|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 25 July 2007
doi: 10.1242/dev.005884
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Departments of Genetics, Washington University School of Medicine, 660 South
Euclid Avenue, St Louis, MO 63110, USA.
2 Departments of Pathology and Immunology, Washington University School of
Medicine, 660 South Euclid Avenue, St Louis, MO 63110, USA.
3 Departments of Medicine and Renal division, Washington University School of
Medicine, 660 South Euclid Avenue, St Louis, MO 63110, USA.
4 Departments of Molecular Biology and Pharmacology, Washington University
School of Medicine, 660 South Euclid Avenue, St Louis, MO 63110, USA.
5 Departments of Pediatrics, Washington University School of Medicine, 660 South
Euclid Avenue, St Louis, MO 63110, USA.
6 Departments of HOPE Center for Neurological Disorders, Washington University
School of Medicine, 660 South Euclid Avenue, St Louis, MO 63110, USA.
* Author for correspondence (e-mail: jmilbrandt{at}wustl.edu)
Accepted 22 June 2007
| SUMMARY |
|---|
|
|
|---|
Key words: PDS5, APRIN, Sister chromatid cohesion, Congenital defects, Cornelia de Lange syndrome, Primordial germ cells, Mouse
| INTRODUCTION |
|---|
|
|
|---|
50% of cases of Cornelia de Lange syndrome (CdLS). CdLS
patients present with a variety of developmental anomalies, including
dysmorphic facial features, mental retardation, growth delay, limb reduction,
genital anomalies and cardiac defects
(Deardorff et al., 2007
PDS5 is a regulatory component of cohesin and interacts genetically or
physically with the cohesion factors SCC2, ECO1, SMC1, SMC3, SCC1 and SCC3
(Losada et al., 2005
;
Tanaka et al., 2001
) to ensure
proper sister chromatid cohesion during mitosis and meiosis
(Hartman et al., 2000
;
Panizza et al., 2000
;
van Heemst et al., 1999
). The
N-terminal region of PDS5 contains several HEAT repeats, a motif that is
involved in protein-protein interactions and is present in other cohesin
subunits and regulatory factors (i.e. SCC2)
(Neuwald and Hirano, 2000
;
Panizza et al., 2000
). In
vertebrates, there are two homologs of PDS5, PDS5A and
PDS5B, that both contribute to cohesion dynamics
(Losada et al., 2005
).
Interestingly, in addition to its regulation of chromatid cohesion, PDS5 also
appears to directly regulate transcription of a number of developmental genes.
For example, similar to SCC2/NIPPED-B and SMC1, PDS5 regulates transcription
of the Drosophila cut gene during wing development
(Dorsett et al., 2005
). In
humans because PDS5B (also known as APRIN in human and
mouse) is located in a region where loss of heterozygosity is commonly
detected in tumors (13q12.3), it may act as a tumor suppressor
(Geck et al., 2000
).
Furthermore, PDS5B regulates androgen-induced differentiation of prostate
epithelial cells (Geck et al.,
2000
). Finally, lethality in yeast Pds5 mutants can be
rescued by overexpression of topoisomerase II, however, TOPII does not
compensate for the cohesion deficit in these mutants, indicating that PDS5 has
crucial functions in yeast beyond those related to chromosome cohesion
(Aguilar et al., 2005
).
To delineate physiological roles of PDS5B in mammals we generated Pds5B-deficient mice using homologous recombination. Loss of Pds5B results in a number of developmental defects, including dysmorphic facies, cleft palate, skeletal patterning and bone development defects, cardiac malformation, distal enteric nervous system (ENS) aganglionosis, abnormal autonomic nervous system formation, and depletion of primordial germ cells. Together, these results indicate that PDS5B and perhaps the cohesin complex itself is a critical regulator of multiple aspects of organogenesis. The association of CdLS with mutations in several different cohesion proteins and the constellation of developmental defects in Pds5B-/- mice indicate the widespread role of the cohesion factors in normal development, and provide a possible mechanism for their role in the pathogenesis of CdLS and related developmental disorders. As the first mouse model resembling CdLS, the Pds5B-deficient mice will be useful in delineating how PDS5B and cohesin regulate developmental processes.
| MATERIALS AND METHODS |
|---|
|
|
|---|
The Pds5B recombination construct encompasses genomic regions
surrounding the first coding exon. A 7.9 kb 5' arm upstream of the first
coding exon of Pds5B containing 20 nt of 5' UTR and a 6.3 kb
3' arm downstream of the first coding exon of Pds5B were
generated by PCR (See below for primer sequences) and cloned into pRS315 by
yeast gap repair (Le et al.,
2005
). The final targeting construct was generated using yeast gap
repair by co-transforming yeast with linearized 7.9 kb 5' arm in pRS315,
6.3 kb 3' arm in pRS315, the ß-gal-PGK-Neo
(ß-gal-Neo) cassette, and two adapters. Two adapters were
generated by annealing adapter forward and reverse primers and filled by
Herculase DNA polymerase (Stratagene). For cloning the 5' arm and
3' arm by gap repair, pRS315 was digested with SacI and
XhoI. For cloning the final target construct, 5' arm pRS315 and
3' arm pRS315 were digested with XhoI and MluI,
respectively. The final Pds5B recombination construct was confirmed
by sequencing analysis to ensure veracity of the Pds5B arm
regions.
