|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 11 July 2007
doi: 10.1242/dev.006296
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Stanford University, Department of Biological Sciences, Stanford, CA 94305, USA.
Author for correspondence (e-mail:
dbergmann{at}stanford.edu)
Accepted 2 June 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis, Root pattern, Symmetry, Vasculature
| INTRODUCTION |
|---|
|
|
|---|
The RM has a stem-cell population that divides asymmetrically to create
each of the tissue layers. Cells in this population (initial cells) maintain
competence to divide by their proximity to the quiescent center (QC), which is
specified by the coordinate activity of the hormone auxin, as mediated via the
AP2 class transcription factors PLETHORA1 (PLT1) and PLT2
(Aida et al., 2004
), and the
GRAS family transcription factors SCARECROW (SCR) and SHORTROOT (SHR)
(Sabatini et al., 2003
).
Although the SHR protein is a transcription factor, it also serves as a
positional cue by virtue of its regulated movement from the center of the root
to the neighboring cell layers, where it activates SCR
(Nakajima et al., 2001
).
Downstream of these regulators that position the root stem cells, the
Arabidopsis homolog of the Retinoblastoma gene,
RETINOBLASTOMA-RELATED (RBR1), appears to behave similarly
to its animal counterparts in repressing cell divisions within the stem cell
population (Wildwater et al.,
2005
). Although it appears that initial cells for each of the
different tissue types are regulated by this common pathway, very little is
known about the initial cells for central tissues in the root.
These central tissues are collectively referred to as the stele. Clonal
analysis of Arabidopsis embryos has indicated that all of the tissues
of the stele - the pericycle, vascular elements (xylem and phloem) and some
ground tissue - share a common origin
(Dolan et al., 1993
;
Kidner et al., 2000
). When
viewed in cross-section, the tissues in the stele exhibit a stereotyped,
species-specific arrangement. The small Arabidopsis root invariantly
has two xylem poles diametrically opposed (diarch;
Fig. 1A), whereas the roots of
other plants, such as wild-grown radish, can vary from being diarch through to
heptarch (reviewed in Turner and Sieburth,
2002
). Lateral roots are produced by postembryonic divisions in
the pericycle. In the roots of many species, including Arabidopsis,
only the pericycle cells adjacent to the xylem poles are capable of initiating
laterals. This leads to a predictable pattern of root growth somewhat
analogous to the arrangement of organs in the shoot known as phyllotaxis.
Several genes and growth regulators have been implicated in root vascular
development. ALTERED PHLOEM DEVELOPMENT (APL) encodes a MYB
transcription factor required for the production of phloem. In the absence of
APL, crucial proliferative divisions in the vascular cylinder do not
take place and the phloem is not specified
(Bonke et al., 2003
).
WOODEN LEG (WOL, also known as CRE1 or
AHK4) is also required for proliferation of the vascular cylinder.
Plants homozygous for the wol-1 mutation have fewer cells in the
stele and fail to produce phloem (Mahonen
et al., 2000
; Scheres et al.,
1995
). WOL encodes a histidine kinase that functions in
cytokinin response (Inoue et al.,
2001
; Mahonen et al.,
2000
). Further work with this kinase family, as well as classic
physiology experiments, has implicated cytokinins in the control of cell
proliferation and cell fate in both shoot and root vascular development
(de Leon et al., 2004
;
Higuchi et al., 2004
;
Mahonen et al., 2006a
;
Mahonen et al., 2006b
;
Nishimura et al., 2004
).
In this study, we identify a new locus, LONESOME HIGHWAY (LHW), that is required to establish and maintain the normal vascular cell number and pattern in primary and lateral roots. Using a map-based cloning approach, we identified the LHW gene and found that it defines the first member of a clade of plant-specific genes. Further characterization of protein localization and activity suggests that LHW encodes a transcriptional activator, suggesting that LHW plays a regulatory role in establishing a `set point' for the radial extent of the root vascular population.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Phenotypic characterization
Markers of cell fate used were: SCR::GFP (gift of J. Long, SALK, San Diego,
CA), APLproAPL::GFP (Bonke et al.,
2003
), QC25::GUS (gift of B. Scheres, University of Utrecht, The
Netherlands), J0121::GFP (ABRC stock CS9090), Q1630::GFP (ABRC stock CS9227),
VH1::GUS (Clay and Nelson,
2002
), DR5::GUS (Ulmasov et
al., 1997
) and CYCB1;1::GUS
(Colon-Carmona et al., 1999
;
Donnelly et al., 1999
). Unless
otherwise indicated, the wild-type control for experiments with lhw-1
and lhw-2 is the unmutagenized parental line CS9090 (C24 ecotype).
