|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 4 July 2007
doi: 10.1242/dev.003194
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

1 Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge
CB2 1QP, UK.
2 Division of Cancer and Haematology, The Walter and Eliza Hall Institute of
Medical Research, 1G Royal Parade, Parkville, Victoria 3050, Australia.
3 Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH,
UK.
Author for correspondence (e-mail:
cjw53{at}cam.ac.uk)
Accepted 30 May 2007
| SUMMARY |
|---|
|
|
|---|
; also known as Ifng) and Tnf
are
downregulated concomitantly with the upregulation of the Th2 cytokines IL-4,
IL-13 and IL-5 (Il5) as epithelial cells commit to the luminal lineage.
Moreover, we show that Th2 cytokines play a crucial role in mammary gland
development in vivo, because differentiation and alveolar morphogenesis are
reduced in both Stat6 and IL-4/IL-13 doubly deficient mice during pregnancy.
This unexpected discovery demonstrates a role for immune cell cytokines in
epithelial cell fate and function, and adds an unexpected tier of complexity
to the previously held paradigm that steroid and peptide hormones are the
primary regulators of mammary gland development.
Key words: Th2 cells, Cytokines, Mammary gland, Signalling, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Elegant experiments using various transgenic mouse models have identified
factors involved in the regulation of Th2 development (reviewed in
Ansel et al., 2006
;
Farrar et al., 2002
;
Murphy and Reiner, 2002
).
Ablation of IL-4 (Kuhn et al.,
1991
), Stat6 (Kaplan et al.,
1996
; Shimoda et al.,
1996
; Takeda et al.,
1996
) or IL-13 (McKenzie et
al., 1998
) expression leads to perturbed Th2 cell development and
reduced type-2 immunity in mice. It is now clear that Th2 cells activate Stat6
in response to IL-4/IL-13, which, in turn, activates the transcription factor
Gata3 (Zheng and Flavell,
1997
). Gata3 has been shown to be essential for Th2 development
because it is required for chromatin remodelling at the IL-4 locus, which
facilitates transcription of the IL-4, IL-13 and IL-5
(Il5) genes (Takemoto et al.,
1998
). This can occur even in the absence of Stat6
(Ouyang et al., 2000
). There
are other factors that have been identified as regulators of Th2 development,
such as c-Maf (Maf) and NFAT1 (also known as Nfatc2). c-Maf is a transcription
factor that is expressed predominantly in Th2 cells and induces the
transcription of IL-4 (Ho et al.,
1998
). On the other hand, NFAT1 has been shown to be a negative
regulator of Th2 development, because ablation of its expression leads to
marked Th2 development (Xanthoudakis et
al., 1996
). The regulation of Th1/Th2 differentiation is
complicated further by the involvement of the suppresser of cytokine
signalling (SOCS) family of proteins. SOCS proteins are cytokine-inducible Src
homology 2 (SH2)-domain-containing proteins that negatively regulate cytokine
signalling (Alexander and Hilton,
2004
). Socs1 and Socs3 have been implicated in negatively
regulating the Th1 cytokines IFN-
and IL-12, respectively
(Egwuagu et al., 2002
;
Fujimoto et al., 2002
;
Marine et al., 1999
;
Seki et al., 2003
).
Conversely, Socs5 has been shown to be expressed in Th1 cells, where it
interacts with the IL-4R
chain and thereby attenuates IL-4 signalling,
thus negatively regulating Th2 differentiation
(Seki et al., 2002
).
Mammary epithelial cells undergo a massive expansion in number during
pregnancy. The current paradigm in mammary gland biology is that proliferation
and differentiation of these epithelial cells is primarily under the control
of estrogen (E), progesterone (P) and prolactin (Prl)
(Hennighausen and Robinson,
2001
; Rosen,
2004
). Progenitor cells differentiate into either luminal or
myoepithelial cells; milk is produced by the luminal cells and expelled into
ducts by contraction of the myoepithelial cells. The factors that control
commitment to these lineages have not been well defined.
Our previous microarray data indicated that Stat6 was abundantly expressed
in mammary glands during development
(Clarkson et al., 2004
). Thus,
we sought to address whether the Stat6 signalling pathway is involved in
mammary gland development in addition to the roles of Stat5
(Liu et al., 1997
) and Stat3
(Chapman et al., 1999
) in
different mammary developmental processes. Therefore, we characterized the
cytokines, receptors and transcription factors that are involved in the Stat6
signalling pathway in both mammary gland in vivo and in mammary epithelial
cells (MECs) in culture. Examination of mammary gland development in
Stat6-/- and
IL-4-/-/IL-13-/- animals revealed a role for
the Stat6 signalling pathway in branching morphogenesis, because development
during gestation was found to be delayed. Conversely, deletion of Socs5, a
negative regulator of Stat6, resulted in accelerated development. Furthermore,
analysis of MECs in culture revealed a switch from Th1 to Th2 cytokine
production coincident with the induction of differentiation to the luminal
lineage.
| MATERIALS AND METHODS |
|---|
|
|
|---|
KIM-2 cells (Gordon et al.,
2000
) were grown to confluency in 1:1 DMEM:F12 (Invitrogen) media
containing 10% FCS (Sigma), 0.8 mM Insulin (Sigma), 0.8 mM EGF (Sigma) and 17
mM Linoleic acid (Sigma). For differentiation induction, cells were grown to
confluency and then differentiation media was added comprising 1:1 DMEM:F12,
10% FCS, 0.8 mM Insulin, 0.2 mM Prolactin (Sigma), 1 mM Dexamethasone (Sigma)
and 17 mM Linoleic acid. Zero time-points were collected 24 hours post media
change prior to the start of cytokine treatment. IL-4 and IL-13 (R&D) were
used at the indicated concentrations (Fig.
