|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 18 July 2007
doi: 10.1242/dev.002907
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Developmental Biology, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX 75390-9133, USA.
e-mail: rita.perlingeiro{at}utsouthwestern.edu
Accepted 12 June 2007
| SUMMARY |
|---|
|
|
|---|
Key words: ES cells, Endoglin, Hemangioblast, Primitive erythropoiesis, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Mutations in endoglin that lead to haploinsufficiency are associated with
an autosomal-dominant vascular disorder termed hereditary hemorrhagic
telangiectasia (HHT) (McAllister et al.,
1994
) in humans, which is characterized by hemorrhagic bleedings,
which are presumably secondary to vascular malformations. Mice lacking one
copy of the endoglin gene also display vascular defects and hemorrhage, and
represent a murine model for HHT (Bourdeau
et al., 1999
). Complete loss of endoglin is embryonic lethal.
Embryos homozygous for the endoglin knockout (Eng-/-) fail
to progress beyond 10.5 days postcoitum (dpc), primarily due to vascular and
cardiac abnormalities (Arthur et al.,
2000
; Bourdeau et al.,
1999
). Analysis of 9.5 dpc mouse Eng-/-
embryos revealed abnormal vasculature and anemia of the yolk sac
(Arthur et al., 2000
). Although
the anemia was suggested to be secondary to defective vasculature, a possible
earlier effect in the hematopoietic lineage has not been investigated in these
knockout mice. Besides being detected in endothelial cells between embryonic
day (E)8.5 and E10.5 (Hirashima et al.,
2004
), endoglin is also present in early extraembryonic mesoderm
from gastrulating embryos (Ema et al.,
2006b
; Hirashima et al.,
2004
), suggesting a potential role for endoglin in earlier
developmental stages.
By differentiating embryonic stem (ES) cells using the OP9 co-culture
system, Cho and colleagues (Cho et al.,
2001
) have shown that myelopoiesis and definitive erythropoiesis
is impaired in the absence of endoglin. However primitive erythropoiesis,
reflective of yolk sac hematopoiesis, was not investigated in this study.
The close association between endothelial cells and primitive hematopoietic
precursors in the embryonic yolk sac suggests that the endothelium plays a
crucial role in early hematopoietic development, providing the
microenvironment required for stem cell proliferation and differentiation.
Endothelial and blood precursors also both express several of the same crucial
regulatory genes and antigenic markers
(Kabrun et al., 1997
;
Kallianpur et al., 1994
;
Orkin, 1992
;
Yamaguchi et al., 1993
;
Young et al., 1995
). These
observations support the hypothesis that a common progenitor, the
hemangioblast, gives rise to both endothelial and hematopoietic cells
(His, 1900
;
Murray, 1932
;
Sabin, 1920
). A cell with
properties of the hemangioblast has been identified during in vitro
differentiation of ES cells into embryoid bodies (EBs)
(Kennedy et al., 1997
), and
has more recently been identified in the primitive streak of the mouse embryo
(Huber et al., 2004
). This
precursor, referred to as the blast colony-forming cell (BL-CFC) forms in
response to vascular endothelial growth factor (VEGF) and stem cell factor
(SCF, also known as KITL - Mouse Genome Informatics), and represents a
transient population of cells that stands at the juncture of the endothelial
and hematopoietic lineages (Choi et al.,
1998
).
To address whether endoglin is important at these early stages of development, endoglin-deficient mouse ES cells were evaluated for their hemangioblast activity as well as for their hematopoietic and endothelial potential. The results of this study point to an essential role for endoglin at the stages of hemangioblast specification as well as at hematopoietic commitment.
| MATERIALS AND METHODS |
|---|
|
|
|---|
ES cells were maintained on gelatinized flasks in DMEM (Sigma) supplemented with 1000 U/ml leukemia inhibitory factor (LIF; Chemicon), 15% knockout serum replacement (Invitrogen), 0.1 mM non-essential amino acids (Sigma), and 0.1 mM of beta-mercaptoethanol (Sigma) in the absence of feeders for up to 15 passages. For differentiation cultures, the cells were dissociated with trypsin (0.25%; Invitrogen)/EDTA (1 mM; Sigma) to form a single-cell suspension. Cells were washed three times with phosphate-buffered saline (PBS) and EBs were generated by plating 5 x104 cells per ml in EB media, which consists of IMDM (Sigma) with 15% fetal calf serum (FCS; Sigma), 50 µg/ml ascorbic acid (Sigma), 200 µg/ml iron-saturated transferrin (Sigma), 4.5x10-4 M monothioglycerol (MTG; Sigma) and 0.9% methylcellulose (M3120, StemCell Technologies) in 35 mm Petri dishes (StemCell Technologies).