The Pds5B targeting vector was linearized with KpnI and transfected by electroporation into R1 embryonic stem cells. Homologous recombinants were screened by Southern blot hybridization using a probe downstream of the 3' arm. Two properly targeted ES cell clones were injected into blastocysts to generate chimeric mice. The chimeras were mated and successful germline transmission of the targeted allele was detected by Southern blotting. Heterozygous mice grew normally and were mated to ß-actin Cre mice to remove the PGK-Neo cassette. The phenotypes of two independent lines (before or after excision of the PGK-Neo cassette) were similar. All animal procedures were performed according to our institutional approved protocols. Experiments were performed on mice from a mixed 129Sv/B6 background. The genotypes of Pds5B mutant mice were determined using Southern blotting or PCR using primers P1, P2, P3 (95°C 30 seconds, 58°C 60 seconds, 72°C 90 seconds; 35 cycles). Wild-type and mutant alleles were amplified with P1-P2 (390 nt amplicon) and P1-P3 (450 nt amplicon) primer pairs, respectively. (See below for primer sequences.)
Primers, containing Pds5B genomic and associated pRS315 sequences, used for PCR amplification of the 5' arm and 3' arm of the targeting construct were as follows:
5' arm forward primer: TTAATGCGCCGCTACAGGGCGCGTCACGCGTCTGTGCTGGAGCTCACATGACCTGTCCT; 5' arm reverse primer: ACAGCTATGACCATGATTACGCCAACTCGAGGATGGAAATGTCTGTACCCCTAAAGCAAGAAAA; 3' arm forward primer: TTAATGCGCCGCTACAGGGCGCGTCACGCGTCAGTGTATGCTGCAGACAGCTGGGCAGTT; 3' arm reverse primer: ACAGCTATGACCATGATTACGCCAACTCGAGCAGCCTGGTTTGCAGAGAGTTCTAGCACA.
Primers used to generate adapters for the final targeting construct using yeast gap repair:
Adapter 1 forward primer: GATCCCCCAAGCTTACT TAG ATCTCGAGCTAGCACGCGTGATGGAAATG; adapter 1 reverse primer: TTTTCTTGCTTTAGGGGTACAGACATTTCCATCACGCGTGCTAGC. Adapter 2 forward primer: ATACATTATACGAAGTTATAC CGGTTAATTAAGGGCTCGAGCTAGCGGGCCC; Adapter 2 reverse primer: CACACAAACTGCCCAGCTGTCTGCAGCATACACTGGGGCCCGCTAGCTCGAGCCCTTAA.
Primers used to genotype Pds5B mutant mice: P1, CCAGACCTGAAGAATTGGTGGAGGA;P2,ACCCTCCTGGAGTCAAGGAAA; P3, ACCCTCCTGGAGTCAAGGAAA.
Generation of polyclonal antibody against mouse PDS5B
Rabbit anti-PDS5B polyclonal antibodies were raised using C-terminal
peptide immunogen NH2-CATKENDSSEEMDV-COOH (Pacific Immunology, CA, USA). The
same peptide was crosslinked to a solid support by using SulfoLink coupling
Gel (Pierce Biotechnology, IL, USA) and used for affinity purification of
antibodies from serum.
Immunohistochemistry and western blot analysis
Tissues used in immunohistochemistry were fixed in paraformaldehyde or
Bouin's fixative. For antigen retrieval, paraffin-embedded sections were
deparaffinized in xylene, hydrated and boiled in 1 mM EDTA solution for 30
minutes prior to immunostaining (Jain et
al., 2004
; Naughton et al.,
2006
). Primary antibodies used in this study include sheep
tyrosine hydroxylase (TOH; Chemicon), rabbit neuron-specific class III
ß-tubulin (TuJ1; Covance), rat GCNA1 (George C. Enders, PhD, University
of Kansas Medical Center, Kansas City, KS, USA), mouse BrdU (Roche), which
were visualized using donkey anti-sheep HRP (Jackson ImmunoResearch), donkey
anti-rabbit Alexa Fluor 488 (1:100; Molecular Probes), goat anti-rat Cy3
(Jackson ImmunoResearch), or goat anti-mouse Alexa Fluor 488 (Molecular
Probes) secondary antibodies. Bisbenzimide (2 µg/ml; Sigma) was used for
nuclear staining.
Western blot analysis was performed using standard techniques using proteins derived from embryonic day (E) 14.5 forelimbs. The limbs were lysed in 2x SDS protein lysis buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, 1x protease inhibitor cocktail; Roche). The western blots were probed with rabbit anti-PDS5B antibody (1:500 dilution) and PDS5B was visualized using chemiluminescence substrate (Pierce). For a loading control, mouse anti-ß-tubulin antibody (DSHB, University of Iowa, IA, USA) was also used at 1:20,000 dilution.
Histological analysis of bone and palate
Alizarin Red S and Alcian Blue staining of newborn mice was performed as
previously described (Wellik and Capecchi,
2003
). Briefly, newborn mice were skinned and dehydrated in 95%
ethanol. They were then stained in Alcian Blue solution for 3 days, rehydrated
and incubated in 1% KOH for 2 days, and stained with Alizarin Red S for 3
days. Embryonic and newborn heads were fixed in 4% paraformaldehyde at 4°C
for 16 hours. The fixed heads were properly oriented in paraffin, coronal
sections were prepared, sections were stained with Hematoxylin and Eosin
(H&E) and examined microscopically for evidence of cleft palate.