6). EpH4 cells were grown in 1:1 DMEM:F12 supplemented with 10%
FCS.
RNA extraction and PCR primers
Mammary tissue was snap frozen in liquid nitrogen and ground to a fine
powder using a mortar and pestle. Tissue (100 mg) was dissolved in 1 ml of
Tri-reagent (Sigma). RNA extraction was performed using an RNeasy mini kit
(Qiagen) according to the manufacturer's instructions. The RNA quantity and
integrity was determined using a NanoDrop ND-1000 (NanoDrop Technologies).
cDNA was synthesized by random hexanucleotide-primed reverse transcription
from 2 µg of total RNA using the Transcriptor reverse transcription cDNA
synthesis kit (Roche). Semi-quantitative detection of Il4ra, Il13ra1,
Gata3, Gapdh and cyclophillin A (CypA, Ppia) was performed by
PCR using Taq polymerase (Qiagen). The following primers were used (all
primers are shown 5'-3'): Il4ra Fwd,
TGGGCTGTCGATTTTGCTTTTGG, Rev, GTGCTGGGGTGGGAATCTGGTC;
Il13r
1 Fwd, GGCCATC CTGCAAAATAGTG, Rev,
ACAGCGTCGGCAAGAACA; Gata3 Fwd, TGGGTGGGGCCTCATCCTCAG, Rev,
ACCGGGTCCCCATTAGCGTTCCT; Gapdh Fwd, CGGCAAATTCAACGGCACAGTCAA, Rev,
CTTTCCAGAGGGGCCATCCACAG; and Cyclophillin A Fwd, CCTTGGGCCGCGTCTCCTT,
Rev, CACCCTGGCACATGAATCCTG. Quantitative real-time detection of cDNA was
performed using iCycler supermix (BioRad) with the addition of fluorescein
(BioRad) and SYBR-green (Sigma) according to the supplier's recommendations.
The real-time PCR reactions were run in an iCycler (BioRad) in triplicate.
Sequences of the following primers used for real-time PCR were obtained using
the PrimerBank (Wang and Seed,
2003
) website
(http://pga.mgh.harvard.edu/primerbank/):
Il4 Fwd, GGTCTCAACCCCCAGCTAGT, Rev, GCCGATGATCTCTCTCAAGTGAT;
Il13 Fwd, CCTGGCTCTTGCTTGCCTT, Rev, GGTCTTGTGTGATGTTGCTCA;
Il5 Fwd, CTCTGTTGACAAGCAATGAGACG, Rev, TCTTCAGTATGTCTAGCCCCTG;
Il12a Fwd, CTGTGCCTTGGTAGCATCTATG, Rev, GCAGAGTCTCGCCATTATGATTC;
Ifng Fwd, ATGAACGCTACACACTGCATC, Rev, CCATCCTTTTGCCAGTTCCTC;
Tnfa Fwd, CCCTCACACTCAGATCATCTTCT, Rev, GCTACGACGTGGGCTACAG;
Gata3 Fwd, CTCGGCCATTCGTACATGGAA, Rev: GGATACCTCTGCACCGTAGC. All
primers were purchased from Sigma-Aldrich. Analysis was performed using
iCycler iQ Real-Time Detection System Software (BioRad). All real-time PCR
products were sequenced and specificity was confirmed using BLAST.
Whole mounts and H&E staining
For whole-mount analysis, abdominal glands (no. 4) were spread out using
forceps on a glass slide and incubated in Carnoy's fixative (6 parts 100 %
ethanol, 3 parts chloroform and 1 part glacial acetic acid) overnight. The
slide was washed in water and placed in carmine alum stain (1 g Carmine, 2.5 g
aluminum potassium sulphate and 500 ml of dH2O) overnight. The
slide was washed with ethanol and cleared in xylene for 1 day before
documentation. For histological analysis, abdominal glands were fixed in 4%
formaldehyde in PBS for 24 hours at room temperature. The glands were
transferred to 70% ethanol and stored at -20°C until embedding and
sectioning. All tissues were embedded in wax and sectioned at 5 µm before
being stained with haematoxylin and Eosin (H&E).
Immunoblotting
Lymph node-free abdominal mammary glands and cells were extracted with a
lysis buffer containing 50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% sodium
deoxycholate, 150 mM NaCl, 1 mM EDTA, 1x Cocktail protease inhibitors
(Roche), 1 mM Na3VO4, and 1 mM NaF. Protein
concentration was determined with the BCA colorimetric assay (Pierce) and
samples were separated on criterion gels (BioRad). Immunoblotting and antibody
detection using enhanced chemiluminescence (ECL, GE Healthcare) were performed
as described previously (Abell et al.,
2005
). The following antibodies from Cell Signaling Technology
were used: rabbit anti-pAkt (Akt is also known as Akt1)/PKB (Ser 473), rabbit
anti-total Akt/PKB and mouse anti-pERK1/2. Other commercial antibodies used
were mouse anti-ERK1/2 (Transduction Laboratories), mouse anti-pStat6 (Y641)
(Abcam) rat anti-tubulin (Abcam) and goat anti-IL-4r
(R&D systems).