Seedlings were grown vertically on plants containing 0.5xMS, 1% agar.
Expression of GFP markers was analyzed on a Bio-Rad 1024 confocal microscope,
with propidium iodide counterstaining to observe cell morphology. Xylem was
visualized by staining with 0.01% basic fuchsin. Root cross sections were
prepared according to Scheres et al.
(Scheres et al., 1995
). Growth
curves were performed by marking root lengths on the underside of plates every
24 hours during the growth of lhw and control parental plants grown
side-by-side. Auxin analogue 2,4-dichlorophenoxyacetic acid (2,4D) and
cytokinin (kinetin) effects on primary root growth were assayed at 5 days post
germination (dpg). Seedlings grown on plates containing 20 µM
1-N-naphthylphthalamic acid (NPA) were scored at 7 dpg for rescue and at 21
dpg for terminal phenotypes. Images were processed for figures using Adobe
Photoshop consistent with guidelines for image manipulation specified in the
instructions for authors.
Map-based cloning of LHW
All alleles were individually mapped using a standard set of PCR-based
mapping primers (Lukowitz et al.,
2000
). Recombinants between CER459215 and CER460427 were
identified from approximately 800 F2 individuals from a mapping outcross of
lhw-1 to Ler and scored for additional simple sequence
length polymorphism (SSLP) markers, localizing LHW to an 80 kb region
on BAC F12K2. T-DNA insertion alleles for 24/34 of the genes in the region
were screened for root phenotypes and SALK_079402 (At2g27230) exhibited a
single-xylem-pole phenotype. Mutations leading to stop codons in the predicted
open reading frame of At2g27230 were identified in four LHW alleles.
Using numbering derived from AY035151, mutations were found in:
lhw-1, G
A at 575; lhw-2, G
A at 1944;
lhw-3, C
T at 1883; and lhw-4, G
A at 1066.
lhw-1 is predicted to truncate the protein at amino acid 23 and is
probably a null. All phenotypic characterization was carried out with both
lhw-1 and lhw-2, and some tests with SALK_079402, to ensure
that the lhw phenotype was not ecotype dependent. All alleles behaved
similarly, so only results from lhw-1 are reported, except as noted.
Full-length cDNA AY035151 was obtained from RIKEN, Japan. An error in the cDNA
that introduced an additional G at position 918 was corrected by PCR. CaMV35S
expression of this cDNA was capable of rescuing the xylem phenotype of
lhw-1 (Fig. 5B) in the
T1 generation (6/14 independent lines).
Yeast two-hybrid assay and screen
LHW and other clones were PCR amplified from cDNA clones or by
reverse transcriptase (RT)-PCR and cloned into the Clontech Matchmaker vectors
pGBK (bait) and pGAD (prey). Saccharomyces cerevisiae strains AH109
or Y187 were used as hosts. Bait clones were tested for transcriptional
auto-activation by co-transformation with an empty prey vector. Direct
interactions between plasmids were tested by retransformation of plasmids in
pairwise comparisons. A screen of approximately 800,000 colonies was performed
using the LHW bHLH domain and C-terminus (DB-bC) as bait and a prey library in
pACT constructed by Kim and Theologis (ABRC stock CD4-22). Positive clones
were tested to ensure a single plasmid was responsible for the interaction,
sequenced, and then retransformed into a strain containing prey for
confirmation of the interaction. Quantitative analysis of ß-galactosidase
(ß-gal) expression was performed by transforming LHW variants
into the yeast strain Y187 and following procedures in Clontech's yeast
protocol guide.
Expression studies
Total RNA for semi-quantitative RT-PCR was isolated from plant tissues
using a micro-midi RNA isolation kit (Invitrogen). RNA (100 ng) was used in
first-strand synthesis with superscript III (Invitrogen), followed by PCR with
the gene-specific primers (shown 5'-3') lhwrtf1,
GATCGTGTCAAAGAGCTGCG and lhwrtr1, TTCGAAAGCCCATGTTGCTCC, and control primers
actinF, GGCGATGAAGCTCAATCCAAACG and actinR, GGTCACGACCAGCAAGATCAAGACG.
LHW and ACT were amplified for 32 and 25 cycles,
respectively, for 15 seconds at 95°C, 30 seconds at 52°C and 1 minute
at 68°C. A ß-glucuronidase (GUS) reporter for LHW expression
was created by PCR amplifying 2.8 kb of genomic sequence 5' of the
translational start site and cloning the piece into pCAMBIA 1303. Subcellular
localization was determined by cloning the LHW cDNA from the
translational start to one codon before the translational stop into pEZN
(Cutler et al., 2000
).
