabidopsis
thaliana, required for formation of a symmetric flat leaf lamina, encodes
a member of a novel family of proteins characterized by cysteine repeats and a
leucine zipper. Plant Cell Physiol.
43,467
-478.
Konishi, S., Izawa, T., Lin, S. Y., Ebana, K., Fukuta, Y.,
Sasaki, T. and Yano, M. (2006). An SNP caused loss of seed
shattering during rice domestication. Science
312,1392
-1396.
Koornneef, M., van Eden, J., Hanhart, C. J., Stam, P., Braaksma,
F. J. and Feenstra, W. J. (1983). Linkage map of
Arabidopsis thaliana. J. Hered.
74,265
-272.
Kumaran, M. K., Bowman, J. L. and Sundaresan, V.
(2002). YABBY polarity genes mediate the repression of
KNOX homeobox genes in Arabidopsis. Plant
Cell 14,2761
-2770.
Liljegren, S. J., Ditta, G. S., Eshed, Y., Savidge, B., Bowman, J. L. and Yanofsky, M. F. (2000). SHATERPROOF MADS-box genes control seed dispersal in Arabidopsis.Nature 404,766 -770.[CrossRef][Medline]
Liljegren, S. J., Roeder, A. H., Kempin, S. A., Gremski, K., Ostergaard, L., Guimil, S., Reyes, D. K. and Yanofsky, M. F. (2004). Control of fruit patterning in Arabidopsis by INDEHISCENT. Cell 116,843 -853.[CrossRef][Medline]
Lincoln, C., Long, J., Yamaguchi, J., Serikawa, K. and Hake,
S. (1994). A knotted1-like homeobox gene in
Arabidopsis is expressed in the vegetative meristem and dramatically
alters leaf morphology when overexpressed in transgenic plants.
Plant Cell 6,1859
-1876.
Long, J. A., Moan, E. I., Medford, J. I. and Barton, M. K. (1996). A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis.Nature 379,66 -69.[CrossRef][Medline]
Ohno, C. K., Reddy, G. V., Heisler, M. G. and Meyerowitz, E.
M. (2004). The Arabidopsis JAGGED gene encodes a
zinc finger protein that promotes leaf tissue development.
Development 131,1111
-1122.
Ori, N., Eshed, Y., Chuck, G., Bowman, J. L. and Hake, S. (2000). Mechanisms that control knox gene expression in the Arabidopsis shoot. Development 127,5523 -5532.[Abstract]
Pautot, V., Dockx, J., Hamant, O., Kronenberger, J., Grandjean,
O., Jublot, D. and Traas, J. (2001). KNAT2: evidence
for a link between knotted-like genes and carpel development. Plant
Cell 13,1719
-1734.
Pelaz, S., Tapia-Lopez, R., Alvarez-Buylla, E. R. and Yanofsky, M. F. (2001). Conversion of leaves into petals in Arabidopsis. Curr. Biol. 11,182 -184.[CrossRef][Medline]
Rajani, S. and Sundaresan, V. (2001). The Arabidopsis myc/bHLH gene ALCATRAZ enables cell separation in fruit dehiscence. Curr. Biol. 11,1914 -1922.[CrossRef][Medline]
Redei, G. P. (1965). Non-mendelian
megagametogenesis in Arabidopsis. Genetics
51,857
-872.
Ripoll, J. J., Ferrándiz, C., Martínez-Laborda, A. and Vera, A. (2006). PEPPER, a novel K-homology domain gene, regulates vegetative and gynoecium development in Arabidopsis. Dev. Biol. 289,346 -359.[CrossRef][Medline]
Roeder, A. H. and Yanofsky, M. F. (2006). Fruit development in Arabidopsis. In The Arabidopsis Book (ed. C. R. Somerville and E. M. Meyerowitz). Rockville, MD: American Society of Plant Biologists. doi: 10.1199/tab.0075, www.aspb.org/publications/arabidopsis/.
Roeder, A. H., Ferrándiz, C. and Yanofsky, M. F. (2003). The role of the REPLUMLESS homeodomain protein in patterning the Arabidopsis fruit. Curr. Biol. 13,1630 -1635.[CrossRef][Medline]
Savidge, B., Rounsley, S. D. and Yanofsky, M. F. (1995). Temporal relationship between the transcription of two Arabidopsis MADS box genes and the floral organ identity genes. Plant Cell 7,721 -733.[Abstract]
Sawa, S., Ito, T., Shimura, Y. and Okada, K.
