|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 July 2007
doi: 10.1242/dev.001818
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Institut National de la Santé et de la Recherche Médicale U506,
Villejuif, F-94807, France.
2 U602, Hôpital Paul Brousse, Villejuif, F-94807, France.
3 Université Paris-Sud, Villejuif, F-94807, France.
4 Sanofi-Synthelabo Recherche, Département Cardiovasculaire Thrombose,
Toulouse, F-31036, France.
5 Children's Hospital of Pittsburgh, Pittsburgh, PA, USA.
* Author for correspondence (e-mail: souyri{at}vjf.inserm.fr)
Accepted 11 June 2007
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: Cytokine receptor, AGM, Fetal liver, HSC, Hematopoiesis, Development
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). The most
stringent experimental procedure to underline the existence of HSCs is to show
their ability to provide long-term multilineage hematopoietic reconstitution
(LTR) when transplanted into a lethally irradiated adult animal
(Morrison et al., 1995), and
to further repopulate secondary lethally conditioned recipient animals. It is
now accepted that the first definitive HSCs endowed with LTR ability are
generated in the AGM (aorta-gonad-mesonephros) region at mid-gestation
[embryonic day (E) 10.5], and localize to the dorsal aorta and the vitelline
and umbilical arteries (Cumano et al.,
1996; Medvinsky and Dzierzak,
1996; Muller et al.,
1994). By E11, LTR-HSCs are found in the yolk sac (YS) and the
fetal liver (FL) rudiment. From E11 onwards, the number of HSCs increases
dramatically in the FL, which is, with the thymus, the major lymphohemopoietic
organ during mouse embryonic development
(Ema and Nakauchi, 2000;
Morrison et al., 1995). This
very rapid increase of the FL HSC pool has raised the question of whether the
HSCs from the AGM alone could account for this expansion. Indeed, it has
recently been shown that E12 YS also contributes to this process
(Kumaravelu et al., 2002), and
that an HSC pool expands in the placenta from E10.5-11 until E12.5-13.5
(Gekas et al., 2005;
Ottersbach and Dzierzak,
2005). Finally, HSCs colonize the thymus, the spleen and the bone
marrow, which is the primary site of adult hematopoiesis.
Among the various factors that contribute to the maintenance of the HSC
compartment, the cytokine signaling pathways are important in promoting HSC
self-renewal, proliferation and differentiation in the adult. Yet little is
known about the role of cytokines in embryonic hematopoiesis. Recent work on
the earliest identified cytokine interleukin 3 (Il3), has shown that although
this cytokine shares functional redundancy with other cytokines for HSC growth
in the adult, it is an important embryonic HSC regulator as a proliferation
and survival factor for the earliest HSCs in the embryo
(Robin et al., 2006). The Mpl
receptor and its ligand, thrombopoietin (TPO; also known as Thpo - Mouse
Genome Informatics), the primary regulator of megakaryopoiesis and platelet
production (Eaton and de Sauvage,
1997; Kaushansky,
1995), have been shown to play an essential role in the early
steps of adult hematopoiesis. Long-term self-renewing stem cell activity
segregates with Mpl expression (Solar et
al., 1998) and, conversely, bone marrow cells from mice lacking
Mpl (Mpl-/- mice) are unable to compete with normal marrow
for long-term hematopoietic repopulation in irradiated mice
(Kimura et al., 1998). High
Mpl expression is found in marrow cell populations enriched for HSCs
(Terskikh et al., 2001;
Terskikh et al., 2003). TPO is
a potent early-acting cytokine that promotes the survival and proliferation of
primitive hematopoietic cells in vitro in synergy with other early-acting
cytokines such as Flt3 ligand and SCF (also known as Kitl - Mouse Genome
Informatics) (Borge et al.,
1997; Luens et al.,
1998; Murray et al.,
1999; Ramsfjell et al.,
1996). TPO has also been shown to be important for the expansion
of HSCs in vivo (Fox et al.,
2002).
Although the role of Mpl/TPO signaling in adult HSCs is well-documented,
little is known about its importance during the establishment of definitive
hematopoiesis in the mouse embryo. Analysis of hematopoiesis during
development in Mpl-/- mice indicated that whereas
production of megakaryocytes was compromised during fetal hematopoiesis, E12
FL contained normal numbers of hematopoietic progenitors (HPs), including
multipotent progenitors and progenitors of blast cell colonies
(Alexander et al., 1996). On
the other hand, comparison of the in vivo hematopoietic reconstituting
activity of AA4.1+ Sca1+ Mpl+ and
AA4.1+ Sca1+ Mpl- cells sorted from E14.5 FL
showed that all the long-term repopulating activity of the AA4.1+
Sca1+ population is confined within the Mpl+ subset
(Solar et al., 1998).