Blast colony-forming cell (BL-CFC) assay
EBs were collected at 3 days post differentiation, washed in PBS and
treated with 0.25% trypsin for 3 minutes at 37°C. EBs were disrupted to
single cells by repeated pipetting and plated at 5x104 cells
in 1 ml of methylcellulose medium (M3120) with 10% FCS, 50 µg/ml ascorbic
acid, 200 µg/ml iron-saturated transferrin, 4.5x10-4 M
MTG, in the presence of thrombopoietin (TPO, 25 ng/ml; Peprotech), vascular
endothelial growth factor (VEGF, 5 ng/ml; Peprotech) and stem cell factor
(SCF, 100 ng/ml; Peprotech), as previously described
(Choi et al., 1998
;
Perlingeiro et al., 2003
).
Cultures were maintained in a humidified incubator at 37°C in an
environment of 5% CO2 in air. After 5 days developing, BL-CFCs were
counted and picked for replating studies.
Generation of hematopoietic cells
Cells from EBs at different time points (days 3, 4, and 5), or individual
BL-CFCs, were plated into methylcellulose media containing interleukin 3
(IL3), interleukin 6 (IL6), erythropoietin (EPO) and SCF (M3434; StemCell
Technologies). Cultures were maintained as described above and primitive
erythroid colonies were scored at 6 days of growth.
Generation of endothelial cells
Individual BL-CFCs were picked and transferred to gelatin-coated microtiter
wells containing IMDM with 10% FCS, 10% horse serum (Biocell), VEGF (5 ng/ml),
insulin-like growth factor 1 (IGF1, 10 ng/ml; Peprotech), EPO (2 U/ml; R&D
Systems), fibroblast growth factor (bFGF, 10 ng/ml; Peprotech), interleukin 11
(IL11, 50 ng/ml; R&D Systems), SCF (100 ng/ml), endothelial cell growth
supplement (ECGS, 100 µg/ml; Collaborative Research), L-glutamine (2 mM),
and 4.5x10-4 MTG. After 3-4 days in culture, non-adherent
cells were removed and adherent cells were cultured for an additional 1-2
weeks in IMDM with 10% FCS, 10% horse serum, VEGF (5 ng/ml), IGF-1 (10 ng/ml),
bFGF (10 ng/ml), ECGS (100 µg/ml), L-glutamine (2 mM) and
4.5x10-4 MTG (Choi et al.,
1998
; Perlingeiro et al.,
2003
).
Rescue experiments
A CMV-endoglin transgene was inserted into the Eng-/-
ES cells. The endoglin cDNA was obtained from Open Biosystems on a CMV
expression vector, pSport6.1. The cDNA was subcloned from this construct to
pcDNA3.1/zeo on a SalI/NotI fragment. ES cells were
electroporated with BstZ17I/PvuI digested plasmid and
colonies selected on Zeocin. Five clones were tested for expression by flow
cytometry. The best expressor was selected for differentiation studies.
Sprouting assay
Eng+/- and Eng-/- ES cells were
differentiated into EBs at 2x103 ES cells per 35-mm Petri
dish in EB media (as described above) supplemented with recombinant human (rh)
insulin (10 µg/ml), human (h)VEGF (50 ng/ml), hEPO (2 U/ml), hIL6 (10
ng/ml) and bFGF (100 ng/ml) (Feraud et
al., 2001
; Vittet et al.,
1996
). After 11 days of EB differentiation, intact EBs were
sub-cultured at 140-180 EBs per 35-mm Petri dish with the same cytokines on a
collagen I matrix (Becton Dickinson). After 3 days at 37°C and 5%
CO2, the vascular spindle-like EBs were assessed for sprouting
angiogenesis based on the following categories: I, no sprout formation; II,
few sprouts; III, many sprouts but no network; and IV, many sprouts with
network (Feraud et al., 2001
).
Scoring was performed in a blinded fashion.