Constructs were introduced into Arabidopsis plants via
Agrobacterium-mediated transformation
(Clough and Bent, 1998
).
| RESULTS |
|---|
|
|
|---|
Phenotypic analysis of lhw defects
Closer examination of lhw roots revealed that the bilaterally
symmetric (diarch) organization of the stele was reduced to a monarch
arrangement. In wild-type plants, two protoxylem strands ran the length of the
root (Fig. 1E). In
lhw, only one protoxylem strand was observed and, in most cases
(34/40), was displaced from the center of the root. J0121::GFP expression was
always adjacent to the single remaining xylem strand. In mature parts of the
root, 2-5 files of metaxylem elements are normally found between the two
protoxylem poles (Mahonen et al.,
2000
). In lhw plants, cells with the morphological
characteristics of metaxylem were made, and they had the same spatial
relationship to the protoxylem pole, but there appeared to be only half as
many metaxylem cells (Fig. 1F
and Fig. 2). In addition to two
xylem poles, Arabidopsis roots normally have two phloem poles. Phloem
organization can be visualized by APLpro::APL-GFP expression
(Bonke et al., 2003
). In
wild-type root tips, APLpro::APL-GFP was seen in nuclei of two cell files,
corresponding to maturing protophloem (Fig.
1G). In lhw, only a single APLpro::APL-GFP-marked file
was visible (Fig. 1H). Despite
the reduced cell number in the root vasculature, lhw plants were
healthy and fertile. Plants with mutations in LHW did not exhibit
dramatically altered phyllotaxis, nor did they have any gross morphological
abnormalities in their leaf and floral organs
(Fig. 1I,J). lhw
mutations in the C24 background led to plants that were slightly agravitropic,
as seen by the waving of lhw roots as they grew down a slanted agar
surface (Fig. 1K). In
cotyledons, lhw vein development was delayed relative to wild type
(Fig. 1L,M), and xylem gaps
were still visible in the mature organs
(Fig. 1N,O); however, leaf
venation patterns appeared normal (data not shown).
|
|
Because lhw mutants still made some lateral roots, we could
examine the organization of these postembryonically formed organs.
Arabidopsis lateral roots originate from a stereotyped series of
divisions in three pericycle cell files adjacent to a xylem pole. Lateral
roots normally have the same tissue organization as primary roots, although
control over the number of cells in the cortex and endodermis is somewhat
relaxed (Dolan et al., 1993
).
Despite early division patterns that were indistinguishable between wild type
and lhw (see Fig. S1K-P in the supplementary material), lhw
lateral roots generated only a single protoxylem pole (100%, n=40), a
single APLpro::APL-GFP-marked phloem pole (100%, n=20) and a single
J0121::GFP-marked xylem-adjacent pericycle file (97%, n=40),
suggesting that LHW is required to establish normal cell numbers in
the stele of these organs.
|
Germination and growth on media containing the auxin-transport inhibitor
NPA can lead to excessive RM proliferation and xylem production
(Mattsson et al., 1999
).
lhw and wild-type plants grown on MS agar plates containing 20 µM
NPA were sampled at 7 and 21 dpg for xylem vessel formation and for expression
of the J0121::GFP marker in roots. At neither time-point was expression of
J0121::GFP seen in two stripes, nor was the second xylem pole restored in
lhw plants (compare Fig.
3B with Fig. 3A,
and data not shown). Morphology of the root tip was strikingly different
between wild type and lhw at 21 dpg. In wild type, the roots became
extensively fasciated and produced eight to ten xylem files
(Fig. 3D). The lhw
root tips were only slightly wider than untreated roots, failed to undergo
excess cell proliferation and never produced more than a single differentiated
xylem cell file (Fig. 3E).
These data indicate that, although lhw plants appear to perceive
auxin and respond in terms of primary root inhibition and production of root
hairs, they are unable to respond to auxin in the formation of xylem and
pericycle. The simplest explanation for these phenotypes is that LHW
is not a core component of auxin signaling but that lhw mutants are
defective in a downstream process.
|
LHW encodes a member of a novel, plant-specific, family of proteins
LHW appears to play a central role in defining the number of stele cells.
