|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 29 August 2007
doi: 10.1242/dev.005868
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Wolfson Institute for Biomedical Research and Department of Biology,
University College London, Gower Street, London WC1E 6BT, UK.
2 Department of Pediatric Oncology, Dana-Farber Cancer Institute, Dana 640D, 44
Binney Street, Boston, MA 02115, USA.
3 Center for Advanced Biotechnology and Medicine, UMDNJ-Robert Wood Johnson
Medical School, 679 Hoes Lane, Piscataway, NJ 08854, USA.
4 Center for Neurologic Diseases, Brigham and Women's Hospital, Program in
Neuroscience, Harvard Medical School, 77 Avenue Louis Pasteur, Boston, MA
02115, USA.
Author for correspondence (e-mail:
w.richardson{at}ucl.ac.uk)
Accepted 25 July 2007
 |
SUMMARY |
|---|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Key words: Notch1, Delta-like 4, Foxn4, Gata, Scl (Tal1), Chx10, Spinal cord, Neurogenesis, Chick, Mouse, V2 interneurons, Mash1 (Ascl1)
|
INTRODUCTION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
;
Ericson et al., 1997). For
example, sonic hedgehog diffusing from the notochord and floor plate forms a
concentration gradient that specifies five ventral progenitor domains known as
p3, pMN, p2, p1 and p0 (ventral to dorsal). This initial patterning phase is
followed by the neurogenic phase, during which the progenitor domains give
rise to particular combinations of differentiated neurons and glia
(Rowitch, 2004). Motor neurons
and several types of interneurons (INs) in the ventral spinal cord assemble
into local networks that generate the rhythmic output required for locomotion
(reviewed by Kiehn, 2006). To
understand how locomotor circuits develop, it is necessary to understand the
genetic and cellular mechanisms that determine neuron diversity.
The p2 progenitor domain generates two distinct subtypes of INs, V2a and
V2b (Karunaratne et al., 2002;
Li et al., 2005;
Smith et al., 2002;
Zhou et al., 2000).
Postmitotic V2a INs are characterised by expression of the homeodomain
transcription factor Chx10 (Ericson et al.,
1997), whereas V2b INs express transcription factors Gata2, Gata3
and Scl (Tal1) (Karunaratne et al.,
2002; Muroyama et al.,
2005; Smith et al.,
2002). How V2 INs incorporate into the local spinal circuitry is
not established, although V2a INs are thought to be excitatory (glutamatergic)
and to project ipsilaterally (Kiehn,
2006; Kimura et al.,
2006). The neurotransmitter phenotype of V2b INs is not known. V2a
and V2b INs are derived from common progenitors that initially express the
forkhead/winged helix transcription factor Foxn4
(Li et al., 2005) (this
paper). How does this homogeneous progenitor pool generate two distinct
neuronal subtypes?
The Notch-Delta signalling pathway is often used to establish or to
maintain differences between lineally related cells
(Artavanis-Tsakonas et al.,
1999; Louvi and
Artavanis-Tsakonas, 2006). For example, signalling between Notch1
and its ligand delta-like 4 (Dll4) in endothelial cells is necessary for
artery-vein discrimination and also for sprouting of lymphatic vessels from
veins (Duarte et al., 2004;
Seo et al., 2006). We thought
it possible that the distinction between V2a and V2b INs might also be
established through Notch-Delta signalling. Notch1, 2 and 3 are all expressed
in the ventral VZ of the embryonic spinal cord
(Lindsell et al., 1996), as
are their ligands Dll1, Dll3, Dll4 and jagged 1
(Benedito and Duarte, 2005;
Dunwoodie et al., 1997;
Lindsell et al., 1996;
Mailhos et al., 2001). Unlike
Dll1 and Dll3, which are expressed widely throughout the VZ and/or in
postmitotic neurons, Dll4 appears to be restricted to the p2 domain of the VZ,
suggesting a specific role in V2 IN development
(Benedito and Duarte,
2005).