Interestingly, passage of HSCs through the FL seems to be an important step
for HSCs to acquire their definitive potential, and liver also appears to be
the main site of TPO production in fetuses, neonates and adults
(Wolber et al., 1999). In the
mouse, TPO mRNA is detected in the FL as early as E12.5
(Nomura et al., 1997). At this
stage, a high level of Mpl expression is also detected in this organ
(Souyri et al., 1990). Our own
results have shown that in the E12.5 FL, the cytoplasmic domain of Mpl is
active only in immature hematopoietic cells. This result, added to the
observation that the Mpl cytoplasmic domain promotes hematopoietic commitment
of embryonic stem (ES) cells led us to hypothesize that Mpl could be important
in the establishment of definitive hematopoiesis
(Challier et al., 2002). In
order to answer this question, we first investigated the temporal expression
of Mpl by in situ hybridization in the main sites of hematopoiesis
during mouse C57Bl6 development. We next tested the functional relevance of
Mpl expression in vitro and in vivo using Mpl-/- mice: we
compared the colony-forming cell (CFC) content, LTR abilities and HSC content
of control C57Bl6 and Mpl-/- embryos at different times of
development. We show that Mpl is expressed by clusters of emerging HSCs in the
AGM region and as early as E10.5 in the FL. In vivo LTR assays indicated that
Mpl-/- embryos indeed present a delayed production of HSCs
by the AGM region, accompanied by delayed seeding of the liver by HSCs at
E11.5. During FL development, a decrease in HP and HSC potential is observed,
associated with a defect in amplification and self-renewal/survival of the
lin- AA4.1+ Sca1+ population of HSCs. Our
results indicate that Mpl plays a dual role in the establishment of definitive
hematopoiesis: first, in the process of emergence/production of the first HSCs
in the AGM region, and then in the amplification and survival/self-renewal of
HSCs during their passage in the FL.
|
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
Embryo generation and processing
Embryos were produced by natural mating of B6-Ly5.2 or
Mpl-/- mice. Vaginal plugs were checked in the morning,
marking E0.5. Pregnant females were killed by cervical dislocation at
different times of gestation. Uteri were taken and placed in
phosphate-buffered saline (PBS) (Invitrogen). The stages of the embryos were
confirmed by somite counting and/or morphological analysis. Thereafter,
embryos were either dissected further to recover AGM, liver and spleen and
thymus at later stages of development, or embedded in paraffin for in situ
hybridization (ISH).
For ISH, embryos were fixed overnight in 4% paraformaldehyde (PAF) (Sigma) at 4°C, and dehydrated by successive baths in 70, 90 and 100% ethanol (Prolabo, VWR International), and toluene (Carlo Erba). Embryos were then infiltrated with paraffin (Thermo Shandon-Biosciences Technologies) at 56°C and embedded at room temperature until solidification of paraffin. Blocks of paraffin were either directly sliced with a microtome (5 µm sections) or stored at 4°C.
In situ hybridization
A full-length murine Mpl probe cloned in the pSPT18 vector was
used. Sense and antisense 35S-UTP Mpl riboprobes were
produced using the Riboprobe In Vitro Transcription System (Promega),
following the manufacturer's instructions. After hydrolysis and purification
on a G-50 Sephadex column (Amersham Biosciences), RNA probes were precipitated
with ethanol. The RNA pellet was resuspended in 100 µl of 100 mM
dithiothreitol (Invitrogen). An aliquot was counted in a radioactivity counter
(LS 1800, Beckman Coulter).
For ISH, slides were dewaxed in toluene and treated with proteinase K
(Roche Diagnostics) as previously described
(Labastie et al., 1998).
Hybridization of 35S-labeled riboprobes was performed as described
by Labastie et al. (Labastie et al.,
1995). Slides were in contact with NTB2 autoradiographic emulsion
(Kodak) for 5-6 weeks. After development, sections were counterstained with
Gill's Hematoxylin (Sigma), dehydrated and mounted in Entellan medium (Merck)
before observation.
RT-PCR analysis of total cellular RNA
Dissected embryos were lysed with Trizol (Invitrogen) and total RNA was
extracted as recommended by the manufacturer. Reverse transcription was
performed on 1 µg or less of RNA, as previously described
(Challier et al., 2002).
Samples of cDNAs were submitted to 35 cycles of amplification with Taq
polymerase (New England Biolabs). A sample (5 µl) was used with primers
specific for ß-actin (Actb) and 10 µl with primers specific
for the sequence encoding the intracellular region of the Mpl receptor.
Sequences for ß-actin primers have been described
(Cocault et al., 1996). For
Mpl, the 5' primer was
5'-TACAGCTTGCAGCTGCGTGCCAG-3', and the 3' primer was
5'-TGTGTGGTGCAGCAGGACCCCCTC-3'.
Relative quantitative PCR (q-PCR) was performed using the Quanti-Tect SYBR
Green PCR Kit (Qiagen) according to the manufacturer's guidelines with
gene-specific PCR primers on a LightCycler Instrument (Roche). After one step
at 95°C for 15 minutes to activate the HotStarTaq DNA polymerase, the
samples were cycled 40 times (denaturation at 95°C for 15 seconds,
annealing at 60°C for 25 seconds, and extension at 72°C for 15
seconds). Crossing point (Cp) values of the sequences of interest
(Mpl and TPO) were measured using the LightCycler software
(automated calculation was by the second derivative maximum method). Relative
expression was calculated according to the E-
Cp formula.
Data were normalized to Gapdh. The following primer sequences
(5' to 3') were used: Mpl forward primer,
CATCCTTGTAGAGGTGACCACAG; Mpl reverse primer, TCCAGCCTTCCACTTGAGAC;
TPO forward primer, TGTGACCCCAGACTCCTAAATAAA; TPO reverse
primer, GGCAGCAGAACAGGGATAGA; Gapdh forward primer,
ATGGTGAAGGTCGGTGTGAA; Gapdh reverse primer, AATGAAGGGGTCGTTGATGG.
|
Clonogenic assays
Clonogenic assays were performed as previously described
(Gurney et al., 1994).
