DEV02864 Supplementary Material

Files in this Data Supplement:

• Supplemental Table S1 -

  Adobe PDF

• Supplemental Figure S1 -

  Fig. S1. Nucleotide and protein sequences of the AS1 coding region. The conserved MYB sequence is underlined. The as1-1 allele is a frame-shift mutation generated by the deletion of G at position 691 (indicated by #) (Sun et al., 2002). The as1-104 allele is a G-to-A transition at position 242 that creates a premature stop codon.

• Supplemental Figure S2 -

  Fig. S2. Expression of AS1 and BP in the gynoecium. (A,B) In situ detection of the AS1 transcript in a stage-9 pistil of Col (A), and a control section of the same pistil hybridized with a sense probe (B). (C,D) In situ detection of the AS1 transcript in a stage-15 fruit of Col (C), and a control section of the same fruit hybridized with a sense probe (D). (E) GUS staining in a stage-11 gynoecium of the KNAT1::GUS-18 line. Staining is not yet detected in the style. For in situ hybridization, a 404 bp fragment from AS1 was amplified by PCR using the primers AS1-5 (TTCTCGAGAGTTTCGCTGAG) and AS1-6 (TTCCTCCAACTCTCTACAACAC) and cloned into the pGEM-T vector (Promega). Two micrograms of SalI-linearized plasmid were used to generate a DIG-labeled antisense riboprobe. A sense DIG-labeled riboprobe was generated after digestion with ApaI. Scale bars: 200 μm in C-E; 100 μm in A,B.

• Supplemental Figure S3 -

  Fig. S3. Expression analysis of RPL in No-0 and 35S::BP plants. qRT-PCR was performed using whole rosettes or leaves, showing a moderate increase of RPL transcript levels in 35S::BP plants. Bars indicate expression levels of RPL, which were normalized with transcripts of the standard EF1-α. The values for wild-type No-0 plants were arbitrarily set to 1.0. Lines on top of the bars indicate standard deviations.

• Supplemental Figure S4 -

  Fig. S4. Effect of mutations in BP and KNAT2 on the fruit phenotype. (A,B,D,F,H) Cross-sections and (C,E,G) bright-field stereomicroscope images of stage-17 fruits. The fruits from bp-1 (A), knat2 (B) and bp-1 knat2 (C,D) show a wild-type phenotype. The knat2 allele does not affect the As1⁻ fruit phenotype (E,F). The as1-1 bp-1 knat2 triple mutant shows the same fruit phenotype as seen in the as1-1 bp-1 double mutant (G,H). The genetic background is ER, with the exception of A in which bp-1 is in an er background. Arrowheads indicate the positions of valve margins. Scale bars: 100 μm in A,B,D,F,H; 500 μm in C,E,G.

• Supplemental Figure S5 -

  Fig. S5. Strong interactions of ful-1 with mutations in AS genes and with 35S::BP. (A,B,C) Bright-field steromicroscope images and (D,E,F) SEMs of stage-17 fruits. The phenotype caused by ful-1 is enhanced in fruits from as1-1 ful-1 (A,D), 35S::BP ful-1 (B,E) and as2-1 ful-1 (C,F) plants. All fruits are in an ER background. Scale bars: 1 mm in A-C; 0.5 mm in D-E.