Flow cytometry
For endoglin, a rat anti-mouse antibody was used (Pharmingen). For
secondary staining, an R-phycoerythrin (PE)-conjugated goat anti-rat Ig
(Pharmingen) was applied. For FLK-1 (also known as KDR - Mouse Genome
Informatics), a biotinylated anti-mouse antibody was used (R&D Systems),
followed by Streptavidin-Allophycocyanin (APC) (Pharmingen). We also used
fluorescein-5-isothiocyanate (FITC)-conjugated anti-mouse GPIIB (also known as
ITGA2B and CD41 - Mouse Genome Informatics) and PE-conjugated anti-mouse c-KIT
(KIT; Pharmingen). For the staining of endothelial progenitors, we used
APC-conjugated anti-mouse FLK-1 (eBioscience), biotinylated anti-mouse TIE-2
(also known as TEK - Mouse Genome Informatics; eBioscience) and rat anti-mouse
VE-cadherin (also known as CDH5 - Mouse Genome Informatics; Pharmingen),
followed by Streptavidin-APC and PE-conjugated goat anti-rat Ig.
EB cells were collected after a short incubation with trypsin, washed twice, first with IMDM 10% FBS and then with blocking buffer (PBS 1% FBS), suspended in the same buffer containing 0.25 µg/106 cells of Fc block (Pharmingen) and placed on ice for 5 minutes. Antibody was added at 1 µg/106 cells and incubated at 4°C for 30 minutes before washing with blocking buffer. When secondary staining was required, cells were counterstained with the appropriate secondary antibody for 20 minutes at 4°C, followed by washing with blocking buffer. Stained cells were analyzed on a FACSAria cell sorter (Becton-Dickinson) after the addition of propidium iodide (Pharmingen) to exclude dead cells.
Reverse transcriptase polymerase chain reaction (RT-PCR) analysis
Total RNA was isolated using Trizol (Invitrogen) as recommended by the
manufacturer. First-strand cDNA was produced using Superscript II reverse
transcriptase (Invitrogen) with Oligo dT. A total of 5% of first-strand
reaction was used for each ensuing PCR reaction. Primer sequences and PCR
conditions are described in Table
1. For real-time PCR, all probe sets were acquired from Applied
Biosystems. For globins, we designed our own primer/probe sets (all shown
5'-3'):
|
Beta-H1 F, CCTCAAGGAGACCTTTGCTCAT; Beta-H1R, CAGGCAGCCTGCACCTCT; Beta-H1 probe, 6FAM-CAACATGTTGGTGATTGTCCTTTCT-TAMRA.
| RESULTS |
|---|
|
|
|---|
|
Endoglin marks the hemangioblast
FLK-1 marks nascent mesoderm (Ema et
al., 2006a
) and is the only known surface marker for the
hemangioblast (D'Souza et al.,
2005
; Ema et al.,
2003
; Huber et al.,
2004
). To address whether the defective hemangioblast formation
from endoglin-deficient ES cells was associated with an insufficient number of
FLK-1-positive precursors, expression of FLK-1 and endoglin was evaluated over
a time course of EB differentiation. As expected, endoglin was absent in
Eng-/- cells (Fig.
2A, lower panel, and Fig.
2B). However, FLK-1 levels were equivalent to wild-type cells
(Fig. 2A, upper panel),
suggesting that a lack of endoglin does not interfere with the origin of
mesoderm. This finding is corroborated by the normal levels of brachyury, a
mesodermal marker, in differentiating Eng-/- cells
(Fig. 2B). We also observed
that endoglin was abundantly expressed in ES cells
(Fig. 2A,B) and that, as
differentiation proceeded, its expression was gradually reduced to
approximately 13% of the total EB population by day 6
(Fig. 2A, upper panel).
Interestingly, during differentiation, a fraction of ENG+ cells
also became positive for FLK-1, reaching a peak for double-positives
(ENG+FLK-1+) on day 3 of EB differentiation
(approximately 30%), which coincided with the peak for hemangioblast activity
during EB differentiation (Fig.
2A, upper panel). With the aim of examining which cell population
contains the hemangioblast precursor (the BL-CFC), we carried out cell-sorting
experiments on EBs derived from wild-type ES cells. In these experiments the
four cell fractions (ENG+FLK-1+,
ENG+FLK-1-, ENG-FLK-1+ and
ENG-FLK-1-) were purified and assayed for their
hemangioblast activity (Fig.