Antibodies purchased from SCBT were: rabbit anti-Stat6 (M-20), rabbit
anti-Gata3 and rabbit anti-c-Maf. Secondary HRP-conjugated antibodies were
from Dako Cytomation. ß-casein antibody was a kind gift from Bert Binas
(Texas A & M University, Texas, TX).
Immunohistochemistry
Paraffin-embedded mammary sections were de-paraffinized and antigen
retrieval was performed using boiling 10 mM Tri-sodium citrate buffer, pH 6.0,
for 10 minutes. Sections were blocked in 10% normal goat serum (normal rabbit
serum in the case of IL-4r
) (Dako) for 1 hour at room temperature.
Sections were either incubated with primary antibody at 1:100 for
phosphorylated Stat6 (pStat6); at 1:50 for Gata3, c-Maf and IL-4R
or
with isotype control overnight at 4°C and detected using Cy3-conjugated
secondary antibodies (Sigma) and bisbenzimide-Hoechst 33342 (Sigma). For
intracellular KIM-2 cytokine staining, cells were grown on chamber slides
(NUNC) and treated with Brefeldin-A 10 µg/ml (Sigma) for 4 hours prior to
fixing in 1:1 acetone:methanol. Slides were blocked in 10% normal goat serum
and stained with antibodies against IL-4 (1:50; R&D) or IL-13 (1:50;
R&D).
Microscopy and statistical analysis
Fluorescence microscopy was carried out using a Zeiss Axiovert S100TV
microscope equipped with a Hamamatsu C4742-95 ORCA1 digital camera, with
images visualized and manipulated using AQM 6 Advanced Kinetic Acquisition
Manager software (Kinetic Imaging). The DAB IHC and H&E stains were
visualized on a LEICA light microscopy. The mouse mammary gland whole mounts
were visualised using the LEICA MZ75 light microscope. Quantification of
images and immunoblots was performed using National Institutes of Health (NIH)
ImageJ software. Statistical analysis was performed using the Sigma Stat 3.5
software package (Sysstat Software).
Cytokine array
Medium (1 ml) from cultures of KIM-2 cells at day 0 and day 8 of
differentiation was analysed using a Cytokine array I (RayBio) following the
manufacturer's protocol. Chemiluminescence was detected using ECL-hyperfilm
(GE Healthcare).
Microarray
cDNA from Stat6-/- mice was compared to wild-type cDNA
via competitive hybridization to the arrays. A mouse exonic evidence based
oligonucleotide (MEEBO) array was used (Pathology Department, Centre for
Microarray Resources, Cambridge, UK). Each experiment was repeated with a dye
swap for technical replicate (repeat hybridizations on separate slides using
independent labelling of the same starting RNA preparations) and with three
biological replicates. Total RNA from wild-type and
Stat6-/- glands at day 5 of gestation was isolated using
TRI reagent (Sigma) and cleaned using RNeasy columns (Qiagen), in accordance
with to the manufacturer's protocols. cDNA target preparation was amplified
and labelled as described by Petalidis and co-workers
(Petalidis et al., 2003
),
except that 5 µl of MgCl2 was added to the second-strand
amplification reaction mix. A constant number of 14 cycles was used. For the
labelling step, 2 µl of Cy3-dCTP or Cy5-dCTP was used with 22 µl of
second-strand cDNA. The labelled products were purified using G50 columns,
according to the manufacturer's instructions (Amersham Biosciences UK).
Labelled samples were combined and hybridized for 16 hours at 50°C with 4
µl of Cot-1 DNA, 1 µl PolyA (8 µg/µl) and 1 µl yeast tRNA (4
µg/µl). Arrays were scanned using an Axon 4100A (Axon Instruments) and
signal quantification was performed using Blue Fuse 3.2 (BlueGnome). Analysis
was performed using FSPMA (Sykacek et al.,
2005
).
|
| RESULTS |
|---|
|
|
|---|
and Gata3 increased from day 10 of
gestation, whereas c-Maf was increased later, from day 15 of gestation. To
determine which cells express these factors, immunohistochemistry for
phosphorylated Stat6 (pStat6), Gata3, c-Maf and IL-4R
was carried out
on sections of mammary tissue (Fig.
1B-I). This study revealed that pStat6 was expressed in a minority
of virgin ductal epithelial cells, whereas, by day 5 of gestation, most
ductal/luminal cells exhibited nuclear pStat6
(Fig. 1B,C). Interestingly,
IL-4R
expression was localised to the apical surface of luminal cells
during gestation only (Fig.
1D,E), whereas the transcription factors Gata3 and c-Maf were
localised in the nuclei of epithelial cells
(Fig. 1F-I).
Stat6-deficient mammary glands exhibit delayed development
We hypothesized, based on the above data, that Stat6 would be important for
normal mammary gland development. Mice deficient for Stat6
(Kaplan et al., 1996
) were
mated and mammary tissue harvested at various time points. Whole-mount and
histological analysis of mammary glands collected from 5-week-old virgin
Stat6-/- mice displayed no apparent abnormality compared
to wild-type mice (see Fig. S2 in the supplementary material). However,
analysis of the gestational time points showed a striking reduction in the
number of side branches and alveolar buds in the absence of Stat6 at day 5
compared with strain-matched wild-type controls
(Fig. 2A). At days 10 and 15 of
gestation, development progressed but was delayed, and the density of the
lobuloalveolar structures was diminished
(Fig. 2B,C). This was clearly
demonstrated in the haematoxylin and Eosin (H&E)-stained sections where
the number of alveoli was approximately 70, 50 and 30% less at days 5, 10 and
15, respectively (Fig. 2D). The
reduced number of epithelial cells suggests a defect in proliferation, and
this was confirmed by immunostaining for Ki67, a marker of proliferation.