In the root, a variety of biochemical functions have been defined by
mutational analysis to be required for patterning the RM and balancing cell
proliferation and differentiation. These include: core cell cycle regulators,
components of cell signaling and hormone perception pathways, and
transcriptional regulators (e.g. Aida et
al., 2004
; Blilou et al.,
2002
; Blilou et al.,
2005
; Friml et al.,
2002
; Mahonen et al.,
2006a
; Sabatini et al.,
2003
; Wildwater et al.,
2005
). To understand how LHW might control root
development, we used a map-based cloning approach and found that LHW
corresponds to At2g27230, a locus that encodes a protein of 650 amino acids
(see Materials and methods). Initial searches of databases with LHW revealed
that it was a plant-specific protein of unknown function. LHW is closely
related to three other uncharacterized proteins in Arabidopsis
(encoded by At1g06150, At1g64625 and At2g31280) and to two proteins in rice
(encoded by Os12g06330 and Os11g06010). The highest similarities among these
proteins are in an N-terminal and a C-terminal region
(Fig. 4B and see Fig. S4 in the
supplementary material). Although the N-terminal region does not resemble any
domains of known biochemical function, part of the C-terminal domain is weakly
similar to basic helix-loop-helix (bHLH) transcription factors
(Fig. 4B). Alignments of LHW
with typical bHLHs (At1g66470 and At5g37800) revealed that this similarity is
most convincing in the predicted dimerization domain (boxed in
Fig. 4B); however, the
canonical DNA-contacting residues are not conserved in LHW, and LHW was not
considered a bHLH by two independent groups conducting comprehensive analyses
of the family (Heim et al.,
2003
; Toledo-Ortiz et al.,
2003
).
Transcriptional activation and HLH dimerization activity of LHW
Proteins in the bHLH class generally interact with DNA and regulate
transcription as dimers. They can partner with a variety of protein classes,
including a class of proteins [the inhibitor of differentiation (Id) proteins]
that have HLH dimerization domains but that lack a DNA-binding domain and
antagonize bHLH function (Chen et al.,
1996
). We examined whether LHW had any properties consistent with
it acting as a transcriptional regulator and/or interacting with canonical
bHLH proteins.
|
We then performed a two-hybrid screen using a library made from seedling
cDNA (see Materials and methods) to identify other potential partners of LHW.
In a screen of 800,000 colonies, 12 prey constructs interacted with LHW
(DB-bC) under stringent conditions. Nine of the clones corresponded to four
bHLH genes: At5g08130 (five clones); At1g68810 (two clones); At1g29950 (one
clone) and At3g25710 (one clone). This suggests that LHW readily binds to
typical bHLH proteins. The bHLH proteins that were identified in the
two-hybrid screen have not been extensively characterized. However, it is
interesting that, in silico, transcripts for each of these bHLHs are enriched
in root tips or found in xylem cell populations
(Birnbaum et al., 2005
)
(http://bbc.botany.utoronto.ca/efp)
|
To determine the subcellular localization of LHW, roots of Arabidopsis stably transformed with 35Spro::LHW-GFP were examined. GFP expression was visible in nuclei (Fig. 5A,B). Expression of these constructs in lhw-1 mutant plants was sufficient to rescue the xylem pole defect in T1 plants (Fig. 5B), but expression in wild type did not result in any obvious phenotypes in root length, vasculature or overall plant morphology in T1 plants (data not shown). Silencing of the LHW transgene was often observed in T2 lines as a reduction in GFP expression and by the appearance of a single xylem pole in plants with a wild-type genomic copy of LHW (data not shown).
Analysis of the requirement for LHW in root meristem maintenance
Given its identity, activities and expression pattern, we hypothesized that
LHW was required in the meristem to promote cell divisions that establish the
normal size of the stele. Similar roles are played by transcriptional
regulators such as SCR and SHR, which are important for regulating both radial
and longitudinal growth. SCR is normally expressed in the QC, in
endodermal/cortex initials and in the maturing endodermis of the root
(Di Laurenzio et al., 1996
).
Mosaic analysis revealed that SCR has a cell-autonomous role in maintaining
the QC (Heidstra et al., 2004
;
Sabatini et al., 2003
). When
we examined the expression of SCRpro::GFP in 7-dpg lhw, we
found, unexpectedly, that the reporter was present in the endodermis, but not
in the QC (0/40 lhw plants compared with 38/40 wild-type plants;
Fig. 6B versus 6A). In
torpedo-stage lhw embryos, however, SCRpro::GFP was present in QC
cells (Fig. 6C), suggesting
that SCR expression is lost over time.
Loss of SCR expression in the QC is reminiscent of the phenotypes of
hobbit (Blilou et al.,
2002
) and shr
(Helariutta et al., 2000
)
mutants; both HOBBIT and SHR are required for meristem maintenance. The
arrangement of SCRpro::GFP-expressing cells in lhw mutants
was also similar to that in roots provided with only endodermal expression of
SCR (Sabatini et al., 2003
).
Because roots lacking SCR in the QC often have a compromised RM
(Sabatini et al., 2003
), we
examined several other markers of `meristem health' in lhw, including
the expression of QC identity markers, the longitudinal extent of the zone of
proliferation and whether lhw roots exhibited determinate growth.