Briefly, 0.5 embryo-equivalent (ee) AGM or 5x104 FL cells
were plated in 1 ml methylcellulose in IMDM supplemented with 30% FCS, 1%
crystallized BSA (Sigma), and 10-4 M ß-mercaptoethanol
(Sigma), in the presence of 2 U/ml erythropoietin, 10 ng/ml recombinant mouse
Il3 (Promocell) and 20 ng/ml recombinant human TPO (kindly provided by Kirin
Brewery Co., Japan). Samples were plated in duplicate 35-mm Petri dishes and
incubated for 7 days at 37°C.
Assay for long-term culture-initiating cells (CAFCs)
MS5 stromal feeder cells (Itoh et al.,
1989) were seeded at 3x103 cells/100 µl LTC-IC
medium in 96-well flat-bottom microplates (Dutscher). LTC-IC medium consisted
of IMDM supplemented with 12.5% FCS, 12.5% horse serum, 0.5 mg/l ascorbic
acid, 37 mg/l myo-inositol, 10 mg/l folic acid, 5x10-5 M
ß-mercaptoethanol and 10-6 M hydrocortisone hemisuccinate
(Sigma). 24 hours later, serial half-dilutions of test cells in 100 µl
LTC-IC medium were seeded over feeder cells. Cultures were maintained at
37°C with weekly half-medium changes. The input number of cells seeded per
well was plotted against the log percentage of negative wells on day 28 of
culture. The frequency of CAFCs was extrapolated from the linear regression
curves at the log percentage of -0.37.
Analysis of long-term repopulating (LTR) ability
Adult B6-Ly5.1 mice were exposed to a single dose of 9.25 Gy (0.3
Gy/minute) from a 137Cs source (IBL637, CIS Bio International); at
this dose, mice died within 2 weeks. Pooled YS, AGM, blood and FL cells were
co-injected intravenously into the retro-orbital venous plexus with
7x105 normal B6-Ly5.1 spleen cells for short-term
radioprotection. Peripheral blood was collected at different times after
injection and nucleated cells were incubated with fluorescein isothiocyanate
(FITC)-conjugated anti-Ly5.1 and biotinylated anti-Ly5.2, followed by addition
of streptavidin-phycoerythrin (PE) (BD Biosciences-Pharmingen), and analyzed
by flow cytometry (FACSCalibur cytometer, BD Biosciences) for the presence of
donor-derived (Ly5.2+) cells. The percentage of reconstitution was
determined by the following formula: (%Ly5.2/%Ly5.1+%Ly5.2)x100. A
recipient mouse was considered positive when the percentage of reconstitution
was above 5%.
|
At the same time, 5x105 bone marrow cells from Mpl-/- and control C57Bl6 mice with equivalent percentage of Ly5.2 chimerism were injected into new B6-Ly5.1 irradiated mice for secondary reconstitution. Mice were bled between 7 and 16 weeks after injection to determine the percentage of reconstitution.
Statistical analysis
Statistical analysis was performed using the Student's t-test.
P<0.05 was considered significant.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). We therefore started to investigate the temporal
expression of Mpl by RT-PCR in the main sites of intraembryonic
hematopoiesis: the AGM region, FL, spleen and thymus. As shown in
Fig. 1A, strong Mpl
expression was found in the E11.5 FL, which persisted until the neonatal stage
of development (not shown). At this stage, Mpl signal was also found
in the AGM region, but this decreased strongly as early as E12.5
(Fig. 1B). In the spleen and
thymus, Mpl expression was first detected around E15.5, and persisted
until E18.5 (Fig. 1C). We performed in situ hybridization (ISH) to determine the spatial and temporal expression of Mpl during mouse development. For each ISH experiment, one slide was dedicated to hybridization with the sense Mpl riboprobe in order to check the specificity and the level of background. Analysis of serial sections of C57Bl6 embryos at various times of development with a full-length 35S-labeled Mpl antisense riboprobe revealed that, interestingly, a high level of Mpl expression is detected at E10.5-11 in the clusters of hematopoietic cells that emerge from the ventral wall of the aorta within the AGM and represent the first intraembryonic HSCs (Fig. 2A-C). No clear Mpl expression above the background level was observed in the endothelial floor of the aorta. High Mpl expression was detected in the FL as early as E10.5, and persisted throughout development (Fig. 2D-G). The number of Mpl-positive spots in the FL reached a peak at E11.5. Mpl-positive cells were also detected in the lung (where they are likely to correspond to megakaryocytes) and brain (data not shown). Sections of E10.5 and E11.5 YS were also hybridized, and sparse clusters of Mpl-positive cells were seen at these stages (Fig. 2H-J). We did not detect Mpl expression in the E9.5 embryo by ISH. In order to check whether this negative result could be attributed to the detection threshold of ISH, rather than to a true absence of Mpl expression before E10, we used relative q-PCR to test whether Mpl expression could be detected earlier than E10.5. As shown in Fig. 3A, low-level Mpl expression was found in the para-aortic splanchnopleura (PSP) region at E9.5 (this region will develop into aorta, gonads and mesonephros, and is called AGM after E10). With this method, Mpl could also be detected in the whole embryo and in the YS at E8, although at a very low level (Fig. 3A). We also checked TPO expression in the AGM region and FL. As expected, TPO was detected in the FL as early as E10.5 (Fig. 3B). Interestingly, we also found TPO expression in the AGM region at E10.5 (Fig. 3B).