2C). We observed a substantial enrichment for blast colonies in
the double-positive fraction (ENG+FLK-1+)
(Fig. 2C) when compared with
the ENG-FLK-1+, ENG+FLK-1+, or
ENG-FLK-1- cell fractions (enriched 3.4-, 5.3- and
7.1-fold, respectively). These results indicate that endoglin is not only
essential for hemangioblast development, but it actually also functions as a
marker for this precursor on day 3 of EB differentiation.
|
Embryonic hematopoiesis is impaired in the absence of endoglin
Because anemia is a feature of yolk sacs from 9.5 dpc
Eng-/- embryos (Arthur
et al., 2000
), we also examined early erythropoiesis using
differentiating EBs. For this purpose, Eng-/-,
Eng+/- and Eng+/+ ES cells were
differentiated into EBs for 3, 4 and 5 days, at which time cells were
disrupted and plated for primitive erythroid colonies (EryP) in
methylcellulose medium containing IL-3, IL-6, SCF and EPO. Overall, a
reduction in the number of EryP colonies was observed in
Eng-/- EBs at all the EB time points studied
(Fig. 4A; 8.3-, 6.7- and
25.8-fold reduction on days 3, 4, and 5 of EB differentiation, respectively).
We also evaluated levels of both embryonic and adult globins as well as
several hematopoietic-specific genes, including those encoding SCL, GATA2,
RUNX1, GATA1, GPIIB (CD41), NFE2 and FMS (also known as CSF1R - Mouse Genome
Informatics), on Eng-/- EBs, and observed an overall
reduction in hematopoietic-specific gene expression
(Fig. 4B). These results
provide an explanation for the anemia observed in vivo in
Eng-/- embryos as well as the reduced hematopoietic
replating potential observed in Eng-/- BL-CFCs
(Fig. 1C). Flow cytometry
analyses of day 6 EBs for c-KIT and GPIIB (CD41) (the alpha component of
2bß3 integrin), for which the
double-positive fraction represents hematopoietic progenitors
(Mikkola et al., 2003
;
Mitjavila-Garcia et al.,
2002
), revealed that this population is reduced by half in the
absence of endoglin (Fig.
4C).
Lack of endoglin does not affect vasculogenesis but reduces branching ability (angiogenesis)
To investigate whether angioblast precursors are affected by the lack of
endoglin, Eng+/+ and Eng-/- day 6 EBs
were analyzed for the expression of VE-cadherin in combination with FLK-1 or
TIE-2 (Zhang et al., 2005
). As
evidenced by the percentage of cells that were double-positive for
VE-cadherin/FLK-1 and VE-cadherin/TIE-2
(Fig. 5A), no differences were
found in the frequency of vascular precursors between the two genotypes. These
results suggest that vasculogenesis is not affected by the absence of
endoglin, which corroborates our findings on the normal endothelial replating
of Eng-/- BL-CFCs (Fig.
1C).
To assess the later role of endoglin in angiogenesis, we applied an in
vitro angiogenic model, in which EBs are transferred into a collagen I matrix
(Feraud et al., 2001
). In this
model, EBs develop endothelial sprouting in the presence of angiogenic growth
factors (Vittet et al., 1996
)
and form a primitive vascular network. Eng+/+,
Eng+/- and Eng-/- ES cells were
differentiated in methylcellulose for 11 days in the presence of VEGF, EPO,
IL-6 and bFGF. At this point, intact EBs were sub-cultured with the same
cytokines on a collagen I matrix for 3 days and sprouting angiogenesis was
assessed. Whereas the majority of Eng+/+ and
Eng+/- EBs presented many sprouts with extensive network
formation (class III and IV), the sprouts produced by
Eng-/- EBs had reduced branching ability
(Fig. 5B,C). This result agrees
with the findings from endoglin-knockout mouse embryos
(Li et al., 1999
).
|
| DISCUSSION |
|---|
|
|
|---|
Endoglin as a regulator of cell fate decision
Despite extensive research in the field, our understanding of the molecular
mechanisms that govern the lineage decision from mesodermal cells to
hemangioblast and how the hemangioblast selects between endothelial and
hematopoietic fates is very limited. To date, a handful of genes have been
reported to play a role in hemangioblast formation, including Flk-1
(Faloon et al., 2000
;
Schuh et al., 1999
),
Scl (Faloon et al.,
2000
; Robertson et al.,
2000
), Runx1 (Lacaud
et al., 2002
), EphB4
(Wang et al., 2004
) and
Mixl1 (Willey et al.,
2006
). In addition, a negative regulator, Hex (also known
as Hhex - Mouse Genome Informatics), has been identified
(Guo et al., 2003
;
Kubo et al., 2005
).