We have examined the relationship between Foxn4 and Notch-Delta signalling during development of V2a and V2b sub-lineages. We demonstrated that Foxn4 is a master regulator of the V2b sub-lineage, being necessary and sufficient to induce the V2b determinants Gata2, Gata3 and Scl, while repressing markers of other neuronal lineages. We also found that Foxn4 controls Dll4 and Mash1 (Ascl1) expression in p2. In gain-of-function assays, Dll4 inhibited the development of V2a INs and, conversely, when Notch1 was conditionally inactivated, V2a INs were overproduced at the expense of V2b INs. Taken together, our data suggest the following model: (1) Foxn4 activates Dll4 and Mash1 in common V2a/V2b progenitors; (2) subsequent neighbour-to-neighbour signalling via Dll4 activates Notch1 in a subset of p2 progenitors, which then generate V2b INs under the combined action of Notch1, Foxn4 and Mash1; (3) the complementary set of progenitors fails to activate Notch1 and consequently generates V2a INs.
|
|
MATERIALS AND METHODS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
),
Scl conditional nulls (
Scl)
(Muroyama et al., 2005),
Notch1 conditional nulls (Yang et
al., 2006), Mash1-/-
(Guillemot et al., 1993). The
Scl and Notch1 conditional nulls were crossed to
Nestin-Cre to eliminate the floxed alleles throughout the CNS.
Electroporation constructs
The complete coding sequence of mouse Foxn4 was cloned from an
E15.5 mouse eye cDNA library by PCR with the primers
5'-CTCCAGGAAATGATAGAAAGTG and 5'-CTGCAGAAGATGGGTAGGTAGAG. The
cloned sequence matched the published mouse Foxn4 mRNA (GenBank
accession AY039039), with the exception of nucleotide T288G, which does not
change the translated protein sequence. The cDNA (from ATG to stop codon) was
cloned into the pCAß-LINK-IRESeGFPm5-ClaI bi-cistronic expression vector
(Schubert and Lumsden, 2005)
by PCR.
The Mash1 vector (gift from Francois Guillemot, National Institute for Medical Research, London, UK) contains the coding sequence of mouse Mash1 under transcriptional control of a synthetic ß-actin promoter (CAGGS), followed by IRES-eGFP (with a nuclear localisation signal).
A human DLL4 (hDll4) expression vector was kindly provided by Ji-Liang Li (John Radcliffe Hospital, University of Oxford, UK). The full-length human DLL4 coding sequence was PCR-amplified from human placental cDNA, using primers 5'-GGATCCCATATGGCGGCAGCGTCCCGTAGCGCCT and 5'-ACCGGTTCCCGCGGTACCTCCGTGGCAATGACACATTCATTC. hDll4 was released from the pGEM-T Easy vector (Promega) by BamHI/SacII digestion and inserted into pcDNA3.1/myc-His (Invitrogen).
Electroporation of chick embryos in ovo
Fertilised chicken eggs were incubated at 38°C in a humidified
incubator, opened and staged according to Hamburger and Hamilton
(Hamburger and Hamilton,
1951). Embryos were electroporated at st11-16
(Itasaki et al., 1999). The
expression constructs [2-5 µg/µl in PBS and 0.8% (w/v) Fast Green] were
injected into the lumen of the spinal cord and electroporated using an
Intracel TSS20 Ovodyne electroporator with EP21 current amplifier and 0.5 mm
diameter home-made platinum electrodes (4-5 pulses of 20-25 volts for 50
milliseconds each).
Tissue preparation and immunohistochemistry
Embryos were dissected in cold PBS and fixed in 4% (w/v) paraformaldehyde
in PBS. They were then cryo-protected with 20% (w/v) sucrose in PBS, embedded
in OCT and frozen for cryo-sectioning (10 µm nominal thickness). The
antibodies used were: rabbit polyclonal anti-GFP at 1:8000 (ab290-50, Abcam),
rabbit anti-Chx10 at 1:100 (provided by Thomas Jessell, Columbia University,
NY and Connie Cepko, Harvard Medical School, Boston, MA), mouse monoclonal
anti-Myc at 1:200 (M4439, Sigma), mouse monoclonal anti-Gata3 at 1:100 (SC268,
Santa Cruz), rabbit anti-Olig2 1:8000 (provided by Charles Stiles, Dana Farber
Cancer Institute, Boston, MA), mouse monoclonal anti-Hb9 (Developmental
Studies Hybridoma Bank, DSHB), rabbit anti-ß-gal at 1:2000 (Cappel, ICN
Pharmaceuticals), mouse anti-Lim1/2 (Lhx1/5) at 1:30 (DSHB), mouse anti-En1 at
1:5 (DSHB), mouse anti-ß-gal (Promega) at 1:300 (with tyramide
amplification, Molecular Probes). Some of the sections were incubated with
DAPI in PBS in order to visualise cell nuclei before mounting.
|
). PCR forward and reverse primers were as follows:
Foxn4, 5'-CCCGATGGCTGGAAAAACTC and
5'-AGAGTGTGGAGAGGAGGTGT; Lhx3, 5'-AGACGCAGCTGGCCGAGAAGTG
and 5'-TGTCCCATGATGCCCAAACC; Chx10, 5'-AC
AATCTTCACATCCTACCAACTG and 5'-GCTCCATATCTCAAACACCTCAAT; Gata2,
5'-TGCCGGCCTCATCTTATCCAC and 5'-TTTGCCATCCCTACATTCTCCTCT;
Gata3, 5'-AAGCTCTTTCCCCACCCCGACTC and
5'-GGACATCAGACCCATAACCACACG.