Analysis of cardiac malformations
The thoraxes of newborn mice was fixed in 4% formaldehyde before the heart
was dissected free and embedded in paraffin. Entire neonatal hearts were
serially sectioned at 6 µm thickness, stained with H&E, and inspected
for defects. Two people (J.M.E. and P.Y.J.) examined the set of sections from
every heart under a 5x microscope objective. The two examiners
independently made the same diagnosis for every heart in this study.
Peripheral nervous system analysis
For analysis of the enteric nervous system, the E12.5 or E18.5 whole gut
was dissected from the mouse and fixed with 4% paraformaldehyde at 25°C
for 30 minutes. After fixation, explants were washed three times in TBST (1 mM
Tris, 150 mM NaCl, 0.2% Triton X-100) and blocked with 4% donkey serum in TBST
(1 hour, 25°C) before incubation with primary antibody (4°C,
overnight) in TBST. Primary antibody (rabbit anti-Tuj1, 1:100; Covance)
staining was visualized using donkey anti-rabbit Alexa Fluor 488 (1:100;
Molecular Probes) secondary antibody after washing three times with TBST
(Fu et al., 2006
). For
cross-sectional analysis, post-natal day (P)0 gut was fixed in 4%
paraformaldehyde and embedded in paraffin. Paraffin sections were stained with
anti-Tuj1 (rabbit; Covance; 1:500) and visualized using goat anti-rabbit Cy3
(1:500; Jackson ImmunoResearch). P0 gut staining with acetylcholinesterase and
analysis of the percentage of distal colon colonized by ENS precursors was
performed as previously described (Jain et
al., 2004
).
The sympathetic nervous system of embryos and newborns was analyzed using
whole-mount TOH immunohistochemistry as described previously
(Enomoto et al., 2001
).
Analysis of germ cells
Embryonic gonads were dissected, fixed in Bouin's solution overnight at
4°C, embedded in paraffin, and 6 µm sections were prepared. Primordial
germ cells were examined by H&E staining, alkaline phosphatase
histochemistry, or GCNA1 immunohistochemistry. For germ cell identification,
anti-GCNA1 antibody (1:200, rat polyclonal) was used, whereas Sertoli cells
were identified using anti-GATA4 antibody (1:200, goat Sertoli cells
polyclonal; Santa Cruz Biotechnology)
(Naughton et al., 2006
).
For BrdU and GCNA1 double immunostaining, timed pregnant females were
injected with 200 mg/kg body weight BrdU 2 hours prior to sacrifice
(Jain et al., 2004
).
Paraffin-embedded sections of embryonic testis were incubated with BrdU
primary antibody (1: 200; Roche) and visualized using goat anti-mouse
immunoglobulin labeled with Alexa Fluor 488 (1:500; Molecular Probes)
secondary antibody, followed by staining with GCNA1 (1:200) and goat anti-rat
immunoglobulin labeled with Cy3 (1:500, Jackson ImmunoResearch). TUNEL was
performed as previously described (Jain et
al., 2004
).
Testes transplantation
Testes from E16.5 mutant and wild-type mice were transplanted
subcutaneously onto the back and/or flank of castrated 4- to 8-week-old male
nude mice (Taconic No. NCRNUM, Germantown, NY, USA) as previously described
(Honaramooz et al., 2002
). The
grafted donor testes were harvested and processed for histological evaluation
at the indicated time points.
Metaphase spread analysis
Chromosome analysis was performed in the Chromosome Analysis Laboratory at
University of Southern California directed by Chih-Lin Hsieh, PhD. Mouse
embryonic fibroblasts from wild-type and Pds5B mutant mice (passage
3) were cultured in DMEM with 10% fetal bovine serum. Chromosomes were
harvested the day after plating after growth for 1 hour in colcemid (1
µg/ml) using standard hypotonic (0.075 M KCl) treatment and fixed in
methanol:acetic acid (3:1). Slides were prepared and chromosomes were analyzed
using the Geimsa-trypsin-Wrights (GTW) banding method. Two cells were fully
analyzed from each line, and all were found to have normal karyotypes.
Twenty-two to 25 cells were examined for precocious sister chromatid
separation (PSCS). To avoid selection bias, the first 22-25 metaphases
encountered were included in the analysis regardless of the length of the
chromosomes or differences in the quality of banding.
In situ hybridization
Mouse cDNA fragments corresponding to Pds5B (probe 1: nt 2903-3438
and probe 2: nt 4561-5098) were generated by RT-PCR and cloned into the
BamHI and HindIII sites of pBluescript II KS+ vector. Sense
or antisense 35S-labeled cRNA probes were generated from these
Pds5B fragments and in situ hybridization was performed as previously
described (Song et al., 2002
).
Frozen sections (12 µm) were mounted on poly-L-lysine-coated slides, fixed
in cold 4% paraformaldehyde in PBS, acetylated and hybridized at 45°C for
4 hours in hybridization buffer containing the 35S-labeled
antisense cRNA probes. After hybridization, the sections were treated with
RNase A (20 µg/ml) at 37°C for 20 minutes. RNase A-resistant hybrids
were detected by autoradiography. Sections hybridized with the sense probes
served as negative controls.