Delayed production of HSCs with an impaired activity in the AGM of Mpl-/- embryos
We tested the functional relevance of Mpl expression in the AGM
clusters of hematopoietic cells using Mpl-/- mice. We
compared the CFC content (which corresponds to the HP content), the LTR
ability and the HSC content of the AGM and liver from control C57Bl6 and
Mpl-/- E11.5 embryos (expressing the Ly5.2 allele of CD45)
(Fig. 4). In order to make this
comparison as rigorous as possible, embryos were staged precisely by counting
somites and only embryos with 38 to 45 somites (E11-11.5) were used in all
experiments. As shown in Fig.
5A, Mpl-/- AGM presented a 1.4-fold defect in
total CFCs (47.4±13.4 total CFCs in Mpl-/- versus
65.6±22.6 in C56Bl6 AGMs), mainly owing to a deficiency in BFU-E and in
mixed colonies containing megakaryocytic progenitors (CFU with MK). At this
stage, no difference in CFC content was observed in the YS or placenta for
Mpl-/- and C57Bl6 embryos (data not shown). A 2-fold
defect in LTR ability was also observed [14% (1 reconstituted mouse for 7
transplanted) and 33% (2 reconstituted mice for 6 transplanted) of
reconstituted mice grafted with 1 and 3 ee Mpl-/- AGM,
respectively, versus 30% and 57% when the mice were grafted with 1 and 3 ee
control C57Bl6 AGM) (Table 1).
However, FACS analysis of the bone marrow, spleen, thymus and blood of
reconstituted recipient mice for coexpression of CD45.2 and specific lineage
markers indicated that HSCs present in the AGM of Mpl-/-
mice were able to colonize all hematopoietic organs and to give rise to all
hematopoietic lineages in adult recipients
(Fig. 6). Solid lymphoid
reconstitution is indicative of the presence of HSCs in
Mpl-/- AGM. Self-renewal being a key property of HSCs,
bone marrow cells from primary recipients were used for secondary
reconstitutions 20 weeks post-transplant. As illustrated in
Table 1, although both
Mpl-/- and C57Bl6 bone marrow cells were able to
reconstitute secondary irradiated mice with the same efficiency, the median of
participation of grafted cells to hematopoietic reconstitution was much lower
with bone marrow issued from Mpl-/- AGM injection than
with bone marrow injected with control AGM (28% versus 63%). This is
indicative of a lower number of HSCs in the AGM of Mpl-/-
mice, and could reflect a delay in the production of these HSCs. In order to
test this hypothesis, we studied the LTR potential of E12.5 AGM. We showed
that it was higher than that of E11.5 for Mpl-/- AGM,
whereas, as described, it decreased for control AGM. In addition, E12.5
Mpl-/- AGM was found to have a better LTR potential than
C57Bl6 AGM (Table 1). Secondary
reconstitutions indicated that the LTR ability detected in the E12.5
Mpl-/- AGM is linked to the presence of HSCs
(Table 1). However, as for
E11.5 Mpl-/- AGM, these secondary transplantations
underscored an HSC defect (median of participation of grafted cells to
hematopoietic reconstitution in mice reconstituted with primary bone marrow of
only 6%) compared with control E12.5 AGM
(Table 1). This indicates that
in addition to their delayed production, HSCs generated by
Mpl-/- AGM present an impaired activity.
|
|
HSC potential decreases during Mpl-/- FL development
We next analyzed the HSC potential of Mpl-/- FL. No LTR
activity was detected in the FL at E11.5, even when as many as 4 ee were used
to reconstitute one adult irradiated recipient
(Table 2). By contrast, LTR
activity was observed in 70% of reconstituted mice injected with 1 ee control
C57Bl6 FL at the same stage (Table
2), and this LTR activity was associated with the presence of HSCs
(100% of secondary reconstituted mice injected with 5x105
bone marrow cells from primary recipients, data not shown). These results
indicate that at E11.5, Mpl-/- FL already presents a
profound HSC defect.
|
), with a
peak production at E12-13 (Ottersbach and
Dzierzak, 2005). We therefore investigated the LTR ability of
Mpl-/- placenta at E12.5. As shown in
Table 2, E12.5
Mpl-/- placentas contained more HPs endowed with LTR
ability than C57Bl6 placentas. However, a defect in HSC content was detected,
as illustrated by the low percentage of secondary reconstituted mice and the
low median of reconstitution. Although to a lesser extent, an input of LTR
cells from E12.5 Mpl-/- YS was also detected
(Table 2). This contribution of
LTR cells from AGM, placenta and YS through the blood stream could play a
significant part in the high LTR ability of E12.5 Mpl-/-
FL. This was supported by the fact that LTR cells were slightly more abundant
in blood from E12.5 Mpl-/- embryos than in blood from
control C57Bl6 embryos (data not shown).
|
), we
analyzed E14.5 crude Mpl-/- FL cells in reconstitution
assays. No animals could be reconstituted with 1x104
Mpl-/- cells, and only 40% of the mice were reconstituted
with 5x104 cells (instead of 20 and 60% when
1x104 and 5x104 C57Bl6 FL cells were
injected, respectively; see Table
2), which seems to indicate that the Mpl-/-
E14.5 FL presents a defect in LTR ability. Secondary transplantations showed
that this deficiency is accompanied by a deficit in HSCs (40% reconstitution
with bone marrow cells prepared from mice reconstituted with
Mpl-/- FL cells, with a maximum level of reconstitution of
only 38%, versus 90% with bone marrow cells prepared from mice reconstituted
with control C57Bl6 FL cells, with a maximum level of reconstitution of 80%)
(Table 2). It appears, then,
that E14.5 Mpl-/- FL presents a general defect in HPs and
HSCs. Taken together, these results indicate that HSC potential decreases
during FL development in Mpl-/- embryos.