Fig. 2E shows that the number
of Ki67 positively staining cells was reduced by approximately 50% in the
Stat6-deficient glands at day 5 of gestation. Interestingly, this reduction in
proliferation was reversed by day 15 of gestation, suggesting a compensatory
mechanism for the absence of Stat6. This `catch-up' proliferation would
account for the more subtle phenotype observed at the late gestation time
points and the ability of Stat6-/- dams to nurse their
pups.
|
was detected at lower levels in Stat6-deficient mice
at days 5, 10 and 15 of gestation, whereas this difference was less striking
during lactation. However, the protein levels of Gata3, another Stat6 target,
were found to be comparable between the Stat6-/- and
control tissue.
|
Global expression profiling of mammary tissue from day 5 of gestation
Stat6-/- and wild-type glands was carried out. Changes in
selected transcripts are shown in Fig.
3C. In addition to caseins
and ß, which were six- to
eight-fold reduced in the Stat6-/- glands, cyclins B1 and
B2 and the proliferation indicator Ki67 are reduced by approximately 2-fold.
Cyclin B1 and B2 are known to be expressed in dividing cells during M phase
and are responsible for the induction of mitosis
(Doree and Hunt, 2002
).
Interestingly, aquaporins 4, 5 and 11 were all expressed at higher levels in
the Stat6-/- glands compared with wild type. These water
transporters are known to be expressed in the ductal epithelium of virgin
mice; however, during pregnancy, expression of these proteins is no longer
detectable (Shillingford et al.,
2003
). Therefore, these microarray data provide further evidence
for a delay in proliferation and differentiation in the absence of Stat6.
IL-4/IL-13 doubly deficient mammary glands exhibit delayed development
Stat6 is activated by a number of cytokines - particularly IL-4 and IL-13,
which are also downstream targets of Stat6. However, the expression profiles
of these Th2 cytokines in mammary glands are not well defined. We determined,
therefore, expression levels of three Th2 cytokines - IL-4, IL-13 and IL-5 -
at gestational time points by quantitative reverse transcriptase (QRT)-PCR. At
day 5 of gestation, all three cytokines were reduced by between approximately
90 (Il13), 60 (Il5) and 50% (Il4) in the
Stat6-/- samples compared with control mice
(Fig. 4A). By contrast, the Th1
cytokine IL-12a was expressed at elevated levels in the
Stat6-/- samples compared with control mice
(Fig. 4A). By day 15, cytokine
levels were no longer diminished in Stat6-/- tissue and,
in fact, Il4 was detected at higher levels compared with control mice
(Fig. 4A). This reflects
compensatory signalling in the absence of Stat6, which could be attributed to
Gata3 because this protein is still expressed in Stat6-deficient mammary
glands. IL-4 continued to be expressed throughout lactation (see Fig. S4 in
the supplementary material).
|
|
Socs5-/- mice exhibit accelerated mammary gland development
To confirm the notion that Stat6 signalling has a role in mammary gland
development further, we investigated a model with enhanced IL-4/IL-13
signalling. Socs5 has been shown to inhibit IL-4/IL-13 signalling by binding
to IL-4R
and it is primarily expressed in Th1 cells
(Seki et al., 2002
). However,
in Socs5-/- mice, there is no effect on B and T cell
development, suggesting that Socs5 is superfluous in these cell types
(Brender et al., 2004
).
Interestingly, we found that Socs5-/- mice have
accelerated mammary gland development compared with controls
(Fig. 5A), with increased
numbers of lobuloalveolar structures (Fig.
5B). This suggests that enhanced IL-4/IL-13 signalling in the
mammary epithelium of Socs5-/- mice results in precocious
development, further supporting a role for Stat6 signalling in the regulation
of mammary gland development. Taken together, these results suggest that IL-4
and IL-13 regulate Stat6 and are required for normal development of the
mammary gland.
|
Stat6 signalling in MECs
To further study and confirm the Stat6 signalling observed in vivo, we
studied the mouse mammary epithelial cell line KIM-2, which accurately mimics
mammary gland development (Gordon et al.,
2000
). KIM-2 cells undergo a programme of differentiation over 10
days that is analogous to MECs in vivo
(Gordon et al., 2000
). Fig.
S5A in the supplementary material shows the cuboidal epithelial morphology of
confluent KIM-2 cells and the domes formed in response to lactogenic
hormone-induced differentiation of these cells. RT-PCR analysis showed that
the IL-4/IL-13 receptor components, IL-4R
and IL-13R
1, are
expressed in undifferentiated KIM-2 cells and the expression of IL-4R
is slightly increased after 2 days differentiation (see Fig. S5B in the
supplementary material). In addition, the transcription factors Gata3 and
c-Maf were detected at constant levels in KIM-2 cells throughout
differentiation (see Fig. S5C in the supplementary material).
|
are expressed at low levels in untreated cells and are induced
further in response to IL-13. Gata3 expression was significantly induced after
30 minutes of treatment, whereas IL-4R
expression was significantly
higher in the treated cells after 4 hours and was elevated by 7.5-fold by 24
hours. It is noteworthy that even in the absence of recombinant IL-13,
expression of Gata3 and IL-4R
was induced, suggesting that KIM-2 cells
secrete IL-13 or IL-4 into the medium. In addition, immunoblot analysis showed
that Stat6 became tyrosine phosphorylated in the absence of exogenous ligand
(Fig. 6D). Therefore, we
treated KIM-2 cells with Brefeldin A for 2 hours to block cytokine secretion
and then stained the cells using anti-IL-4 or anti-IL-13 antibodies.