Quantitative RT-PCR
RNA was prepared from mouse adult and embryonic tissues using Trizol
(Invitrogen) and quantified by the Ribogreen fluorometric assay (Molecular
Probes). Reverse transcription was performed using M-MLV reverse transcriptase
(Invitrogen) and oligo(dT) and random hexamers as primers. qRT-PCR was
performed using a Model 7700 instrument (Applied Biosystems) using
Sybr Green I fluorescence (Molecular Probes) as described previously
(Svaren et al., 2000
). Target
genes were analyzed using standard curves to determine relative levels of gene
expression. Individual RNA samples were normalized according to the levels of
GAPDH or 18S mRNA. (See below for primer sequences.)
Primers used for qRT-PCR analysis: mouse Pds5B, ACCCTCCTGGAGTCAAGGAAA and CAGAGTCCTGGTCCAT GT CCAT; mouse GAPDH, TGCCCCCATGTTTGTGATG and TGTGG TCATGAGCCCTTCC; mouse 18S ribosomal RNA, CGGCTA CCA CATCCAAGGAA and GCTGGAATTACCGCGGCT.
Plasmids and cell culture
Flag-tagged human PDS5A in pCR3.1 expression vector and
the human PDS5B (KIAA0979) cDNA were gifts from Kasid Usha
(Georgetown University, DC, USA) and Kazusa DNA Research Institute (Chiba,
Japan), respectively. To generate the carboxyl-terminal EGFP-PDS5B fusion
protein, KIAA0979 was digested with BamHI and EcoRI, blunted
with Klenow, and cloned into the blunted XhoI site in pEGFP-C1
(Clontech). The EGFP-FLAG-PDS5A fusion protein was generated by digesting the
Flag-PDS5A construct with PmeI and inserting this fragment
into the blunted BglII site of pEGFP-C1. HeLa cells were cultured in
DMEM with 10% fetal bovine serum. Transient expression of EGFP-tagged PDS5A
and PDS5B was achieved using Lipofectamine-mediated transfection of
plasmids.
| RESULTS |
|---|
|
|
|---|
The expression of PDS5B, a regulatory factor of cohesin, in post-mitotic as well as dividing cells, suggested that it participates in multiple processes in mammals. Therefore, to determine its physiological roles in mice, we generated Pds5B null mice by homologous recombination (Fig. 1E-G). To confirm the absence of Pds5B expression in the homozygous Pds5B mice, we quantified Pds5B mRNA in E14.5 Pds5B-/- brain and examined PDS5B levels in Pds5B-/- limbs by western blotting using PDS5B antibodies. We did not detect Pds5B mRNA or protein (Fig. 1H,I; see Fig. S1 in the supplementary material) in embryos homozygous for the mutant Pds5B allele, indicating that it is a true null allele. Pds5B-/- embryos were present at the expected Mendelian ratio until age E16.5. However, only about 75% of the expected number of Pds5B-/- fetuses were born alive and none of the mice homozygous for the mutant Pds5B allele survived beyond P1. The newborn animals had signs of respiratory distress, including labored breathing, use of accessory muscles of respiration as indicated by head bobbing and intercostal and abdominal retractions, cyanosis and pallor. They all died shortly after birth, most probably from cardiac and/or respiratory abnormalities (see below).
Pds5B deficiency results in growth retardation, abnormal skeletal patterning and cleft palate
Wild-type and Pds5B-/- mutant embryos were of similar
size until E16.5, but then the mutants began to show signs of growth
retardation. Newborn Pds5B-/- mice were smaller than their
wild-type littermates, and had short stature, short limbs, a small head and
facial dysmorphisms (short snout, short low chin and thin upper lip;
Fig. 2A-C,K). These
abnormalities, which are similar to those reported for CdLS patients, along
with the fact that mutations in other cohesion proteins are associated with
CdLS, suggested to us that the Pds5B-deficient mice could be a
valuable model of this developmental syndrome. To substantiate this idea, we
searched for other abnormalities in Pds5B-/- mice that are
commonly found in patients with CdLS.
|
Another developmental abnormality observed in some children with CdLS is cleft palate. An examination of this region in Pds5B-/- mice revealed a complete cleft of the secondary palate (Fig. 2J,K) and failure of the posterior palatal bones to extend fully and meet at the midline (Fig. 2L,M; WT: 0/24; Pds5B-/-: 25/33). To further characterize the dysmorphogenesis of the palatal shelves in Pds5B mutant embryos, we examined the palatal shelves of wild-type and Pds5B-/- embryos at E12.5, E14.5 and E18.5. Whereas palatal shelves (PS) in Pds5B-/- embryos were seemingly normal at E12.5 (Fig. 2N,Q), by E14.5 they were clearly abnormal (Fig. 2O,R). In E18.5 wild-type embryos, the medial-edge epithelia of the two PS have normally fused and then degenerated (Fig. 2P), however, the PS of E18.5 Pds5B-/- embryos were shorter and failed to fuse (Fig. 2S). Using BrdU and TUNEL analysis on E13.5 embryonic palates, we did not observe significant changes in cell proliferation or apoptosis in palatal shelves of Pds5B-/- embryos compared to WT or Pds5B+/- embryos (see Fig. S2 in the supplementary material). The cleft palate observed in Pds5B-/- mice could be the result of abnormal reorientation of palatal shelves or failure of epithelial-mesenchymal transition of medial edge epithelia at a later stage. Clearly, cleft palate is a distinctive feature of Pds5B-/- mice and could cause aspiration and subsequent asphyxiation, thus contributing to the neonatal lethality of these mice.