Defect in amplification and self-renewal/survival of lin- AA4.1+ Sca1+ HSCs in Mpl-/- FL
In order to more accurately analyze the Mpl-/- HSC
content of the FL at E12.5, we sorted the lin- CD34+
c-kit+ population (enriched in HPs and HSCs) and the
lin- AA4.1+ Sca1+ population (highly enriched
in HSCs) (Jordan et al.,
1990), and compared their LTR ability to that of the same
populations sorted from control C57Bl6 FL. Whereas no significant difference
in the LTR ability was observed between Mpl-/- and C57Bl6
FL lin- CD34+ c-kit+ cells
(Table 3),
Mpl-/- lin- AA4.1+ Sca1+
cells presented a 4- to 5-fold defect in their ability to engraft irradiated
recipients (only 12.5% engrafted recipients with 2000
Mpl-/- cells, versus 57% with the same number of C57Bl6
cells). Likewise, long-term in vitro cultures on MS5 stroma revealed that
Mpl-/- lin- AA4.1+ Sca1+
presented three times fewer day-28 (D28) CAFCs than control lin-
AA4.1+ Sca1+ (1/1750 instead of 1/620). Interestingly,
whereas E12.5 Mpl-/- FL presented a total cellularity
equivalent to that of C57Bl6 FL, it was found to contain three times more
lin- AA4.1+ Sca1+ cells than control FL
(10,767±4592 for Mpl-/- FL, versus 3597±1985
for control FL) (see Fig. S1 in the supplementary material).
|
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
This finding was subsequently extended to the human embryo
(Tavian and Peault, 2005).
These observations have since led to many investigations into the generation
of definitive HSCs during development, and among the various approaches used,
gene-targeted mice have proven helpful in drawing up a map of regulatory
molecules that direct blood cell development
(Teitell and Mikkola, 2006).
In the present report, we show that Mpl, the receptor of the TPO cytokine
known to be an important regulator of adult HSC self-renewal and
proliferation, is also an important embryonic HSC regulator.
|
). This discrepancy may be attributed to the fact that very
few cells express Mpl at this stage, and/or that Mpl
expression is too faint to be detected by ISH. Indeed, using relative q-PCR
analysis, we were able to detect a low level of Mpl in the PSP region
at E9.5 (Fig. 3A), indicating
that this latter possibility is likely to be the case. In the FL, the number
of Mpl-positive spots reaches a peak at E11.5, and although it
decreases sharply after E14.5, expression persists in this organ until birth
(Fig. 2). Therefore, our
results indicate that Mpl expression is associated with the main
phases of hematopoiesis in the embryo and is linked to the emergence (AGM),
expansion and maturation (FL) of HSCs.
|
IIb integrin),
classically viewed as a megakaryocyte- and platelet-specific marker
(Ginsberg et al., 1995), which
has recently been detected on immature hematopoietic cells in the mouse embryo
(including sites of HSC emergence) and on multipotential myeloid progenitors
(Corbel and Salaun, 2002;
Berridge et al., 1985;
Debili et al., 1992;
Tronik-Le Roux et al., 1995).
A functional role for GpIIb in the regulation of progenitor cell number in the
YS, FL and bone marrow was demonstrated in GpIIb-null mice
(Emambokus and Frampton,
2003). Our analysis of the hematopoietic potential of Mpl-/- embryonic and fetal sites of hematopoiesis allowed us to underline the functional role of Mpl receptor during the various stages of the establishment of definitive hematopoiesis in the mouse (Fig. 7).
The AGM is a site of emergence of definitive HSCs that are able to colonize the FL. In the AGM, induction and generation of hematopoietic cells coincide with that of endothelial cells, and HSCs are produced and proliferate without differentiating. In the AGM, the absence of Mpl signal transduction leads to a delayed production of HSCs, as shown by: (1) the 2-fold lower LTR ability of AGM, associated with the lack of LTR potential of the FL at E11.5 (indicating that this organ has not yet been colonized by HSCs); and (2) the fact that LTR potential increases in E12.5 Mpl-/- AGM (Table 1). Importantly, not only did the lack of Mpl lead to delayed production of clusters of definitive hematopoietic cells in the AGM region, but it also resulted in the production of HSCs with an impaired activity, as demonstrated by secondary transplants.
The importance of Mpl signaling in the hematopoietic commitment of
mesodermal cells has already been suggested by our previous data based on in
vitro differentiation of ES cells (Challier
et al., 2002). This has been strengthened by the study of
Perlingeiro et al., who showed that TPO stimulates hemangioblast formation
during ES cell differentiation in vitro, indicating a role for TPO at the
earliest stages of hematopoietic cell commitment
(Perlingeiro et al., 2003).