A longer chick Foxn4 template was cloned by RNA ligase-mediated
rapid amplification of 5' and 3' cDNA ends (RLM-RACE) (Gene Racer
Kit), using the supplied 5' upper primer and
5'-GGCAGAGTGTGGAGAGGAGGTGTC. The cDNA product was 850 bp. The template
for chicken Dll4 was plasmid ChEST714c11 (ARK-Genomics) cut with
NotI. The mouse Foxn4 probe includes the ORF minus the first
1000 bp, plus the entire 3' UTR sequence
(Gouge et al., 2001). The
lacZ probe contained a 3.7 kb BamHI fragment of the
lacZ gene (lacZ-pBlueSK). The mouse Scl probe has
been described previously (Muroyama et
al., 2005).
|
RESULTS |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
; Li et al.,
2004; Li et al.,
2005). In the ventral neural tube it is expressed specifically in
the p2 progenitor domain (Li et al.,
2005), which generates V2a and V2b INs. We analysed Foxn4
expression in chick embryos by in situ hybridisation (ISH) during
Hamburger-Hamilton stages 10 to 25 (st10-25). We first detected small numbers
of Foxn4-positive cells in the rostral spinal cord at st13 (see Fig.
S1A in the supplementary material). At later stages, the number of
Foxn4-positive cells increased. As in the mouse, a few cells were
present in the VZ close to the lumen, but most accumulated towards the outer
margin of the VZ (see Fig. S1B,C in the supplementary material). They are
generated exclusively in the p2 progenitor domain, within the region of
Nkx6.1 expression but immediately dorsal to the
Olig2-expressing pMN domain (see Fig. S1D in the supplementary
material and data not shown).
We compared the expression of Foxn4 with Chx10, which
marks V2a INs (Ericson et al.,
1997), and with Gata2, which marks V2b INs
(Karunaratne et al., 2002), in
chick embryos. There was a significant degree of overlap between
Foxn4 and Gata2 (see Fig. S1E,G in the supplementary
material) but no overlap between Foxn4 and Chx10 (see Fig.
S1F,H in the supplementary material), implicating Foxn4 in the development of
V2b but not V2a INs. In support of this, we found that electroporation of
ß-actin-Foxn4-IRES-GFP into st12-14 chick spinal cord could
induce ectopic expression of the V2b markers Gata2, Gata3 and
Scl, but was unable to induce ectopic V2a markers Chx10
(0/15 embryos) or Lhx3 (0/7 embryos)
(Fig.1A-F,I,J). Gata2
was induced robustly by 24 hours post-electroporation (50/50 embryos), whereas
Scl and Gata3 required longer (0/5 embryos after 24 hours
versus 17/17 embryos after 48 hours for Scl; 0/5 embryos after 24
hours versus 6/8 embryos after 48 hours for Gata3). The number of
Chx10-positive V2a INs generated from the p2 progenitor domain was reduced
markedly in these experiments (62±9% reduction, mean±s.e.; 107
cells on the control side versus 33 on the electroporated side; 41 sections
from eight embryos) (Fig.
1G,H).
This suggested that Foxn4 might act as a master regulator of the V2b
sub-lineage. In a further test of this idea we asked whether Foxn4 can repress
alternative IN fates in more-dorsal progenitor domains. We found that
electroporated Foxn4 inhibited expression of engrailed 1 (En1), a marker of
postmitotic V1 INs (Ericson et al.,
1997), and of Lhx1/5, which marks postmitotic INs derived from
dorsal progenitor domains dP1-dP6 with the exception of dP3 (reviewed by
Lewis, 2006). A reduction of
31±3% (mean±s.e., n=4) was observed for En1 (1173 cells
on the control side versus 776 on the electroporated side; 39 sections from
four embryos; see Fig. S2A in the supplementary material) and a reduction of
45±13% (n=4) for Lhx1/5 (4239 cells on the control side versus
2604 on the electroporated side; 30 sections from four embryos; see Fig. S2B
in the supplementary material). These experiments suggest that ectopic
expression of Foxn4 can reprogram progenitors to a V2b IN fate.
|
). We therefore explored the genetic relationship between
Scl and Foxn4. There was a small but significant overlap
between Foxn4 and Scl in wild-type mice
(Fig. 2A). Scl mRNA
expression was abolished in Foxn4 mutant mouse spinal cords at E10.5
(3/3 embryos) and E11.5 (2/2 embryos) (Fig.