The data shown here demonstrate that endoglin also plays a crucial role in
hemangioblast development. Dramatically reduced numbers of BL-CFCs were
observed in the absence of endoglin during EB differentiation. Unlike the
Ephb4 knockout (Wang et al.,
2004
), endoglin deficiency does not seem to affect the origin of
mesoderm, because the levels of FLK-1 and brachyury were unaltered. This
points to a later function, at the specification of mesoderm to
hemangioblast.
The extent of reduction observed in these studies parallels that seen with
Flk-1-knockout cells (Schuh et
al., 1999
). However, whereas the few BL-CFCs resulting from
Flk-1-deficient EBs retain bipotentiality, the few BL-CFCs that
formed from endoglin-null EBs were skewed towards the endothelial
lineage. These findings were further corroborated by the reduced number of
primitive erythroid progenitors present at days 3, 4 and 5 of EB
differentiation. The anemia of endoglin-knockout embryos has been interpreted
as a secondary manifestation of improper vascularization. Our results suggest
that anemia might result from a direct effect of endoglin on hematopoiesis.
This assumption is supported by in vitro studies using day-9 and -12
Eng-/- ES/OP9 co-cultures, which show a reduction in
myelo-erythropoietic progenitors in the absence of endoglin
(Cho et al., 2001
).
Interestingly, in our studies, haploinsufficiency was observed for primitive
erythropoiesis. Thus, it is reasonable to hypothesize that the anemia, a
classic symptom of hereditary hemorrhagic telangiectasia (HHT) patients, might
result from an intrinsic defect in erythropoiesis.
|
|
Endoglin and TGF-ß signaling
Because endoglin is a receptor for TGF-ß, it is likely that this
factor influences hemangioblast development, particularly in light of the fact
that TGF-ß1 is expressed in the yolk sac blood islands of 7.5 dpc embryos
(Akhurst et al., 1990
).
TGF-ß1 is well known for its inhibitory effect in endothelial
differentiation (Basson et al.,
1992
; Muller et al.,
1987
) and in hematopoietic proliferation
(Ohta et al., 1987
;
Sing et al., 1988
).
Accordingly, a reduction in the number of hematopoietic progenitors was
observed when TGF-ß1 was added to EB cultures
(Park et al., 2004
).
Inhibition of BL-CFCs was also observed when TGF-ß1 was added to the
blast media (R.C.R.P., unpublished). Based on these in vitro results, one
would expect that absence of this potent growth inhibitor in vivo would result
in endothelial and hematopoietic hyperplasia. However, Tgfb1
knockouts present compromised hematopoiesis and endothelial differentiation, a
phenotype somewhat similar to the endoglin knockout
(Dickson et al., 1995
). These
seemingly discordant findings might be due to the in vivo redundancy with
other TGF-ß isoforms or to a biphasic effect
(Goumans et al., 2003
), with
high levels being inhibitory but low levels being necessary. Nevertheless,
because endoglin is an accessory non-signaling receptor, it is most likely to
function as a modulator of TGF-ß responses in early mesoderm. We are
currently investigating the precise mechanism by which endoglin plays a role
in this early developmental process.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akhurst, R. J., Lehnert, S. A., Faissner, A. J. and Duffie,
E. (1990). TGF beta in murine morphogenetic processes: the
early embryo and cardiogenesis. Development
108,645
-656.
Arthur, H. M., Ure, J., Smith, A. J., Renforth, G., Wilson, D. I., Torsney, E., Charlton, R., Parums, D. V., Jowett, T., Marchuk, D. A. et al. (2000). Endoglin, an ancillary TGFbeta receptor, is required for extraembryonic angiogenesis and plays a key role in heart development. Dev. Biol. 217, 42-53.[CrossRef][Medline]
Barbara, N. P., Wrana, J. L. and Letarte, M.
(1999). Endoglin is an accessory protein that interacts with the
signaling receptor complex of multiple members of the transforming growth
factor-beta superfamily. J. Biol. Chem.
274,584
-594.