Importantly, we found significant levels of IL-4 and IL-13 in the cytoplasm of
KIM-2 cells (Fig. 6E-G),
confirming that KIM-2 cells synthesize these cytokines. It is worth noting
that HC11 cells have previously been shown to produce ß-casein in
response to IL-4 treatment (Moriggl et
al., 1997
Differentiation of KIM-2 cells induces a switch from Th1 to Th2 cytokine synthesis
We then investigated the expression profile of cytokines in KIM-2 cells
during differentiation to the luminal (milk-producing) lineage
(Gordon et al., 2000
). We
found a striking switch from Th1 to Th2 cytokine expression that coincided
with the induction of differentiation (Fig.
7A). Thus, the Th1 cytokines IL-12a and Tnf
are
significantly downregulated at day 2 of differentiation, when the milk protein
ß-casein is first expressed, and levels decline as differentiation
progresses. By contrast, levels of INF
(also known as Ifng - Mouse
Genome Informatics), another Th1 cytokine, do not decrease until day 8, when
the cells are fully differentiated (Gordon
et al., 2000
). Strikingly, the Th2 cytokines IL-4, IL-13 and IL-5
were immediately upregulated. It is noteworthy that the expression of IL-4 and
IL-13 continued to increase during the differentiation time course, whereas
IL-5 peaked at day 2 of differentiation
(Fig. 7A). To confirm that
these cytokines are not only synthesized by mammary epithelial cells but are
also secreted, a cytokine array was used with media harvested from
undifferentiated (Fig. 7B, left
panel) or 8-day differentiated (Fig.
7B, right panel) KIM-2 cells. This assay showed that IL-4 is
secreted at higher levels by day-8 differentiated cells than in
undifferentiated cells, as are some other Th2 cytokines - IL-2, IL- 3, IL-5,
IL-9 and IL-10. IL-13 secretion did not appear to change. This is most
probably a consequence of the rapid turnover of this cytokine. Notably,
secretion of granulocyte-colony stimulating factor (GCSF) and IL-6 was
diminished upon differentiation.
|
| DISCUSSION |
|---|
|
|
|---|
, IL-12 and Tnf
is suppressed upon lactogenic
hormone-induced differentiation of MECs, whereas expression of the Th2
cytokines IL-4, IL-13 and IL-5 is induced. These data suggest that
differentiation of the luminal epithelial lineage requires autocrine
signalling by Th2 cytokines (Fig.
8).
This was confirmed by investigating the involvement of Th2 signalling in
MECs in vivo. Mammary glands from Stat6-/- mice displayed
up to a 70% reduction in side branching and delayed alveolar development
during gestation, which was accompanied by reduced proliferation and reduced
milk protein production. A similar phenotype was also observed in mammary
glands from IL-4-/-/IL-13-/- doubly deficient
mice. Deletion of a negative regulator of IL-4/IL-13 would be anticipated to
result in accelerated development, and the loss of Socs5 does indeed result in
precocious alveolar development. This phenotype is similar to that observed in
Socs1/IFN
doubly deficient mice
(Lindeman et al., 2001
). Taken
together, these results further support our contention that Th2-biased
cytokine signalling is required for normal mammary gland development.
Compensatory mechanisms: insights from the Th2 system
Despite the marked developmental delay in the absence of Stat6 signalling,
lactation occurred normally in both Stat6-/- (see Fig. S6
in the supplementary material) and
IL-4-/-/IL-13-/- (data not shown) mice,
suggesting that there is a compensatory mechanism that promotes functional
differentiation. This scenario is similar to that observed in Th2 cells from
Stat6-deficient mice, in which the Th2 cells have been shown to autoregulate
Gata3 (Ouyang et al., 2000
).
It is also worth noting that Gata3 has been shown to be regulated by the Notch
pathway in an IL-4/Stat6-independent manner
(Amsen et al., 2004
). Taken
together, these results suggest that even low levels of Gata3 are sufficient
to mediate Th2 differentiation.
We suggest that Gata3 is an important regulator of mammary gland
development and that, in the absence of Stat6 signalling, Gata3 is sufficient
to ultimately promote alveologenesis. While this work was under review, it was
shown that Gata3 is required to maintain the differentiation of luminal
epithelial cells (Asselin-Labat et al.,
2007
; Kouros-Mehr et al.,
2006
). These authors did not address the mechanism by which Gata3
is regulated in the mammary gland. Our results suggest that, similarly to Th2
cells, Stat6 signalling is required for amplification of the IL-4/IL-13 signal
and for the expansion of luminal mammary epithelial cells
(Fig. 8).
Implications for cancer progression
Immune surveillance is an important factor in preventing tumour growth. It
has been shown that a Th1 bias is more effective in tumour rejection
(Czarneski et al., 2001
;
Jensen et al., 2003
) and that
many established tumours secrete Th2 cytokines. Significantly, estrogen
receptor-positive breast tumours of a luminal subtype have been shown to
express high levels of Gata3 (Usary et
al., 2004
). Although it is generally accepted that pregnancy is
protective against breast cancer and reduces life-time risk
(Medina, 2004
), it is also
known that a recent full-term pregnancy transiently increases the risk of
developing breast cancer (Schedin,
2006
). Our results provide an explanation for this apparent
anomaly, because a Th2 bias during pregnancy and continued cytokine expression
during lactation could hinder immune surveillance and hence promote tumour
growth.