Interestingly, it has recently been shown that the expression of VEGF-A (also
known as Vegfa), a key factor in the process of induction of the
hemangioblastic and hematopoietic development of ES cells
(Choi et al., 1998), is
enhanced by TPO in primitive hematopoietic cells
(Kirito et al., 2005). In the
AGM, TPO could act synergistically with VEGF-A, therefore enhancing the
commitment and induction of hematopoietic cells, which would explain the
delayed production of HSCs in the absence of Mpl signaling. The defect in the
activity of HSCs produced by Mpl-/- AGM underlines an
additional specific role of Mpl signaling in the self-renewal/survival of HSCs
at the earliest stages of their emergence in the embryo. Of interest, Mpl has
possible interactions with Runx1, one of the genes involved in the
emergence of definitive HSCs in the AGM region
(Teitell and Mikkola, 2006):
on the one hand, TPO/Mpl signaling can regulate the activity of Runx1 through
the ERK pathway (Hamelin et al.,
2006); on the other hand, Runx1 can putatively regulate Mpl
expression, as three Runx1 binding sites are present in the promoter region of
Mpl (Heller et al.,
2005).
The FL is the main site of HSC expansion and differentiation; the first
HSCs appear in this organ at E11.5 and are likely to come from the AGM and
placenta (Mikkola and Orkin,
2006). Indeed, the delayed production of HSCs by
Mpl-/- AGM led to a delayed colonization of FL by HSCs, as
no LTR activity could be detected in the E11.5 Mpl-/- FL
(Table 2). Interestingly, 1 day
later, normal amounts of both HPs and LTR cells were detected in this organ
(Fig. 5B and
Table 2). Our data showed that
this can be explained by an influx of LTR cells derived not only from the AGM
at E12.5, but also from the placenta and YS through blood circulation
(Table 2). These results are in
agreement with recent studies indicating that besides AGM, inputs of HSCs come
from E12 YS (Kumaravelu et al.,
2002) and placenta (Gekas et
al., 2005; Ottersbach and
Dzierzak, 2005). However, HSCs present in E12.5
Mpl-/- FL had a defect in their ability to self-renew.
This is at least in part the result of the colonization of FL by the HSCs
produced by the Mpl-/- AGM, which already presented an
impaired activity. Moreover, our data clearly indicate that HP, LTR activity
and HSC potential decrease during Mpl-/- FL development
(Fig. 5B and
Table 2), and underline a
defect in amplification and self-renewal/survival of the lin-
AA4.1+ Sca1+ population of HSCs. This step in HSC
maturation in the FL also corresponds to the timing of TPO production by this
organ (Nomura et al., 1997).
HSCs lacking Mpl are not exposed to the signals mediated through TPO, which
would normally help them to become functional adult-type HSCs and to retain
self-renewal and differentiation properties. The role of TPO in the
self-renewal capacity of adult HSCs in vivo has indeed been demonstrated in a
hematopoietic reconstitution model in which wild-type HSCs were grafted in
TPO-/- mice (Fox et al.,
2002; Kaushansky,
2003). The genes involved in the TPO-mediated steps of
amplification and self-renewal of HSCs during their passage in the FL remain
to be determined.
The differential role of Mpl that we underline in this work might be related to the properties of the various hematopoietic sites employed during development, and to the inductions/restrictions that are imposed on HSCs in these various territories. At any rate, our findings indicate that Mpl expression is important for HSCs at the earliest stages of their emergence in the mouse embryo, and that it could have different impacts on the generation and the expansion of HSCs during the establishment of definitive hematopoiesis.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/16/3031/DC1
|
ACKNOWLEDGMENTS |
|---|
aises dans la Lutte
contre le Cancer (GEFLUC). M.F. is supported by the Ministère de
l'Education Nationale, de la Recherche et de la Technologie (MENRT). |
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Alexander, W. S., Roberts, A. W., Nicola, N. A., Li, R. and
Metcalf, D. (1996). Deficiencies in progenitor cells of
multiple hematopoietic lineages and defective megakaryocytopoiesis in mice
lacking the thrombopoietic receptor c-Mpl. Blood
87,2162
-2170.
Berridge, M. V., Ralph, S. J. and Tan, A. S.
(1985). Cell-lineage antigens of the stem
cell-megakaryocyte-platelet lineage are associated with the platelet IIb-IIIa
glycoprotein complex. Blood
66, 76-85.
Borge, O. J., Ramsfjell, V., Cui, L. and Jacobsen, S. E.
(1997). Ability of early acting cytokines to directly promote
survival and suppress apoptosis of human primitive CD34+.
Blood 90,2282
-2292.
Challier, C., Cocault, L., Berthier, R., Binart, N.,
Dusanter-Fourt, I., Uzan, G. and Souyri, M. (2002). The
cytoplasmic domain of Mpl receptor transduces exclusive signals in embryonic
and fetal hematopoietic cells. Blood
100,2063
-2070.
Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. and Keller, G. (1998). A common precursor for hematopoietic and endothelial cells. Development 125,725 -732.[Abstract]
Cocault, L., Bouscary, D., Le Bousse, K. C., Clay, D., Picard,
F., Gisselbrecht, S. and Souyri, M. (1996). Ectopic
expression of murine TPO receptor (c-mpl) in mice is pathogenic and induces
erythroblastic proliferation. Blood
88,1656
-1665.