In wild-type plants, QC25::GUS is expressed specifically in the QC
(Sabatini et al., 2003
). At 7
dpg, lhw mutants expressed QC25::GUS but, interestingly, the
intensity of GUS expression in the QC cells was often asymmetric (14/20
lhw plants versus 0/10 wild type;
Fig. 6H,I). The intensity of
staining did not appear to be correlated with the side on which the protoxylem
formed (data not shown). Despite this asymmetry, at 7 dpg, the lhw RM
appeared to have normal proliferative capacity, as assayed by root growth
(Fig. 6Q) and by the presence
of columella initials. Columella initials are identified as a layer of cells
between the QC and the cells expressing the columella marker Q1630::GFP and
starch granules (Fig. 6D,E and
data not shown). Several groups have used the expression of a mitotic cyclin
(CYCB1;1) to measure the longitudinal extent of the proliferative zone (e.g.
Aida et al., 2004
;
Hutchison et al., 2006
;
Ioio et al., 2007
). At 7 dpg,
the region of CYCB1;1pro::GUS-expressing cells was similar in wild-type and
lhw (Fig. 6F,G; 119
µm±1.6 s.d. in wild type, n=11; 125 µm±1.73 in
lhw-1, n=10). Together, these data suggest that LHW is not
required for the establishment of a functioning RM.
Despite the normal early development, maintenance of the lhw RM failed over time. At 13 days, QC25::GUS was still expressed (Fig. 6J versus 6K), but columella initials began to differentiate and contained starch grains (Fig. 6L, star). At 17 dpg, the meristem of lhw roots was visibly disorganized. In contrast to wild-type roots (Fig. 6M,N), lhw roots exhibited a variety of defects, including a failure to express QC25::GUS (5/10; Fig. 6P), the loss of columella initials (6/10; Fig. 6O) and grossly abnormal QC morphology (4/10; Fig. 6O). The RM abnormalities correlated with decreased growth; beginning at approximately 10 dpg, lhw root growth slowed relative to wild type and, by 19 days, lhw primary roots ceased growing (Fig. 6Q).
| DISCUSSION |
|---|
|
|
|---|
|
If stele cell number is controlled by LHW in parallel with other factors,
then cytokinin is a likely candidate. Cytokinin signaling is required for the
repression of xylem differentiation and for the promotion of stele cell
proliferation (Mahonen et al.,
2006a
; Mahonen et al.,
2006b
). Like cytokinin, LHW is required to promote cell
proliferation in the stele; however, LHW is also required to promote
protoxylem formation - a combination of phenotypes inconsistent with a simple
increase or reduction in cytokinin synthesis or response. In addition,
lhw-1;wol-1 roots have significantly fewer stele cells in the mature
zone than do lhw mutants. The interpretation of this genetic result
is complicated because WOL is one of three cytokinin receptors required for
root vascular development (Higuchi et al.,
2004
; Mahonen et al.,
2006b
). The wol1-1 mutation has been reported to mimic
the loss of all three receptors in root vascular development
(Mahonen et al., 2006a
;
Mahonen et al., 2006b
); if
wol-1 eliminates cytokinin perception, then LHW and
cytokinin are likely to be two of several inputs that promote proliferation of
the stele independently.
We interpret the appearance of a smaller provascular region in the
lhw embryo and young lateral roots as meaning that the primary role
of LHW is to produce the wild-type number of stele initial cells in
the radial direction. However, we also demonstrated that LHW is
required to maintain growth in the longitudinal direction. LHW could have a
direct or indirect role in maintaining the RM. In contrast to other
root-patterning mutants that exhibit a clear `short root' phenotype,
lhw mutant roots were not noticeably shorter than wild type until 10
dpg. Abnormalities in the QC cells, however, preceded this growth defect, and
previous studies have shown that the self-renewing properties of the RM
initials are maintained through interactions with the QC cells
(Aida et al., 2004
;
Sabatini et al., 2003
;
van den Berg et al., 1997
;
Wildwater et al., 2005
). By 5
dpg, lhw roots failed to express SCR in the QC; by 7 dpg,
the majority of lhw roots expressed QC25::GUS asymmetrically and a
small fraction exhibited morphological abnormalities in the QC cells. The
finding that SCR is missing from the QC earlier than other markers could
indicate a specific requirement for LHW to promote the expression of
this gene. Alternatively, LHW might be indirectly required for the RM
via its effects on SHR production. The disappearance of SCR from the
QC is seen in reduction-of-function mutations of SHR
(Sabatini et al., 2003
).