(1999a). FILAMENTOUS FLOWER controls the formation and
development of Arabidopsis inflorescences and floral meristems.
Plant Cell 11,69
-86.
Sawa, S., Watanabe, K., Goto, K., Liu, Y. G., Shibata, D.,
Kanaya, E., Morita, E. H. and Okada, K. (1999b).
FILAMENTOUS FLOWER, a meristem and organ identity gene of
Arabidopsis, encodes a protein with a zinc finger and HMG-related
domains. Genes Dev. 13,1079
-1088.
Semiarti, E., Ueno, Y., Tsukaya, H., Iwakawa, H., Machida, C. and Machida, Y. (2001). The ASYMMETRIC LEAVES2 gene of Arabidopsis thaliana regulates formation of a symmetric lamina, establishment of venation and repression of meristem-related homeobox genes in leaves. Development 128,1771 -1783.[Abstract]
Sessions, R. A. and Zambryski, P. C. (1995). Arabidopsis gynoecium structure in the wild and in ettin mutants. Development 121,1519 -1532.[Abstract]
Shuai, B., Reynaga-Peña, C. G. and Springer, P. S.
(2002). The LATERAL ORGAN BOUNDARIES gene defines a
novel, plant specific gene family. Plant Physiol.
129,747
-761.
Siegfried, K. R., Eshed, Y., Baum, S. F., Otsuga, D., Drews, G. N. and Bowman, J. L. (1999). Members of the YABBY gene family specify abaxial cell fate in Arabidopsis. Development 126,4117 -4128.[Abstract]
Smith, H. M. and Hake, S. (2003). The
interaction of two homeobox genes, BREVIPEDICELLUS and
PENNYWISE, regulates internode patterning in the Arabidopsis
inflorescence. Plant Cell
15,1717
-1727.
Sun, Y., Zhou, Q., Zhang, W., Fu, Y. and Huang, H. (2002). ASYMMETRIC LEAVES1, an Arabidopsis gene that is involved in the control of cell differentiation in leaves. Planta 214,694 -702.[CrossRef][Medline]
Venglat, S. P., Dumonceaux, T., Rozwadowski, K., Parnell, L.,
Babic, V., Keller, W., Martienssen, R., Selvaraj, G. and Datla, R.
(2002). The homeobox gene BREVIPEDICELLUS is a key
regulator of inflorescence architecture in Arabidopsis. Proc. Natl.
Acad. Sci. USA 99,4730
-4735.
Wolpert, L. (1969). Positional information and the spatial pattern of cellular differentiation. J. Theor. Biol. 25,1 -47.[CrossRef][Medline]
Xu, L., Xu, Y., Dong, A., Sun, Y., Pi, L., Xu, Y. and Huang,
H. (2003). Novel as1 and as2 defects in
leaf adaxial-abaxial polarity reveal the requirement for ASYMMETRIC
LEAVES1 and 2 and ERECTA functions in specifying leaf
adaxial identity. Development
130,4097
-4107.
This article has been cited by other articles:
![]() |
T. Girin, K. Sorefan, and L. Ostergaard Meristematic sculpting in fruit development J. Exp. Bot., April 1, 2009; 60(5): 1493 - 1502. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Tadiello, A. Pavanello, D. Zanin, E. Caporali, L. Colombo, G. L. Rotino, L. Trainotti, and G. Casadoro A PLENA-like gene of peach is involved in carpel formation and subsequent transformation into a fleshy fruit J. Exp. Bot., February 1, 2009; 60(2): 651 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
Compiled by, F. Tooke, T. Chiurugwi, and N. Battey Flowering Newsletter bibliography for 2007 J. Exp. Bot., July 18, 2008; (2008) ern109v1. [Full Text] [PDF] |
||||
![]() |
L. Ragni, E. Belles-Boix, M. Gunl, and V. Pautot Interaction of KNAT6 and KNAT2 with BREVIPEDICELLUS and PENNYWISE in Arabidopsis Inflorescences PLANT CELL, April 1, 2008; 20(4): 888 - 900. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||