2D,E and data not shown). Conversely, Foxn4 was expressed
as normal in Scl conditional null mice (2/2 embryos)
(Fig. 2F,G). Also, as described
above, Foxn4 induces Scl expression after 48 hours (17/17
embryos) (Fig. 1D,
Fig. 2C). Therefore, it seems
that Foxn4 lies upstream of Scl in the genetic hierarchy
leading to V2b INs. A negative-control vector with inverted Foxn4 sequences has been used in parallel with all experiments reported above, without any activity (data not shown). Taken together, our data suggest that Foxn4 is a master regulator of the V2b sub-lineage. Furthermore, we have shown that Scl lies downstream of Foxn4 in the pathway that governs development of V2b INs.
Foxn4 is expressed in the common progenitors of V2a and V2b INs
It was previously reported that V2a and V2b INs share common,
Foxn4-expressing progenitor cells in the VZ
(Li et al., 2005). We
confirmed this by following expression of ß-galactosidase (ß-gal) in
mouse Foxn4+/- heterozygotes, which is possible because
the knockout allele contains a functional copy of lacZ under
Foxn4 transcriptional control. By double immunohistochemistry we
found that ß-gal protein was present in cells that co-express Chx10
(Fig. 3A), as well as in cells
that express Gata3 (Fig. 3B).
By contrast, Foxn4 transcripts or protein were never found in the
same cells as Chx10 or Gata3 (see Fig. S1H in the supplementary material)
(Li et al., 2005). The most
parsimonious interpretation is that there is a common pool of Foxn4-positive
progenitors that generates both V2a and V2b INs. The reason that ß-gal
can be detected in differentiated V2a as well as V2b INs is presumably because
it has a longer half-life than Foxn4. In further support of the
existence of a common pool of V2a/V2b progenitors, we found that those
Foxn4-positive cells that lie closest to the lumen (where neural
progenitors undergo mitosis) co-express the V2a determinant Lhx3
(Fig. 3D), as well as
Gata2 (see Fig. 1G in
the supplementary material) and Mash1
(Fig. 3C,
Fig. 6A).
Foxn4 activates delta-like 4 in p2 progenitors
mRNA encoding the Notch ligand delta-like 4 (Dll4) is expressed in
scattered cells in mouse and chicken within the p2 progenitor domain
(Fig. 4A,B and data not shown).
Some of the Dll4-positive cells in the p2 domain co-expressed
Foxn4 (Fig. 4A,B).
Many of these Foxn4/Dll4 double-positive cells were found at
the ventricular surface, where mitosis occurs. Double-positive cells
frequently occurred as cell pairs (arrows in
Fig. 4B, shown at higher
magnification in C,D). These images strongly suggest that Dll4 and
Foxn4 are co-expressed in cells that are dividing, or in recently
separated siblings that are still in contact.
To determine whether Dll4 and Foxn4 interact genetically, we performed chick electroporation experiments at st11-12 with ß-actin-Foxn4-IRES-GFP. Foxn4 induced ectopic expression of Dll4 at 34 hours post-electroporation in 12/12 embryos analysed (Fig. 4F). A control vector with inverted Foxn4 sequences had no such effect (data not shown). Consistent with these observations, Dll4 expression was abolished in the p2 domain of Foxn4-null mice at E10.5 (3/3 embryos analysed) and E11.5 (2/2 embryos analysed) (Fig. 4E and data not shown). We conclude that Foxn4 is necessary and sufficient for activation of Dll4 in p2 progenitors.