Because LHW acts early to establish the number of cells in the radial
direction of the stele and SHR RNA is produced exclusively in the
stele, the loss of SCR and the gradual slowing of root growth in
lhw mutants might be due to the reduction of the SHR source
(Fig. 6R).
In the future, several lines of inquiry might illuminate whether LHW plays
an indirect or direct role in RM maintenance. For example, when
RETINOBLASTOMA-RELATED function is inactivated specifically in the
meristem (rBRr), a larger RM is created
(Wildwater et al., 2005
). If
rBRr can rescue lhw stele size, pattern and premature termination,
then it is likely that LHW acts through this cell cycle controller to
reach the balance of cells in the stele, and that the effects of lhw
on longitudinal growth are largely indirect. If pattern and size are rescued,
but the meristem terminates, then LHW might have a direct and
independent role in creating and maintaining a functional stem cell pool in
the root.
LHW is the first characterized member of a clade of proteins that represent potential transcriptional regulators in Arabidopsis and in other plants, including rice, a monocot, and poplar, a woody species. Root architecture is significantly different between monocots and dicots; therefore, it would be particularly interesting to see whether LHW orthologs retain a similar role in promoting vascular proliferation, and how this role manifests itself in a structurally diverse root system. Because LHW represents a xylem-promoting factor, its potential for promoting growth in trees might prove valuable for wood and biofuel production.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/16/2959/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Aida, M., Beis, D., Heidstra, R., Willemsen, V., Blilou, I.,
Galinha, C., Nussaume, L., Noh, Y. S., Amasino, R. and Scheres, B.
(2004). The PLETHORA genes mediate patterning of the Arabidopsis
root stem cell niche. Cell
119,109
-120.[CrossRef][Medline]
Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lambert,
G. M., Galbraith, D. W. and Benfey, P. N. (2003). A gene
expression map of the Arabidopsis root. Science
302,1956
-1960.
Birnbaum, K., Jung, J. W., Wang, J. Y., Lambert, G. M., Hirst,
J. A., Galbraith, D. W. and Benfey, P. N. (2005). Cell
type-specific expression profiling in plants via cell sorting of protoplasts
from fluorescent reporter lines. Nat. Methods
2, 615-619.[CrossRef][Medline]
Blilou, I., Frugier, F., Folmer, S., Serralbo, O., Willemsen,
V., Wolkenfelt, H., Eloy, N. B., Ferreira, P. C., Weisbeek, P. and Scheres,
B. (2002). The Arabidopsis HOBBIT gene encodes a CDC27
homolog that links the plant cell cycle to progression of cell
differentiation. Genes Dev.
16,2566
-2575.
Blilou, I., Xu, J., Wildwater, M., Willemsen, V., Paponov, I.,
Friml, J., Heidstra, R., Aida, M., Palme, K. and Scheres, B.
(2005). The PIN auxin efflux facilitator network controls growth
and patterning in Arabidopsis roots. Nature
433, 39-44.[CrossRef][Medline]
Bonke, M., Thitamadee, S., Mahonen, A. P., Hauser, M. T. and
Helariutta, Y. (2003). APL regulates vascular tissue identity
in Arabidopsis. Nature
426,181
-186.[CrossRef][Medline]
Chen, C. M., Kraut, N., Groudine, M. and Weintraub, H.
(1996). I-Mf, a novel myogenic repressor, interacts with members
of the MyoD family. Cell
86,731
-741.[CrossRef][Medline]
Clay, N. K. and Nelson, T. (2002). VH1, a
provascular cell-specific receptor kinase that influences leaf cell patterns
in Arabidopsis. Plant Cell
14,2707
-2722.
Clough, S. J. and Bent, A. F. (1998). Floral
dip: a simplified method for agrobacterium-mediated transformation of
Arabidopsis thaliana. Plant J.
16,735
-743.[CrossRef][Medline]
Colon-Carmona, A., You, R., Haimovitch-Gal, T. and Doerner,
P. (1999). Technical advance: spatio-temporal analysis of
mitotic activity with a labile cyclin-GUS fusion protein. Plant
J. 20,503
-508.[CrossRef][Medline]
Cutler, S. R., Ehrhardt, D. W., Griffitts, J. S. and Somerville,
C. R. (2000). Random GFP::CDNA fusions enable visualization
of subcellular structures in cells of Arabidopsis at a high frequency.
Proc. Natl. Acad. Sci. USA
97,3718
-3723.
de Leon, B. G., Zorrilla, J. M., Rubio, V., Dahiya, P.,
Paz-Ares, J. and Leyva, A. (2004). Interallelic
complementation at the Arabidopsis CRE1 locus uncovers independent pathways
for the proliferation of vascular initials and canonical cytokinin signalling.