We have uncovered a novel role for Stat6 signalling in regulating differentiation of the adult mammary gland. This unexpected association between adaptive immunity and milk production suggests that, during evolution, the mammary gland hijacked an exquisitely controlled cytokine network to ensure functional differentiation. Our study reveals an additional layer of complexity to the previously held paradigm that steroid and peptide hormones are the primary regulators of mammary gland development.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/15/2739/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Abell, K., Bilancio, A., Clarkson, R. W., Tiffen, P. G.,
Altaparmakov, A. I., Burdon, T. G., Asano, T., Vanhaesebroeck, B. and Watson,
C. J. (2005). Stat3-induced apoptosis requires a molecular
switch in PI(3)K subunit composition. Nat. Cell Biol.
7, 392-398.[CrossRef][Medline]
Alexander, W. S. and Hilton, D. J. (2004). The
role of suppressors of cytokine signaling (SOCS) proteins in regulation of the
immune response. Annu. Rev. Immunol.
22,503
-529.[CrossRef][Medline]
Amsen, D., Blander, J. M., Lee, G. R., Tanigaki, K., Honjo, T.
and Flavell, R. A. (2004). Instruction of distinct CD4 T
helper cell fates by different notch ligands on antigen-presenting cells.
Cell 117,515
-526.[CrossRef][Medline]
Anderson, M. S. and Bluestone, J. A. (2005).
The NOD mouse: a model of immune dysregulation. Annu. Rev.
Immunol. 23,447
-485.[CrossRef][Medline]
Ansel, K. M., Djuretic, I., Tanasa, B. and Rao, A.
(2006). Regulation of Th2 differentiation and Il4 locus
accessibility. Annu. Rev. Immunol.
24,607
-656.[CrossRef][Medline]
Asselin-Labat, M. L., Sutherland, K. D., Barker, H., Thomas, R.,
Shackleton, M., Forrest, N. C., Hartley, L., Robb, L., Grosveld, F. G., van
der Wees, J. et al. (2007). Gata-3 is an essential regulator
of mammary-gland morphogenesis and luminal-cell differentiation.
Nat. Cell Biol. 9,201
-209.[CrossRef][Medline]
Brender, C., Columbus, R., Metcalf, D., Handman, E., Starr, R.,
Huntington, N., Tarlinton, D., Odum, N., Nicholson, S. E., Nicola, N. A. et
al. (2004). SOCS5 is expressed in primary B and T lymphoid
cells but is dispensable for lymphocyte production and function.
Mol. Cell. Biol. 24,6094
-6103.
Chapman, R. S., Lourenco, P. C., Tonner, E., Flint, D. J.,
Selbert, S., Takeda, K., Akira, S., Clarke, A. R. and Watson, C. J.
(1999). Suppression of epithelial apoptosis and delayed mammary
gland involution in mice with a conditional knockout of Stat3.
Genes Dev. 13,2604
-2616.
Chatila, T. A. (2004). Interleukin-4 receptor
signaling pathways in asthma pathogenesis. Trends Mol.
Med. 10,493
-499.[CrossRef][Medline]
Clarkson, R. W., Wayland, M. T., Lee, J., Freeman, T. and
Watson, C. J. (2004). Gene expression profiling of mammary
gland development reveals putative roles for death receptors and immune
mediators in post-lactational regression. Breast Cancer
Res. 6,R92
-R109.[CrossRef][Medline]
Czarneski, J., Meyers, J., Peng, T., Abraham, V., Mick, R. and
Ross, S. R. (2001). Interleukin-4 up-regulates mouse mammary
tumor virus expression yet is not required for in vivo virus spread.
J. Virol. 75,11886
-11890.
Doree, M. and Hunt, T. (2002). From Cdc2 to
Cdk1: when did the cell cycle kinase join its cyclin partner? J.
Cell Sci. 115,2461
-2464.
Egwuagu, C. E., Yu, C. R., Zhang, M., Mahdi, R. M., Kim, S. J.
and Gery, I. (2002). Suppressors of cytokine signaling
proteins are differentially expressed in Th1 and Th2 cells: implications for
Th cell lineage commitment and maintenance. J.
Immunol. 168,3181
-3187.
Farrar, J. D., Asnagli, H. and Murphy, K. M.
(2002). T helper subset development: roles of instruction,
selection, and transcription. J. Clin. Invest.
109,431
-435.[CrossRef][Medline]
Fujimoto, M., Tsutsui, H., Yumikura-Futatsugi, S., Ueda, H.,
Xingshou, O., Abe, T., Kawase, I., Nakanishi, K., Kishimoto, T. and Naka,
T. (2002). A regulatory role for suppressor of cytokine
signaling-1 in T(h) polarization in vivo. Int.
Immunol. 14,1343
-1350.
Gordon, K. E., Binas, B., Chapman, R. S., Kurian, K. M.,
Clarkson, R. W., Clark, A. J., Lane, E. B. and Watson, C. J.
(2000). A novel cell culture model for studying differentiation
and apoptosis in the mouse mammary gland. Breast Cancer
Res. 2,222
-235.[CrossRef][Medline]
Gupta, P. B., Proia, D., Cingoz, O., Weremowicz, J., Naber, S.