|
PDS5B-deficiency causes abnormal peripheral nervous system development
The high expression of Pds5B in post-mitotic neurons, the role of
other cohesion components such as Mau-2 in axonal guidance and
neuronal migration, and the profound mental retardation associated with CdLS,
encouraged us to examine the nervous system in Pds5B-/-
mice. Consistent with clinical reports showing that CdLS patients have
relatively normal brain anatomy, we did not observe any gross or microscopic
structural abnormalities in the brain of Pds5B-deficient mice. This
suggests that the cohesin complex does not play a major role in CNS
development; instead, it may influence neuronal function or connectivity.
Unfortunately, the neonatal lethality of Pds5B-/- mice
currently prevents us from further examining this hypothesis.
An examination of the peripheral nervous system revealed that the
sympathetic chain ganglia were well developed with neuronal projections
appearing normal in Pds5B-/- mice (see Fig. S3 in the
supplementary material). We also examined the superior cervical ganglia (SCG),
which provides sympathetic innervation to the ocular muscles. Abnormalities in
the SCG are associated with ptosis, a common condition in CdLS. We found a
number of abnormalities in the SCG and its projections to target organs in the
Pds5B-/- mice (Fig.
4A). For example, in 40% (5/13) of Pds5B-/-
mice, the SCG was located far caudal of its normal position
(Fig. 4B,C). Furthermore, all
Pds5B-/- mice had thin carotid nerves
(Fig. 4D,E) and 30% (4/13) of
these mice had unilateral or bilateral absence of the carotid nerve
(Fig. 4F,G). These SCG defects
are similar to those observed in mice deficient for the neurotrophic factor
artemin, which commonly manifest unilateral or bilateral ptosis
(Honma et al., 2002
). These
results suggest that SCG innervation defects are the likely cause of the
ptosis observed in many CdLS patients
(Jackson et al., 1993
).
|
To determine if the enteric neuron defects occur because of delayed
migration of NCCs into the colon, we examined the ENS at E18.5 and P0 using
the Tuj1 antibody, which recognizes a neuronal form of tubulin, or
acetylcholinesterase (AchE) staining (Fig.
4J-M; see Fig. S3 in the supplementary material). As expected,
enteric neurons colonize the entire length of the wild-type neonatal bowel
(Fig. 4J,L), whereas 70% (8/12)
of Pds5B-/- mice exhibited variable degrees of abnormal
innervation and ganglion formation in the distal colon
(Fig. 4K,M). By contrast, small
bowel innervation appeared grossly normal in Pds5B-/- mice
(data not shown). Thus, the majority of Pds5B-/- mice had
significant defects in the distal enteric nervous system that resemble
Hirschsprung disease in humans. This contrasts with CdLS where distal colonic
aganglionosis has not been reported, but where other gastrointestinal problems
including persistent emesis and feeding problems are common, occurring in 62%
and 77%, respectively, of infants with CdLS
(Jackson et al., 1993
). These
observations suggest that defects in the ENS such as hypoganglionosis may
underlie the gastrointestinal symptoms of CdLS patients.
PDS5B regulates primordial germ cell proliferation
The high expression of Pds5B in adult and embryonic testis, the
role of PDS5 in mitosis and meiosis in lower organisms, and the high frequency
of genital anomalies seen in people with CdLS, encouraged us to examine germ
cell development in Pds5B-/- mice. We found a severely
reduced number of germ cells in testes and ovaries of newborn
Pds5B-/- mice (Fig.
5A-D; see Fig. S4 in the supplementary material) that appeared to
be more severe in males. We therefore focused on male germ cell development to
further investigate mechanisms underlying germ cell depletion. At E16.5,
Pds5B-/- male mice had an 80% reduction in germ cells in
the testis (Fig. 5E,F,I). To
determine if the remaining germ cells could undergo spermatogenesis, we
performed testis transplantation to propagate E16.5 testis of wild-type and
Pds5B-/- mice as explants in nude mice
(Naughton et al., 2006
). Using
GCNA1 immunohistochemistry, we found a complete depletion of spermatogonial
stem cells at 2 weeks after transplantation
(Fig. 5G,H). By 6 weeks after
transplantation, the explanted Pds5B-/- testes contained
testicular cords that only contained Sertoli cells (see Fig. S4 in the
supplementary material). The Pds5B-/- Sertoli cells were
morphologically normal as determined by GATA4 immunohistochemistry (data not
shown). These studies indicate that the germ cells remaining at E16.5 in
Pds5B-/- mice were incapable of sustaining
spermatogenesis.
The embryonic loss of germ cells at E16.5 in Pds5B-deficient mice
suggested that PDS5B is important for primordial germ cell (PGC) development.