Dll4 inhibits V2a lineage progression
To discover whether Dll4 is involved in the specification of V2
INs - possibly through its interactions with Notch - we performed
gain-of-function experiments in chick neural tube by electroporating an
expression vector encoding human DLL4 (CMV-hDll4-Myc). We performed
two sets of experiments. In the first, we electroporated at st11-13 and
analysed the embryos after a further 44 hours (st19-20). In 16 embryos
analysed, we found no ectopic induction of Chx10 immunoreactivity or
Gata2 mRNA. By contrast, a reduction of Chx10 and Gata2
expression was observed on the electroporated versus the control side, Chx10
being more strongly repressed (
80% reduction) than Gata2
(35% reduction) (63 Chx10-positive cells on the control side versus 12 on
the electroporated side, compared with 90 Gata2-positive cells on the
control side versus 58 on the electroporated side; 24 sections from four
embryos; data not shown). In the second set of experiments, we electroporated
at st14-16 and analysed the embryos after a further 48 hours (st21-23). In
this set of experiments, 15 embryos were analysed for Chx10 immunoreactivity
and Chx10, Scl and Gata2 mRNA
(Fig. 5). As in the first
experiment, there was no ectopic expression of Chx10 protein or mRNA but a
strong repression of Chx10 protein on the electroporated versus control side
(51±5% reduction, mean±s.e.; 137 sections from 13 embryos;
two-tail t-test=3.6 at P=0.001)
(Fig. 5A,B). Gata2
mRNA was expressed ectopically in some embryos (19/63 sections in five out of
15 embryos). In general, the induction of Gata2 was modest and always
restricted to the p1-p0 domain (Fig.
5D', white arrow). Despite this small amount of ectopic
expression, the total amount of Gata2 signal (estimated by counting
pixels with ImageJ) was not detectably different on the electroporated versus
control sides (594±83 versus 562±83 pixels, respectively; 80
sections from 7 embryos; two-tail t-test=0.3 at P=0.8, not
significant) (Fig.
5D',E). The Scl signal was also not significantly
different between electroporated and control sides (396±64 pixels
versus 361±57, respectively; 86 sections from 9 embryos; two-tail
t-test=0.5 at P=0.6, not significant), nor was there any
ectopic expression of Scl (Fig.
5D'',E). These results suggest that at st14-16, Dll4
overexpression specifically represses the V2a fate with little or no effect on
V2b fate. In Dll4 electroporations, some cells were Dll4-Myc/Chx10
double positive (Fig. 5C),
indicating that expression of Dll4 is compatible with expression of Chx10 in
the same cell.
|
)
that Foxn4 is expressed as normal in Mash1-null spinal cord
(Fig. 6C,D). After
electroporating ß-actin-Foxn4-IRES-GFP in the chick spinal cord
at st13-14, we found strong ectopic induction of Cash1 (the chick
homologue of Mash1) after 24 hours (6/6 embryos) and 48 hours (3/5
embryos; Fig. 6B and data not
shown). The negative control vector with inverted Foxn4 sequences had
no activity (data not shown). These experiments indicate that Foxn4
is upstream of and controls expression of Mash1 in p2, and fits with
the observation that Mash1 expression in p2 is lost in
Foxn4-null mice (Li et al.,
2005).
Mash1 stimulates Dll4 expression but does not induce V2b INs
Mash1 controls the expression of Dll1 in the ventral telencephalon
and dorsal spinal cord (Casarosa et al.,
1999), so we asked whether Mash1 can also induce Dll4. We
electroporated full-length mouse Mash1
(ß-actin-Mash1-IRES-GFP) into st13-14 chick neural tube. After
24 hours of incubation, 8/8 embryos showed clear ectopic induction of
Dll4 on the electroporated side
(Fig. 6E). After 48 hours, 5/5
embryos displayed weaker but still clear induction of Dll4 (data not
shown). In none of the 13 embryos analysed did we find any ectopic expression
of Chx10, Gata2 or Scl transcripts or Chx10 immunoreactivity
(Fig. 6F,G,H',H''
and data not shown). On the other hand, we observed a loss of endogenous
Chx10-positive INs in the p2 domain of 5/5 embryos analysed (76±6%
reduction, n=23) (Fig.
6F,F',G), with little or no concomitant reduction of
Gata2 or Scl (Fig.
6H',H''). These data suggest that induction of
Dll4 and consequent repression of Chx10-positive V2a INs by Foxn4
might be mediated indirectly via Mash1. However, we found that Dll4
is expressed as normal at E10.5-11 in Mash1-null embryos (4/4
embryos; Fig. 6I,J). Therefore,
Mash1 might be involved in maintaining or reinforcing Dll4 expression
but is not required for its initiation. Although Mash1 is necessary to develop
the V2b fate (Li et al.,
2005), it is not sufficient to do so, judging by its inability to
induce ectopic Gata2 or Scl expression. Therefore, it
appears that the V2b program of gene expression is absolutely dependent on
Foxn4.