Plant J. 38,70
-79.[CrossRef][Medline]
Di Laurenzio, L., Wysocka-Diller, J., Malamy, J. E., Pysh, L.,
Helariutta, Y., Freshour, G., Hahn, M. G., Feldmann, K. A. and Benfey, P.
N. (1996). The SCARECROW gene regulates an asymmetric cell
division that is essential for generating the radial organization of the
Arabidopsis root. Cell
86,423
-433.[CrossRef][Medline]
Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig,
S., Roberts, K. and Scheres, B. (1993). Cellular organisation
of the Arabidopsis thaliana root. Development
119, 71-84.[Abstract]
Donnelly, P. M., Bonetta, D., Tsukaya, H., Dengler, R. E. and
Dengler, N. G. (1999). Cell cycling and cell enlargement in
developing leaves of Arabidopsis. Dev. Biol.
215,407
-419.[CrossRef][Medline]
Ferreira, F. J. and Kieber, J. J. (2005).
Cytokinin signaling. Curr. Opin. Plant Biol.
8, 518-525.[CrossRef][Medline]
Friml, J., Benkova, E., Blilou, I., Wisniewska, J., Hamann, T.,
Ljung, K., Woody, S., Sandberg, G., Scheres, B., Jurgens, G. et al.
(2002). AtPIN4 mediates sink-driven auxin gradients and root
patterning in Arabidopsis. Cell
108,661
-673.[CrossRef][Medline]
Heidstra, R., Welch, D. and Scheres, B. (2004).
Mosaic analyses using marked activation and deletion clones dissect
Arabidopsis SCARECROW action in asymmetric cell division. Genes
Dev. 18,1964
-1969.
Heim, M. A., Jakoby, M., Werber, M., Martin, C., Weisshaar, B.
and Bailey, P. C. (2003). The basic helix-loop-helix
transcription factor family in plants: a genome-wide study of protein
structure and functional diversity. Mol. Biol. Evol.
20,735
-747.
Helariutta, Y., Fukaki, H., Wysocka-Diller, J., Nakajima, K.,
Jung, J., Sena, G., Hauser, M. T. and Benfey, P. N. (2000).
The SHORT-ROOT gene controls radial patterning of the Arabidopsis root through
radial signaling. Cell
101,555
-567.[CrossRef][Medline]
Higuchi, M., Pischke, M. S., Mahonen, A. P., Miyawaki, K.,
Hashimoto, Y., Seki, M., Kobayashi, M., Shinozaki, K., Kato, T., Tabata, S. et
al. (2004). In planta functions of the Arabidopsis cytokinin
receptor family. Proc. Natl. Acad. Sci. USA
101,8821
-8826.
Hutchison, C. E., Li, J., Argueso, C., Gonzalez, M., Lee, E.,
Lewis, M. W., Maxwell, B. B., Perdue, T. D., Schaller, G. E., Alonso, J. M. et
al. (2006). The Arabidopsis histidine phosphotransfer
proteins are redundant positive regulators of cytokinin signaling.
Plant Cell 18,3073
-3087.
Inoue, T., Higuchi, M., Hashimoto, Y., Seki, M., Kobayashi, M.,
Kato, T., Tabata, S., Shinozaki, K. and Kakimoto, T. (2001).
Identification of CRE1 as a cytokinin receptor from Arabidopsis.
Nature 409,1060
-1063.[CrossRef][Medline]
Ioio, R. D., Linhares, F. S., Scacchi, E., Casamitjana-Martinez,
E., Heidstra, R., Costantino, P. and Sabatini, S. (2007).
Cytokinins determine Arabidopsis root-meristem size by controlling cell
differentiation. Curr. Biol.
17,678
-682.[CrossRef][Medline]
Kidner, C., Sundaresan, V., Roberts, K. and Dolan, L.
(2000). Clonal analysis of the Arabidopsis root confirms that
position, not lineage, determines cell fate. Planta
211,191
-199.[CrossRef][Medline]
Laplaze, L., Parizot, B., Baker, A., Ricaud, L., Martiniere, A.,
Auguy, F., Franche, C., Nussaume, L., Bogusz, D. and Haseloff, J.
(2005). GAL4-GFP enhancer trap lines for genetic manipulation of
lateral root development in Arabidopsis thaliana. J. Exp.
Bot. 56,2433
-2442.
Lukowitz, W., Gillmor, C. S. and Scheible, W. R.
(2000). Positional cloning in Arabidopsis. Why it feels good to
have a genome initiative working for you. Plant
Physiol. 123,795
-805.