PGCs are derived from a founder population of
45 cells in the
extraembryonic mesoderm posterior to the primitive streak around E7.25
(Ginsburg et al., 1990
). These
cells migrate to the genital ridge by E11.5
(Gomperts et al., 1994
), and
continue proliferating until E13.5 in males
(McLaren, 2000
). To identify
the mechanism underlying the reduced number of germ cells in male
Pds5B-/- mice, we evaluated the migration, proliferation
and apoptosis of these germ cell precursors. At E12.5, a time point when PGCs
enter the genital ridge, there were already significantly fewer numbers of
germ cells in the Pds5B-/- mice. We hypothesized that
overt migration defects in Pds5B-/- PGCs would result in
failure of these precursors to reach the genital ridge by E11.5. However,
alkaline phosphatase staining of E10.5 gonads to identify PGCs revealed no
significant differences in PGC location between wild-type and
Pds5B-/- embryos (data not shown), indicating that PGC
migration at this early stage must be relatively normal. In addition, TUNEL
analysis revealed no changes in the number of apoptotic germ cells in E12.5 or
E16.5 mutant embryos (data not shown). However, when we examined germ cell
proliferation in E12.5 embryos using BrdU incorporation, we found a 30%
reduction in the number of BrdU-positive germ cells in testes of
Pds5B-/- versus wild-type mice
(Fig. 5J; see Fig. S4 in the
supplementary material). Although it is possible that germ cell depletion
could be partially due to apoptosis or delayed migration at stages in
development that we did not examine, it is clear that the reduced
proliferation is a major factor in the reduced number of germ cells.
|
|
|
There are two PDS5 homologs in vertebrates
(Losada et al., 2005
). The
N-terminal regions of these proteins both contain HEAT repeats and are closely
related, but PDS5A lacks the AT hook domains present in the C-terminal region
of PDS5B. Despite their similarity, the severe abnormalities caused by PDS5B
deficiency clearly show that PDS5A cannot compensate for at least some of the
physiologic roles of PDS5B. We investigated whether their distinct cellular
functions could stem, at least in part, from differential subcellular
localization of these two proteins. We generated EGFP-tagged PDS5A and PDS5B
fusion proteins and determined their subcellular localization in interphase
cells using fluorescence microscopy. Whereas both PDS5A and PDS5B were found
in the nucleus, PDS5B appeared to be more concentrated in the nucleolus than
in the rest of the nucleus. By contrast, PDS5A was less abundant in the
nucleolus than in the rest of the nucleus
(Fig. 6D).
| DISCUSSION |
|---|
|
|
|---|
In this work, we generated mice deficient in Pds5B, a sister
chromatid cohesion factor. These mice manifest a spectrum of developmental
defects similar to those found in human CdLS, including abnormal skeletal
patterning, cardiac anomalies and cleft palate. Other phenotypes that are
associated with CdLS such as mental retardation, hearing loss and
gastroesophageal reflex are difficult to evaluate in this animal model
particularly since Pds5B-/- mice are not viable past P0.
However, the striking defects in the enteric and autonomic nervous systems of
these mice may be related to the frequent occurrence of ptosis and
gastrointestinal problems in CdLS patients. Because of significant phenotypic
overlap in Pds5B-/- mice and people with CdLS
(Table 1), and the fact that
mutations in other cohesion factors have been identified in CdLS patients, we
believe that Pds5B-/- mice represent the first mouse model
resembling human Cornelia de Lange syndrome. In fact, the broad spectrum of
symptoms with incomplete penetrance and variable expressivity in these mice is
also a feature typically observed in CdLS. These studies and the previously
known association of mutations in other cohesion factors and CdLS suggest that
screening CdLS patients for PDS5B mutations is warranted.
PDS5B mutations, unless they produce dominant negative mutants, may
be rare because they would be recessive and most CdLS cases are dominantly
inherited (Krantz et al.,
2004
; Tonkin et al.,
2004
), and because they may result in lethality unless they are
hypomorphic.
|
An alternative explanation for the absence of sister chromatid cohesion
defects in Pds5B-/- mice could be redundancy with its
homolog PDS5A (Losada et al.,
2005
). Physiological evidence for this will require generation of
Pds5A-/- animals, but our preliminary studies indicate
significant overlap in PDS5A and PDS5B mRNA expression (B.Z. and J.M.
unpublished observations). Indeed, we found overlapping expression in a number
of organ systems where Pds5B-/- mice manifest
developmental defects, suggesting differential sensitivity to PDS5B loss in
various organs or perhaps reflecting differences in subcellular localization
(and function) of these two closely related proteins.
Both PDS5A and PDS5B have previously been reported to be localized in the
nucleus by immunohistochemistry (Kumar et
al., 2004
; Maffini et al.,
2002
). In these studies, we found that PDS5B is localized to the
nucleus with higher levels in the nucleolus. Interestingly, PDS5B lacking the
C-terminal 142 residues containing the second AT hook motif was localized to
the nucleus but was not concentrated in the nucleolus (B.Z. and J.M.,
unpublished observation), suggesting that this domain may contribute to its
nucleolar localization. Nucleolar localization of PDS5B indicates that PDS5B
and/or cohesin complexes containing PDS5B could regulate rRNA metabolism and
ribosome biogenesis. Interestingly, other cohesion proteins (e.g. NIPBL and
SMC1A) have also been detected in nucleoli
(Andersen et al., 2005
), and
yeast PDS5 can interact with NIP7 and NOP7, both of
which are involved in ribosomal RNA (rRNA) biosynthesis
(Davierwala et al., 2005
;
Krogan et al., 2006
). Further
evidence of cohesion protein involvement in ribosomal biogenesis comes from
studies in yeast, where an additional copy of NOG2, which encodes a
GTPase required for 60S ribosomal subunit maturation, is able to suppress the
defects caused by mutation of the cohesin protein Scc3
(Bialkowska and Kurlandzka,
2002
). In addition, the cohesin complex is recruited by Sir2 to
silenced chromatin in the rDNA loci to maintain rDNA repeat copy number
(Kobayashi et al., 2004
).