Corbel, C. and Salaun, J. (2002). Alpha IIb integrin expression during development of the murine hemopoietic system. Dev. Biol. 243,301 -311.[CrossRef][Medline]
Cumano, A., Dieterlen-Lievre, F. and Godin, I. (1996). Lymphoid potential, probed before circulation in mouse, is restricted to caudal intraembryonic splanchnopleura. Cell 86,907 -916.[CrossRef][Medline]
Debili, N., Issaad, C., Masse, J. M., Guichard, J., Katz, A.,
Breton-Gorius, J. and Vainchenker, W. (1992). Expression of
CD34 and platelet glycoproteins during human megakaryocytic differentiation.
Blood 80,3022
-3035.
Durand, C. and Dzierzak, E. (2005). Embryonic
beginnings of adult hematopoietic stem cells.
Haematologica 90,100
-108.
Eaton, D. L. and de Sauvage, F. J. (1997). Thrombopoietin: the primary regulator of megakaryocytopoiesis and thrombopoiesis. Exp. Hematol. 25, 1-7.[Medline]
Ema, H. and Nakauchi, H. (2000). Expansion of
hematopoietic stem cells in the developing liver of a mouse embryo.
Blood 95,2284
-2288.
Emambokus, N. R. and Frampton, J. (2003). The glycoprotein IIb molecule is expressed on early murine hematopoietic progenitors and regulates their numbers in sites of hematopoiesis. Immunity 19,33 -45.[CrossRef][Medline]
Fox, N., Priestley, G., Papayannopoulou, T. and Kaushansky, K. (2002). Thrombopoietin expands hematopoietic stem cells after transplantation. J. Clin. Invest. 110,389 -394.[CrossRef][Medline]
Gekas, C., Dieterlen-Lievre, F., Orkin, S. H. and Mikkola, H. K. (2005). The placenta is a niche for hematopoietic stem cells. Dev. Cell 8,365 -375.[CrossRef][Medline]
Ginsberg, M. H., Du, X., O'Toole, T. E. and Loftus, J. C. (1995). Platelet integrins. Thromb. Haemost. 74,352 -359.[Medline]
Gurney, A. L., Carver-Moore, K., de Sauvage, F. J. and Moore, M.
W. (1994). Thrombocytopenia in c-mpl-deficient mice.
Science 265,1445
-1447.
Hamelin, V., Letourneux, C., Romeo, P. H., Porteu, F. and
Gaudry, M. (2006). Thrombopoietin regulates IEX-1 gene
expression through ERK-induced AML1 phosphorylation.
Blood 107,3106
-3113.
Heller, P. G., Glembotsky, A. C., Gandhi, M. J., Cummings, C.
L., Pirola, C. J., Marta, R. F., Kornblihtt, L. I., Drachman, J. G. and
Molinas, F. C. (2005). Low Mpl receptor expression in a
pedigree with familial platelet disorder with predisposition to acute
myelogenous leukemia and a novel AML1 mutation. Blood
105,4664
-4670.
Itoh, K., Tezuka, H., Sakoda, H., Konno, M., Nagata, K., Uchiyama, T., Uchino, H. and Mori, K. J. (1989). Reproducible establishment of hemopoietic supportive stromal cell lines from murine bone marrow. Exp. Hematol. 17,145 -153.[Medline]
Jordan, C. T., McKearn, J. P. and Lemischka, I. R. (1990). Cellular and developmental properties of fetal hematopoietic stem cells. Cell 61,953 -963.[CrossRef][Medline]
Kaushansky, K. (1995). Thrombopoietin: the
primary regulator of platelet production. Blood
86,419
-431.
Kaushansky, K. (2003). Thrombopoietin:
accumulating evidence for an important biological effect on the hematopoietic
stem cell. Ann. N. Y. Acad. Sci.
996, 39-43.
Kimura, S., Roberts, A. W., Metcalf, D. and Alexander, W. S.
(1998). Hematopoietic stem cell deficiencies in mice lacking
c-Mpl, the receptor for thrombopoietin. Proc. Natl. Acad. Sci.
USA 95,1195
-1200.
Kirito, K., Fox, N., Komatsu, N. and Kaushansky, K.
(2005). Thrombopoietin enhances expression of vascular
endothelial growth factor (VEGF) in primitive hematopoietic cells through
induction of HIF-1{alpha}. Blood
105,4258
-4263.
Kumaravelu, P., Hook, L., Morrison, A. M., Ure, J., Zhao, S.,
Zuyev, S., Ansell, J. and Medvinsky, A. (2002). Quantitative
developmental anatomy of definitive haematopoietic stem cells/long-term
repopulating units (HSC/RUs): role of the aorta-gonad-mesonephros (AGM) region
and the yolk sac in colonisation of the mouse embryonic liver.
Development 129,4891
-4899.
Labastie, M. C., Catala, M., Gregoire, J. M. and Peault, B. (1995). The GATA-3 gene is expressed during human kidney embryogenesis. Kidney Int. 47,1597 -1603.[Medline]
Labastie, M. C., Cortes, F., Romeo, P. H., Dulac, C. and Peault,
B. (1998). Molecular identity of hematopoietic precursor
cells emerging in the human embryo. Blood
92,3624
-3635.
Levin, J., Cocault, L., Demerens, C., Challier, C., Pauchard,
M., Caen, J. and Souyri, M. (2001). Thrombocytopenic
c-mpl(-/-) mice can produce a normal level of platelets after administration
of 5-fluorouracil: the effect of age on the response.
Blood 98,1019
-1027.