Mahonen, A. P., Bonke, M., Kauppinen, L., Riikonen, M., Benfey,
P. N. and Helariutta, Y. (2000). A novel two-component hybrid
molecule regulates vascular morphogenesis of the Arabidopsis root.
Genes Dev. 14,2938
-2943.
Mahonen, A. P., Bishopp, A., Higuchi, M., Nieminen, K. M.,
Kinoshita, K., Tormakangas, K., Ikeda, Y., Oka, A., Kakimoto, T. and
Helariutta, Y. (2006a). Cytokinin signaling and its inhibitor
AHP6 regulate cell fate during vascular development.
Science 311,94
-98.
Mahonen, A. P., Higuchi, M., Tormakangas, K., Miyawaki, K.,
Pischke, M. S., Sussman, M. R., Helariutta, Y. and Kakimoto, T.
(2006b). Cytokinins regulate a bidirectional phosphorelay network
in Arabidopsis. Curr. Biol.
16,1116
-1122.[CrossRef][Medline]
Malamy, J. E. and Benfey, P. N. (1997).
Organization and cell differentiation in lateral roots of Arabidopsis
thaliana. Development
124, 33-44.[Abstract]
Mattsson, J., Sung, Z. R. and Berleth, T.
(1999). Responses of plant vascular systems to auxin transport
inhibition. Development
126,2979
-2991.[Abstract]
Nakajima, K., Sena, G., Nawy, T. and Benfey, P. N.
(2001). Intercellular movement of the putative transcription
factor SHR in root patterning. Nature
413,307
-311.[CrossRef][Medline]
Nawy, T., Lee, J. Y., Colinas, J., Wang, J. Y., Thongrod, S. C.,
Malamy, J. E., Birnbaum, K. and Benfey, P. N. (2005).
Transcriptional profile of the Arabidopsis root quiescent center.
Plant Cell 17,1908
-1925.
Nishimura, C., Ohashi, Y., Sato, S., Kato, T., Tabata, S. and
Ueguchi, C. (2004). Histidine kinase homologs that act as
cytokinin receptors possess overlapping functions in the regulation of shoot
and root growth in Arabidopsis. Plant Cell
16,1365
-1377.
Sabatini, S., Heidstra, R., Wildwater, M. and Scheres, B.
(2003). SCARECROW is involved in positioning the stem cell niche
in the Arabidopsis root meristem. Genes Dev.
17,354
-358.
Scheres, B., Di Laurenzio, L., Willemsen, V., Hauser, M. T.,
Janmaat, K., Weisbeek, P. and Benfey, P. N. (1995). Mutations
affecting the radial organisation of the Arabidopsis root display specific
defects throughout the embryonic axis. Development
121, 53-62.[Abstract]
Toledo-Ortiz, G., Huq, E. and Quail, P. H.
(2003). The Arabidopsis basic/helix-Loop-Helix transcription
factor family. Plant Cell
15,1749
-1770.
Torrey, J. G. (1955). On the determination of
vascular patterns during tissue differentiation in excised pea roots.
Am. J. Bot. 42,183
-198.[CrossRef]
Turner, S. and Sieburth, L. E. (2002). Vascular
patterning. In The Arabidopsis Book (ed. C. R.
Somerville and E. M. Meyerowitz). Rockville, MC: American Society of Plant
Biologists. doi. 1199/tab.0073.
Ulmasov, T., Murfett, J., Hagen, G. and Guilfoyle, T. J.
(1997). Aux/IAA proteins repress expression of reporter genes
containing natural and highly active synthetic auxin response elements.
Plant Cell 9,1963
-1971.[Abstract]
van den Berg, C., Willemsen, V., Hendriks, G., Weisbeek, P. and
Scheres, B. (1997). Short-range control of cell
differentiation in the Arabidopsis root meristem.
Nature 390,287
-289.[CrossRef][Medline]
Wildwater, M., Campilho, A., Perez-Perez, J. M., Heidstra, R.,
Blilou, I., Korthout, H., Chatterjee, J., Mariconti, L., Gruissem, W. and
Scheres, B. (2005). The RETINOBLASTOMA-RELATED gene regulates
stem cell maintenance in Arabidopsis roots. Cell
123,1337
-1349.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
B. Parizot, L. Laplaze, L. Ricaud, E. Boucheron-Dubuisson, V. Bayle, M. Bonke, I. De Smet, S. R. Poethig, Y. Helariutta, J. Haseloff, et al. Diarch Symmetry of the Vascular Bundle in Arabidopsis Root Encompasses the Pericycle and Is Reflected in Distich Lateral Root Initiation Plant Physiology, January 1, 2008; 146(1): 140 - 148. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||