Basson, C. T., Kocher, O., Basson, M. D., Asis, A. and Madri, J. A. (1992). Differential modulation of vascular cell integrin and extracellular matrix expression in vitro by TGF-beta 1 correlates with reciprocal effects on cell migration. J. Cell. Physiol. 153,118 -128.[CrossRef][Medline]
Bourdeau, A., Dumont, D. J. and Letarte, M. (1999). A murine model of hereditary hemorrhagic telangiectasia. J. Clin. Invest. 104,1343 -1351.[Medline]
Cheifetz, S., Bellon, T., Cales, C., Vera, S., Bernabeu, C.,
Massague, J. and Letarte, M. (1992). Endoglin is a component
of the transforming growth factor-beta receptor system in human endothelial
cells. J. Biol. Chem.
267,19027
-19030.
Chen, C. Z., Li, M., de Graaf, D., Monti, S., Gottgens, B.,
Sanchez, M. J., Lander, E. S., Golub, T. R., Green, A. R. and Lodish, H.
F. (2002). Identification of endoglin as a functional marker
that defines long-term repopulating hematopoietic stem cells. Proc.
Natl. Acad. Sci. USA 99,15468
-15473.
Cho, S. K., Bourdeau, A., Letarte, M. and Zuniga-Pflucker, J.
C. (2001). Expression and function of CD105 during the onset
of hematopoiesis from Flk1(+) precursors. Blood
98,3635
-3642.
Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J. C. and Keller, G. (1998). A common precursor for hematopoietic and endothelial cells. Development 125,725 -732.[Abstract]
Dickson, M. C., Martin, J. S., Cousins, F. M., Kulkarni, A. B., Karlsson, S. and Akhurst, R. J. (1995). Defective haematopoiesis and vasculogenesis in transforming growth factor-beta1 knock out mice. Development 121,1845 -1854.[Abstract]
D'Souza, S. L., Elefanty, A. G. and Keller, G.
(2005). SCL/Tal-1 is essential for hematopoietic commitment of
the hemangioblast but not for its development. Blood
105,3862
-3870.
Ema, M., Faloon, P., Zhang, W. J., Hirashima, M., Reid, T., Stanford, W. L., Orkin, S., Choi, K. and Rossant, J. (2003). Combinatorial effects of Flk1 and Tal1 on vascular and hematopoietic development in the mouse. Development 17,380 -393.
Ema, M., Takahashi, S. and Rossant, J. (2006a).
Deletion of the selection cassette, but not cis-acting elements, in targeted
Flk1-lacZ allele reveals Flk1 expression in multipotent mesodermal
progenitors. Blood 107,111
-117.
Ema, M., Yokomizo, T., Wakamatsu, A., Terunuma, T., Yamamoto, M.
and Takahashi, S. (2006b). Primitive erythropoiesis from
mesodermal precursors expressing VE-cadherin, PECAM-1, Tie2, endoglin, and
CD34 in the mouse embryo. Blood
108,4018
-4024.
Faloon, P., Arentson, E., Kazarov, A., Deng, C. X., Porcher, C., Orkin, S. and Choi, K. (2000). Basic fibroblast growth factor positively regulates hematopoietic development. Development 127,1931 -1941.[Abstract]
Feraud, O., Cao, Y. and Vittet, D. (2001). Embryonic stem cell-derived embryoid bodies development in collagen gels recapitulates sprouting angiogenesis. Lab. Invest. 81,1669 -1681.[Medline]
Goumans, M. J., Lebrin, F. and Valdimarsdottir, G. (2003). Controlling the angiogenic switch: a balance between two distinct TGF-b receptor signaling pathways. Trends Cardiovasc. Med. 13,301 -307.[CrossRef][Medline]
Guo, Y., Chan, R., Ramsey, H., Li, W., Xie, X., Shelley, W. C.,
Martinez-Barbera, J. P., Bort, B., Zaret, K., Yoder, M. et al.
(2003). The homeoprotein Hex is required for hemangioblast
differentiation. Blood
102,2428
-2435.
Hirashima, M., Bernstein, A., Stanford, W. L. and Rossant,
J. (2004). Gene-trap expression screening to identify
endothelial-specific genes. Blood
104,711
-718.
His, W. (1900). Lecithoblast und Angioblast der Wirbelthiere. Abhandl. K. S. Ges. Wiss. Math. Phys. 22,171 -328.
Huber, T. L., Kouskoff, V., Fehling, H. J., Palis, J. and Keller, G. (2004). Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature 432,625 -630.[CrossRef][Medline]
Kabrun, N., Bühring, H.-J., Choi, K., Ullrich, A., Risau, W. and Keller, G. (1997). Flk-1 expression defines a population of early embryonic hematopoietic precursors. Development 124,2039 -2048.[Abstract]
Kallianpur, A. R., Jordan, J. E. and Brandt, S. J.