P., Weinberg, R. A. and Kuperwasser, C. (2007). Systemic
stromal effects of estrogen promote the growth of estrogen receptor-negative
cancers. Cancer Res. 67,2062
-2071.
Hennighausen, L. and Robinson, G. W. (2001).
Signaling pathways in mammary gland development. Dev.
Cell 1,467
-475.[CrossRef][Medline]
Ho, I. C., Lo, D. and Glimcher, L. H. (1998).
c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation
by both interleukin 4-dependent and -independent mechanisms. J.
Exp. Med. 188,1859
-1866.
Jacobson, N. G., Szabo, S. J., Weber-Nordt, R. M., Zhong, Z.,
Schreiber, R. D., Darnell, J. E., Jr and Murphy, K. M.
(1995). Interleukin 12 signaling in T helper type 1 (Th1) cells
involves tyrosine phosphorylation of signal transducer and activator of
transcription (Stat)3 and Stat4. J. Exp. Med.
181,1755
-1762.
Jensen, S. M., Meijer, S. L., Kurt, R. A., Urba, W. J., Hu, H.
M. and Fox, B. A. (2003). Regression of a mammary
adenocarcinoma in STAT6-/-mice is dependent on the presence of STAT6-reactive
T cells. J. Immunol.
170,2014
-2021.
Kaplan, M. H., Schindler, U., Smiley, S. T. and Grusby, M.
J. (1996). Stat6 is required for mediating responses to IL-4
and for development of Th2 cells. Immunity
4, 313-319.[CrossRef][Medline]
Kouros-Mehr, H., Slorach, E. M., Sternlicht, M. D. and Werb,
Z. (2006). GATA-3 maintains the differentiation of the
luminal cell fate in the mammary gland. Cell
127,1041
-1055.[CrossRef][Medline]
Kuhn, R., Rajewsky, K. and Muller, W. (1991).
Generation and analysis of interleukin-4 deficient mice.
Science 254,707
-710.
Lindeman, G. J., Wittlin, S., Lada, H., Naylor, M. J.,
Santamaria, M., Zhang, J.-G., Starr, R., Hilton, D. J., Alexander, W. S.,
Ormandy, C. J. et al. (2001). SOCS1 deficiency results in
accelerated mammary gland development and rescues lactation in prolactin
receptor-deficient mice. Genes Dev.
15,1631
-1636.
Liu, X., Robinson, G., Wagner, K., Garrett, L., Wynshaw-Boris,
A. and Hennighausen, L. (1997). Stat5a is mandatory for adult
mammary gland development and lactogenesis. Genes Dev.
11,179
-186.
Marine, J. C., Topham, D. J., McKay, C., Wang, D., Parganas, E.,
Stravopodis, D., Yoshimura, A. and Ihle, J. N. (1999). SOCS1
deficiency causes a lymphocyte-dependent perinatal lethality.
Cell 98,609
-616.[CrossRef][Medline]
McKenzie, G. J., Emson, C. L., Bell, S. E., Anderson, S.,
Fallon, P., Zurawski, G., Murray, R., Grencis, R. and McKenzie, A. N.
(1998). Impaired development of Th2 cells in IL-13-deficient
mice. Immunity 9,423
-432.[CrossRef][Medline]
McKenzie, G. J., Fallon, P. G., Emson, C. L., Grencis, R. K. and
McKenzie, A. N. (1999). Simultaneous disruption of
interleukin (IL)-4 and IL-13 defines individual roles in T helper cell type
2-mediated responses. J. Exp. Med.
189,1565
-1572.
Medina, D. (2004). Breast cancer: the
protective effect of pregnancy. Clin. Cancer Res.
10,380S
-384S.[CrossRef][Medline]
Moriggl, R., Berchtold, S., Friedrich, K., Standke, G. J.,
Kammer, W., Heim, M., Wissler, M., Stocklin, E., Gouilleux, F. and Groner,
B. (1997). Comparison of the transactivation domains of Stat5
and Stat6 in lymphoid cells and mammary epithelial cells. Mol. Cell
Biol. 17,3663
-3678.[Abstract]
Mosmann, T. R., Cherwinski, H., Bond, M. W., Giedlin, M. A. and
Coffman, R. L. (1986). Two types of murine helper T cell
clone. I. Definition according to profiles of lymphokine activities and
secreted proteins. J. Immunol.
136,2348
-2357.[Abstract]
Moss, R. B., Moll, T., El-Kalay, M., Kohne, C., Soo Hoo, W.,
Encinas, J. and Carlo, D. J. (2004). Th1/Th2 cells in
inflammatory disease states: therapeutic implications. Expert Opin.
Biol. Ther. 4,1887
-1896.[CrossRef][Medline]
Murphy, K. M. and Reiner, S. L. (2002). The
lineage decisions of helper T cells. Nat. Rev.
Immunol. 2,933
-944.[CrossRef][Medline]
Ouyang, W., Lohning, M., Gao, Z., Assenmacher, M., Ranganath,
S., Radbruch, A. and Murphy, K. M. (2000). Stat6-independent
GATA-3 autoactivation directs IL-4-independent Th2 development and commitment.
Immunity 12,27
-37.[CrossRef][Medline]
Petalidis, L., Bhattacharyya, S., Morris, G. A., Collins, V. P.,
Freeman, T. C. and Lyons, P.A. (2003). Global amplification
of mRNA by template-switching PCR: linearity and application to microarray
analysis. Nucleic Acids Res.