Finally, normal development can be disrupted by defects in rRNA metabolism, a
process largely confined to the nucleolus. For example, Tcof1, which
encodes a nucleolar protein, is mutated in Treacher Collins syndrome, an
autosomal dominant disorder of craniofacial development
(Dixon et al., 2006
).
Haploinsufficiency of Tcof1 in mice causes a reduction of mature
ribosomes that results in deficient neural crest cell migration and
proliferation that leads to craniofacial abnormalities, including cleft palate
and mandibular hypoplasia (Dixon et al.,
2006
). Deficits in the nucleolar functions of cohesion proteins
could also contribute to the abnormalities observed in patients with CdLS or
related diseases.
In summary, we have discovered that the cohesion protein PDS5B is a critical regulator of multiple aspects of organogenesis, probably via roles unrelated to its ancient function in sister chromatid cohesion. This Pds5B-deficient mouse provides the first mammalian model to study the molecular mechanisms of developmental functions of the cohesin complex and the pathogenesis of CdLS and related disorders with mutations in cohesion factors.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/17/3191/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aguilar, C., Davidson, C., Dix, M., Stead, K., Zheng, K., Hartman, T. and Guacci, V. (2005). Topoisomerase II suppresses the temperature sensitivity of Saccharomyces cerevisiae pds5 mutants, but not the defect in sister chromatid cohesion. Cell Cycle 4,1294 -1304.[Medline]
Andersen, J. S., Lam, Y. W., Leung, A. K., Ong, S. E., Lyon, C. E., Lamond, A. I. and Mann, M. (2005). Nucleolar proteome dynamics. Nature 433,77 -83.[CrossRef][Medline]
Benard, C. Y., Kebir, H., Takagi, S. and Hekimi, S.
(2004). mau-2 acts cell-autonomously to guide axonal migrations
in Caenorhabditis elegans. Development
131,5947
-5958.
Bialkowska, A. and Kurlandzka, A. (2002). Additional copies of the NOG2 and IST2 genes suppress the deficiency of cohesin Irr1p/Scc3p in Saccharomyces cerevisiae. Acta Biochim. Pol. 49,421 -425.[Medline]
Davierwala, A. P., Haynes, J., Li, Z., Brost, R. L., Robinson, M. D., Yu, L., Mnaimneh, S., Ding, H., Zhu, H., Chen, Y. et al. (2005). The synthetic genetic interaction spectrum of essential genes. Nat. Genet. 37,1147 -1152.[CrossRef][Medline]
Deardorff, M. A., Kaur, M., Yaeger, D., Rampuria, A., Korolev, S., Pie, J., Gil- Rodriguez, C., Arnedo, M., Loeys, B., Kline, A. D. et al. (2007). Mutations in cohesin complex members SMC3 and SMC1A cause a mild variant of cornelia de Lange syndrome with predominant mental retardation. Am. J. Hum. Genet. 80,485 -494.[CrossRef][Medline]
Dixon, J., Jones, N. C., Sandell, L. L., Jayasinghe, S. M.,
Crane, J., Rey, J. P., Dixon, M. J. and Trainor, P. A.
(2006). Tcof1/Treacle is required for neural crest cell formation
and proliferation deficiencies that cause craniofacial abnormalities.
Proc. Natl. Acad. Sci. USA
103,13403
-13408.
Dorsett, D. (2007). Roles of the sister chromatid cohesion apparatus in gene expression, development, and human syndromes. Chromosoma 116, 1-13.[CrossRef][Medline]
Dorsett, D., Eissenberg, J. C., Misulovin, Z., Martens, A.,
Redding, B. and McKim, K. (2005). Effects of sister
chromatid cohesion proteins on cut gene expression during wing development in
Drosophila. Development
132,4743
-4753.
Enomoto, H., Crawford, P. A., Gorodinsky, A., Heuckeroth, R. O., Johnson, E. M., Jr and Milbrandt, J. (2001). RET signaling is essential for migration, axonal growth and axon guidance of developing sympathetic neurons. Development 128,3963 -3974.[Medline]
Fu, M., Vohra, B. P., Wind, D. and Heuckeroth, R. O. (2006). BMP signaling regulates murine enteric nervous system precursor migration, neurite fasciculation, and patterning via altered Ncam1 polysialic acid addition. Dev. Biol. 299,137 -150.[CrossRef][Medline]
Geck, P., Maffini, M. V., Szelei, J., Sonnenschein, C. and Soto,
A. M. (2000). Androgen-induced proliferative quiescence in
prostate cancer cells: the role of AS3 as its mediator. Proc. Natl.
Acad. Sci. USA 97,10185
-10190.
Ginsburg, M., Snow, M. H. and McLaren, A.
(1990). Primordial germ cells in the mouse embryo during
gastrulation. Development
110,521
-528.