(1994). The SCL/TAL-1 gene is expressed in progenitors of both
the hematopoietic and vascular systems during embryogenesis.
Blood 83,1200
-1208.
Kennedy, M., Firpo, M., Choi, K., Wall, C., Robertson, S., Kabrun, N. and Keller, G. (1997). A common precurson for primitive erythropoiesis and definitive haematopoiesis. Nature 386,488 -493.[CrossRef][Medline]
Kubo, A., Chen, V., Kennedy, M., Zahradka, E., Daley, G. Q. and
Keller, G. (2005). The homeobox gene HEX regulates
proliferation and differentiation of hemangioblasts and endothelial cells
during ES cell differentiation. Blood
105,4590
-4597.
Lacaud, G., Gore, L., Kennedy, M., Kouskoff, V., Kingsley, P.,
Hogan, C., Carlsson, L., Speck, N., Palis, J. and Keller, G.
(2002). Runx1 is essential for hematopoietic commitment
at the hemangioblast stage of development in vitro.
Blood 100,458
-468.
Li, D. Y., Sorensen, L. K., Brooke, B. S., Urness, L. D., Davis,
E. C., Taylor, D. G., Boak, B. B. and Wendel, D. P. (1999).
Defective angiogenesis in mice lacking endoglin.
Science 284,1534
-1537.
Li, W., Ferkowicz, M. J., Johnson, S. A., Shelley, W. C. and Yoder, M. C. (2005). Endothelial cells in the early murine yolk sac give rise to CD41-expressing hematopoietic cells. Stem Cells Dev. 14,44 -54.[CrossRef][Medline]
McAllister, K. A., Grogg, K. M., Johnson, D. W., Gallione, C. J., Baldwin, M. A., Jackson, C. E., Helmbold, E. A., Markel, D. S., McKinnon, W. C., Murrell, J. et. al. (1994). Endoglin, a TGF-beta binding protein of endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat. Genet. 8, 345-351.[CrossRef][Medline]
Mikkola, H. K., Fujiwara, Y., Schlaeger, T. M., Traver, D. and
Orkin, S. H. (2003). Expression of CD41 marks the initiation
of definitive hematopoiesis in the mouse embryo. Blood
101,508
-516.
Mitjavila-Garcia, M. T., Cailleret, M., Godin, I., Nogueira, M. M., Cohen-Solal, K., Schiavon, V., Lecluse, Y., Pesteur, F. L., Lagrue, A. H. and Vainchenker, W. (2002). Expression of CD41 on hematopoietic progenitors derived from embryonic hematopoietic cells. Development 129,2003 -2013.[Medline]
Motoike, T., Markham, D. W., Rossant, J. and Sato, T. N. (2003). Evidence for novel fate of Flk1+ progenitor: contribution to muscle lineage. Genesis 35,153 -159.[CrossRef][Medline]
Muller, G., Behrens, J., Nussbaumer, U., Bohlen, P. and
Birchmeier, W. (1987). Inhibitory action of transforming
growth factor beta on endothelial cells. Proc. Natl. Acad. Sci.
USA 84,5600
-5604.
Murray, P. D. F. (1932). The development `in vitro' of blood of the early chick embryo. Proc. R. Soc. Lond. B Biol. Sci. 111,497 -521.
Nishikawa, S. I., Nishikawa, S., Kawamoto, H., Yoshida, H., Kizumoto, M., Kataoka, H. and Katsura, Y. (1998). In vitro generation of lymphohematopoietic cells from endothelial cells purified from murine embryos. Immunity 8, 761-769.[CrossRef][Medline]
Ohta, M., Greenberger, J. S., Anklesaria, P., Bassols, A. and Massague, J. (1987). Two forms of transforming growth factor-beta distinguished by multipotential haematopoietic progenitor cells. Nature 329,539 -541.[CrossRef][Medline]
Orkin, S. H. (1992). GATA-binding transcription
factors in hematopoietic cells. Blood
80,575
-581.
Park, C., Afrikanova, I., Chung, Y. S., Zhang, W. J., Arentson,
E., Fong, G. G., Rosendahl, A. and Choi, K. (2004). A
hierarchical order of factors in the generation of FLK1- and SCL-expressing
hematopoietic and endothelial progenitors from embryonic stem cells.