31, e142.
Prochazka, M., Gaskins, H. R., Shultz, L. D. and Leiter, E.
H. (1992). The nonobese diabetic scid mouse: model for
spontaneous thymomagenesis associated with immunodeficiency. Proc.
Natl. Acad. Sci. USA 89,3290
-3294.
Rosen, J. M. (2004). Molecular mechanisms
regulating breast development. In Diseases of the
Breast (ed. J. R. Harris), pp. 15-26.
Philadelphia, London: Lippincott Williams & Wilkin.
Schedin, P. (2006). Pregnancy-associated breast
cancer and metastasis. Nat. Rev. Cancer
6, 281-291.[CrossRef][Medline]
Seki, Y., Hayashi, K., Matsumoto, A., Seki, N., Tsukada, J.,
Ransom, J., Naka, T., Kishimoto, T., Yoshimura, A. and Kubo, M.
(2002). Expression of the suppressor of cytokine signaling-5
(SOCS5) negatively regulates IL-4-dependent STAT6 activation and Th2
differentiation. Proc. Natl. Acad. Sci. USA
99,13003
-13008.
Seki, Y., Inoue, H., Nagata, N., Hayashi, K., Fukuyama, S.,
Matsumoto, K., Komine, O., Hamano, S., Himeno, K., Inagaki-Ohara, K. et
al. (2003). SOCS-3 regulates onset and maintenance of
T(H)2-mediated allergic responses. Nat. Med.
9,1047
-1054.[CrossRef][Medline]
Shillingford, J. M., Miyoshi, K., Robinson, G. W., Bierie, B.,
Cao, Y., Karin, M. and Hennighausen, L. (2003). Proteotyping
of mammary tissue from transgenic and gene knockout mice with
immunohistochemical markers: a tool to define developmental lesions.
J. Histochem. Cytochem.
51,555
-565.
Shimoda, K., van Deursen, J., Sangster, M. Y., Sarawar, S. R.,
Carson, R. T., Tripp, R. A., Chu, C., Quelle, F. W., Nosaka, T., Vignali, D.
A. et al. (1996). Lack of IL-4-induced Th2 response and IgE
class switching in mice with disrupted Stat6 gene.
Nature 380,630
-633.[CrossRef][Medline]
Sykacek, P., Furlong, R. A. and Micklem, G.
(2005). A friendly statistics package for microarray analysis.
Bioinformatics 21,4069
-4070.
Takeda, K., Tanaka, T., Shi, W., Matsumoto, M., Minami, M.,
Kashiwamura, S., Nakanishi, K., Yoshida, N., Kishimoto, T. and Akira, S.
(1996). Essential role of Stat6 in IL-4 signalling.
Nature 380,627
-630.[CrossRef][Medline]
Takemoto, N., Koyano-Nakagawa, N., Yokota, T., Arai, N.,
Miyatake, S. and Arai, K. (1998). Th2-specific DNase
I-hypersensitive sites in the murine IL-13 and IL-4 intergenic region.
Int. Immunol. 10,1981
-1985.
Thierfelder, W. E., van Deursen, J. M., Yamamoto, K., Tripp, R.
A., Sarawar, S. R., Carson, R. T., Sangster, M. Y., Vignali, D. A., Doherty,
P. C., Grosveld, G. C. et al. (1996). Requirement for Stat4
in interleukin-12-mediated responses of natural killer and T cells.
Nature 382,171
-174.[CrossRef][Medline]
Usary, J., Llaca, V., Karaca, G., Presswala, S., Karaca, M., He,
X., Langerod, A., Karesen, R., Oh, D. S., Dressler, L. G. et al.
(2004). Mutation of GATA3 in human breast tumors.
Oncogene 23,7669
-7678.[CrossRef][Medline]
Wang, X. and Seed, B. (2003). A PCR primer bank
for quantitative gene expression analysis. Nucleic Acids
Res. 31,e154
.
Xanthoudakis, S., Viola, J. P., Shaw, K. T., Luo, C., Wallace,
J. D., Bozza, P. T., Luk, D. C., Curran, T. and Rao, A.
(1996). An enhanced immune response in mice lacking the
transcription factor NFAT1. Science
272,892
-895.[Abstract]
Zheng, W. and Flavell, R. A. (1997). The
transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene
expression in CD4 T cells. Cell
89,587
-596.[CrossRef][Medline]
Zhu, J., Cote-Sierra, J., Guo, L. and Paul, W. E.
(2003). Stat5 activation plays a critical role in Th2
differentiation. Immunity
19,739
-748.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
C. J. Watson Immune cell regulators in mouse mammary development and involution J Anim Sci, April 1, 2009; 87(13_suppl): 35 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Li, B. J. Ferguson, W. T. Khaled, M. Tevendale, J. Stingl, V. Poli, T. Rich, P. Salomoni, and C. J. Watson PML depletion disrupts normal mammary gland development and skews the composition of the mammary luminal cell progenitor pool PNAS, March 24, 2009; 106(12): 4725 - 4730. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. R. Perez-Lopez, P. Chedraui, and J. Haya Review Article: Vitamin D Acquisition and Breast Cancer Risk Reproductive Sciences, January 1, 2009; 16(1): 7 - 19. [Abstract] [PDF] |
||||
![]() |
C. J. Watson and W. T. Khaled Mammary development in the embryo and adult: a journey of morphogenesis and commitment Development, March 15, 2008; 135(6): 995 - 1003. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||