Gomperts, M., Garcia-Castro, M., Wylie, C. and Heasman, J. (1994). Interactions between primordial germ cells play a role in their migration in mouse embryos. Development 120,135 -141.[Abstract]
Hartman, T., Stead, K., Koshland, D. and Guacci, V.
(2000). Pds5p is an essential chromosomal protein required for
both sister chromatid cohesion and condensation in Saccharomyces cerevisiae.
J. Cell Biol. 151,613
-626.
Honaramooz, A., Snedaker, A., Boiani, M., Scholer, H., Dobrinski, I. and Schlatt, S. (2002). Sperm from neonatal mammalian testes grafted in mice. Nature 418,778 -781.[CrossRef][Medline]
Honma, Y., Araki, T., Gianino, S., Bruce, A., Heuckeroth, R., Johnson, E. and Milbrandt, J. (2002). Artemin is a vascular-derived neurotropic factor for developing sympathetic neurons. Neuron 35,267 -282.[CrossRef][Medline]
Ireland, M., Donnai, D. and Burn, J. (1993). Brachmann-de Lange syndrome. Delineation of the clinical phenotype. Am. J. Med. Genet. 47,959 -964.[CrossRef][Medline]
Jackson, L., Kline, A. D., Barr, M. A. and Koch, S. (1993). de Lange syndrome: a clinical review of 310 individuals. Am. J. Med. Genet. 47,940 -946.[CrossRef][Medline]
Jain, S., Naughton, C. K., Yang, M., Strickland, A., Vij, K.,
Encinas, M., Golden, J., Gupta, A., Heuckeroth, R., Johnson, E. M., Jr et
al. (2004). Mice expressing a dominant-negative Ret mutation
phenocopy human Hirschsprung disease and delineate a direct role of Ret in
spermatogenesis. Development
131,5503
-5513.
Kaur, M., DeScipio, C., McCallum, J., Yaeger, D., Devoto, M., Jackson, L. G., Spinner, N. B. and Krantz, I. D. (2005). Precocious sister chromatid separation (PSCS) in Cornelia de Lange syndrome. Am. J. Med. Genet. A 138, 27-31.[Medline]
Kimura, K. and Hirano, T. (2000). Dual roles of
the 11S regulatory subcomplex in condensin functions. Proc. Natl.
Acad. Sci. USA 97,11972
-11977.
Kobayashi, T., Horiuchi, T., Tongaonkar, P., Vu, L. and Nomura, M. (2004). SIR2 regulates recombination between different rDNA repeats, but not recombination within individual rRNA genes in yeast. Cell 117,441 -453.[CrossRef][Medline]
Krantz, I. D., McCallum, J., DeScipio, C., Kaur, M., Gillis, L. A., Yaeger, D., Jukofsky, L., Wasserman, N., Bottani, A., Morris, C. A. et al. (2004). Cornelia de Lange syndrome is caused by mutations in NIPBL, the human homolog of Drosophila melanogaster Nipped-B. Nat. Genet. 36,631 -635.[CrossRef][Medline]
Krogan, N. J., Cagney, G., Yu, H., Zhong, G., Guo, X., Ignatchenko, A., Li, J., Pu, S., Datta, N., Tikuisis, A. P. et al. (2006). Global landscape of protein complexes in the yeast Saccharomyces cerevisiae. Nature 440,637 -643.[CrossRef][Medline]
Kumar, D., Sakabe, I., Patel, S., Zhang, Y., Ahmad, I., Gehan, E. A., Whiteside, T. L. and Kasid, U. (2004). SCC-112, a novel cell cycle-regulated molecule, exhibits reduced expression in human renal carcinomas. Gene 328,187 -196.[CrossRef][Medline]
Le, N., Nagarajan, R., Wang, J. Y., Araki, T., Schmidt, R. E.
and Milbrandt, J. (2005). Analysis of congenital
hypomyelinating Egr2Lo/Lo nerves identifies Sox2 as an inhibitor of Schwann
cell differentiation and myelination. Proc. Natl. Acad. Sci.
USA 102,2596
-2601.
Losada, A., Yokochi, T. and Hirano, T. (2005).
Functional contribution of Pds5 to cohesin-mediated cohesion in human cells
and Xenopus egg extracts. J. Cell Sci.
118,2133
-2141.
Maffini, M. V., Geck, P., Powell, C. E., Sonnenschein, C. and
Soto, A. M. (2002). Mechanism of androgen action on cell
proliferation: AS3 protein as a mediator of proliferative arrest in the rat
prostate. Endocrinology
143,2708
-2714.
Maher, J. F. and Nathans, D. (1996).
Multivalent DNA-binding properties of the HMG-1 proteins. Proc.
Natl. Acad. Sci. USA 93,6716
-6720.
McLaren, A. (2000). Germ and somatic cell lineages in the developing gonad. Mol. Cell. Endocrinol. 163,3 -9.[CrossRef][Medline]
Musio, A., Selicorni, A., Focarelli, M. L., Gervasini, C., Milani, D., Russo, S., Vezzoni, P. and Larizza, L. (2006). X-linked Cornelia de Lange syndrome owing to SMC1L1 mutations. Nat. Genet. 38,528 -530.[CrossRef][Medline]
Nasmyth, K. and Haering, C. H. (2005). The structure and function of SMC and kleisin complexes. Annu. Rev. Biochem. 74,595 -648.[CrossRef][Medline]
<