Development 131,2749
-2762.
Perlingeiro, R. C. R., Kyba, M., Bodie, S. and Daley, G. Q.
(2003). A role for thrombopoietin in hemangioblast development.
Stem Cells 21,272
-280.
Pierelli, L., Bonanno, G., Rutella, S., Marone, M., Scambia, G. and Leone, G. (2001). CD105 (endoglin) expression on hematopoietic stem/progenitor cells. Leuk. Lymphoma 42,1195 -1206.[Medline]
Robertson, S. M., Kennedy, M., Shannon, J. M. and Keller, G. (2000). A transitional stage in the commitment of mesoderm to hematopoiesis requiring the transcription factor SCL/tal-1. Development 127,2447 -2459.[Abstract]
Sabin, F. R. (1920). Studies on the origin of blood vessels and of red blood corpuscles as seen in the living blastoderm of chicks during the second day of incubation. Contrib. Embryol. 9,213 -262.
Schroeder, T., Fraser, S. T., Ogawa, M., Nishikawa, S., Oka, C.,
Bornkamm, G. W., Nishikawa, S., Honjo, T. and Just, U.
(2003). Recombination signal sequence-binding protein Jkappa
alters mesodermal cell fate decisions by suppressing cardiomyogenesis.
Proc. Natl. Acad. Sci. USA
100,4018
-4023.
Schuh, A. C., Faloon, P., Hu, Q. L., Bhimani, M. and Choi,
K. (1999). In vitro hematopoietic and endothelial potential
of flk-1(-/-) embryonic stem cells and embryos. Proc. Natl. Acad.
Sci. USA 96,2159
-2164.
Sing, G. K., Keller, J. R., Ellingsworth, L. R. and Ruscetti, F.
W. (1988). Transforming growth factor beta selectively
inhibits normal and leukemic human bone marrow cell growth in vitro.
Blood 72,1504
-1511.
Vittet, D., Prandini, M. H., Berthier, R., Schweitzer, A.,
Martin-Sisteron, H., Uzan, G. and Dejana, E. (1996).
Embryonic stem cells differentiate in vitro to endothelial cells through
successive maturation steps. Blood
88,3424
-3431.
Wang, Z., Cohen, K., Shao, Y., Mole, P., Dombkowski, D. and
Scadden, D. T. (2004). Ephrin receptor, EphB4, regulates ES
cell differentiation of primitive mammalian hemangioblasts, blood,
cardiomyocytes, and blood vessels. Blood
103,100
-109.
Willey, S., Ayuso-Sacido, A., Zhang, H., Fraser, S. T., Sahr, K.
E., Adlam, M. J., Kyba, M., Daley, G. Q., Keller, G. and Baron, M. H.
(2006). Acceleration of mesoderm development and expansion of
hematopoietic progenitors in differentiating ES cells by the mouse Mix-like
homeodomain transcription factor. Blood
107,3122
-3130.
Yamaguchi, T. P., Dumont, D. J., Conlon, R. A., Breitman, M. L. and Rossant, J. (1993). flk-1, an flt-related receptor tyrosine kinase is an early marker for endothelial cell precursors. Development 118,489 -498.[Abstract]
Yamashita, J., Itoh, H., Hirashima, M., Ogawa, M., Nishikawa, S., Yurugi, T., Naito, M., Nakao, K. and Nishikawa, S.-I. (2000). Flk1-positive cells derived from embryonic stem cells serve as vascular progenitors. Nature 408, 92-96.[CrossRef][Medline]
Young, P. E., Baumhueter, S. and Lasky, L. A.
(1995). The sialomucin CD34 is expressed on hematopoietic cells
and blood vessels during murine development. Blood
85, 96-105.
Zhang, W. J., Park, C., Arentson, E. and Choi, K.
(2005). Modulation of hematopoietic and endothelial cell
differentiation from mouse embryonic stem cells by different culture
conditions. Blood 105,111
-114.
This article has been cited by other articles:
![]() |
J. E. Pimanda, W. Y. I. Chan, N. K. Wilson, A. M. Smith, S. Kinston, K. Knezevic, M. E. Janes, J.-R. Landry, A. Kolb-Kokocinski, J. Frampton, et al. Endoglin expression in blood and endothelium is differentially regulated by modular assembly of the Ets/Gata hemangioblast code Blood, December 1, 2008; 112(12): 4512 - 4522. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||