Luens, K. M., Travis, M. A., Chen, B. P., Hill, B. L., Scollay,
R. and Murray, L. J. (1998). Thrombopoietin, kit ligand, and
flk2/flt3 ligand together induce increased numbers of primitive hematopoietic
progenitors from human CD34+Thy-1+Lin-cells with preserved ability to engraft
SCID-hu bone. Blood 91,1206
-1215.
Medvinsky, A. and Dzierzak, E. (1996). Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86,897 -906.[CrossRef][Medline]
Mikkola, H. K. and Orkin, S. H. (2006). The
journey of developing hematopoietic stem cells.
Development 133,3733
-3744.
Morrison, S. J., Hemmati, H. D., Wandycz, A. M. and Weissman, I.
L. (1995). The purification and characterization of fetal
liver hematopoietic stem cells. Proc. Natl. Acad. Sci.
USA 92,10302
-10306.
Muller, A. M., Medvinsky, A., Strouboulis, J., Grosveld, F. and Dzierzak, E. (1994). Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1, 291-301.[CrossRef][Medline]
Murray, L. J., Young, J. C., Osborne, L. J., Luens, K. M., Scollay, R. and Hill, B. L. (1999). Thrombopoietin, flt3, and kit ligands together suppress apoptosis of human mobilized CD34+ cells and recruit primitive CD34+ Thy-1+ cells into rapid division. Exp. Hematol. 27,1019 -1028.[CrossRef][Medline]
Nomura, S., Ogami, K., Kawamura, K., Tsukamoto, I., Kudo, Y., Kanakura, Y., Kitamura, Y., Miyazaki, H. and Kato, T. (1997). Cellular localization of thrombopoietin mRNA in the liver by in situ hybridization. Exp. Hematol. 25,565 -572.[Medline]
Ottersbach, K. and Dzierzak, E. (2005). The murine placenta contains hematopoietic stem cells within the vascular labyrinth region. Dev. Cell 8, 377-387.[CrossRef][Medline]
Perlingeiro, R. C., Kyba, M., Bodie, S. and Daley, G. Q.
(2003). A role for thrombopoietin in hemangioblast development.
Stem Cells 21,272
-280.
Ramsfjell, V., Borge, O. J., Veiby, O. P., Cardier, J., Murphy,
M. J., Jr, Lyman, S. D., Lok, S. and Jacobsen, S. E. (1996).
Thrombopoietin, but not erythropoietin, directly stimulates multilineage
growth of primitive murine bone marrow progenitor cells in synergy with early
acting cytokines: distinct interactions with the ligands for c-kit and FLT3.
Blood 88,4481
-4492.
Robin, C., Ottersbach, K., Durand, C., Peeters, M., Vanes, L., Tybulewicz, V. and Dzierzak, E. (2006). An unexpected role for IL-3 in the embryonic development of hematopoietic stem cells. Dev. Cell 11,171 -180.[CrossRef][Medline]
Solar, G. P., Kerr, W. G., Zeigler, F. C., Hess, D., Donahue,
C., de Sauvage, F. J. and Eaton, D. L. (1998). Role of c-mpl
in early hematopoiesis. Blood
92, 4-10.
Souyri, M., Vigon, I., Penciolelli, J. F., Heard, J. M., Tambourin, P. and Wendling, F. (1990). A putative truncated cytokine receptor gene transduced by the myeloproliferative leukemia virus immortalizes hematopoietic progenitors. Cell 63,1137 -1147.[CrossRef][Medline]
Tavian, M. and Peault, B. (2005). Analysis of hematopoietic development during human embryonic ontogenesis. Methods Mol. Med. 105,413 -424.[Medline]
Teitell, M. A. and Mikkola, H. K. (2006). Transcriptional activators, repressors, and epigenetic modifiers controlling hematopoietic stem cell development. Pediatr. Res. 59,33R -39R.[CrossRef][Medline]
Terskikh, A. V., Easterday, M. C., Li, L., Hood, L., Kornblum,
H. I., Geschwind, D. H. and Weissman, I. L. (2001). From
hematopoiesis to neuropoiesis: evidence of overlapping genetic programs.
Proc. Natl. Acad. Sci. USA
98,7934
-7939.
Terskikh, A. V., Miyamoto, T., Chang, C., Diatchenko, L. and
Weissman, I. L. (2003). Gene expression analysis of purified
hematopoietic stem cells and committed progenitors.
Blood 102,94
-101.
Tronik-Le Roux, D., Roullot, V., Schweitzer, A., Berthier, R.
and Marguerie, G. (1995). Suppression of
erythro-megakaryocytopoiesis and the induction of reversible thrombocytopenia
in mice transgenic for the thymidine kinase gene targeted by the platelet
glycoprotein alpha IIb promoter. J. Exp. Med.
181,2141
-2151.
Weissman, I. L. (2000). Stem cells: units of development, units of regeneration, and units in evolution. Cell 100,157 -168.[CrossRef][Medline]
Wolber, E. M., Dame, C., Fahnenstich, H., Hofmann, D., Bartmann,
P., Jelkmann, W. and Fandrey, J. (1999). Expression of the
thrombopoietin gene in human fetal and neonatal tissues.
Blood 94,97
-105.
Ziegler, S., Burki, K. and Skoda, R. C. (2002).
A 2-kb c-mpl promoter fragment is sufficient to direct expression to the
megakaryocytic lineage and sites of embryonic hematopoiesis in transgenic
mice. Blood 100,1072
-1074.
| ||||||||||||||||||||||||||||||||||||||||||||