Notch1 is required for generation of V2b INs
The fact that Dll4 preferentially represses the V2a fate suggests that the
Notch-Delta system might be responsible for the V2a-V2b binary fate decision
in p2 progenitors. To test this, we analysed Notch1 mutant (cKO)
mouse embryos at E10.5 and E11.5 by ISH for Foxn4 or Scl, or
by immunohistochemistry for Chx10, Gata3, Olig2 or Hb9 (Hlxb9)
(Fig. 7). Olig2 is a basic
helix-loop-helix transcription factor that is expressed in the progenitors of
motor neurons (MNs) and oligodendrocytes but not in postmitotic MNs
(Lu et al., 2000), whereas Hb9
is a transcription factor expressed in early committed MNs
(Thaler et al., 1999). At
E11.5, no Gata3 (0 versus 99±3, n=14 sections from three
embryos; two-tail t-test=26, P<0.001) or Scl-
positive cells were present in the ventral spinal cord of Notch1 cKO
mice (3/3 embryos analysed) (Fig.
7A-D,M-N). Instead, twice the normal number of Chx10-positive
cells was observed (200±10 versus 102±3, n=16 sections
from three embryos; two-tail t-test=8.6 at P<0.001)
(Fig. 7A-D), as previously
reported (Yang et al., 2006).
pMN progenitors that express Olig2 were drastically reduced at this age
(2±0.5 versus 39±2, n=14 sections from three embryos;
two-tail t-test=17, P<0.001), but the number of
Hb9-positive cells was not significantly affected in the Notch1
mutant (3/3 embryos analysed) by comparison with wild-type mice (175±16
versus 165±8, n=14 sections from three embryos; two-tail
t-test=0.6, P=0.6) (Fig.
7D,E-F). It seems that Notch1 signalling is necessary to prevent
premature differentiation of most progenitor cells in the ventral cord,
judging by the loss of the ventral VZ in the mutant
(Yang et al., 2006). However,
loss of Notch1 does not seem to result in respecification of pMN progenitors
to p2 progenitors, as originally proposed
(Yang et al., 2006). Rather,
the phenotype is more consistent with respecification of V2b to V2a INs,
consistent with the idea that signalling through Notch1 is required for V2b IN
development.
|
|
). In keeping with this, the morphology of the spinal cord was
normal in the Nestin-Cre/Notch1flox at E10.5
(i.e. the ventral VZ was still present). Foxn4 and Dll4 were
expressed at higher than normal levels in the mutant at E10.5, consistent with
the idea that V2a/V2b progenitors are formed prematurely but have not yet had
time to differentiate (Fig.
7G,H and data not shown). By contrast, and consistent with the
above reasoning, Scl was expressed at a reduced level at E10.5
(Fig. 7K,L).
|
|
DISCUSSION |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
). At present
we are unable to explain this difference but it could perhaps relate to
differences in the level of Foxn4 expression achieved following
electroporation. We have ruled out functional differences between the
Foxn4 electroporation vectors used because in our hands both
constructs give the result reported here. In any case, both our studies
demonstrate that Foxn4 is a key determinant of the V2b sub-lineage.
It was shown previously that the transcription factor Scl is necessary and
sufficient to induce V2b INs (Muroyama et
al., 2005). Foxn4 transcripts are detected before
Scl during normal development - at st13 in chick/E9.5 mouse, compared
with st16-17 chick/E10.5 mouse (Li et al.,
2005; Muroyama et al.,
2005) (data not shown), suggesting that Foxn4 is upstream
of Scl. Consistent with this, we have now shown that: (1)
Scl expression is lost in Foxn4-/- mice, whereas
Foxn4 expression is unaffected in Scl-/- mice;
and (2) Foxn4 is able to induce Scl expression in chick
electroporation experiments. Foxn4 induces robust expression of
Gata2 in chick neural tube within 24 hours post-electroporation,
whereas Scl and Gata3 are not detectable until 48 hours
post-electroporation. This temporal order presumably reflects the fact that
Gata2 is required for Gata3 expression
(Karunaratne et al., 2002;
Nardelli et al., 1999) and
suggests that Gata2 is genetically upstream of Scl. This is
backed up by the fact that Gata2 is expressed ahead of Scl
during normal development in both chick and mouse
(Muroyama et al., 2005) (data
not shown). Gata3 expression is lost in Scl-null mice,
placing Scl upstream of Gata3
(Muroyama et al., 2005). Taken
together, the available data support a genetic cascade Foxn4 
Gata2 Scl Gata3. The reduction of
Gata2 expression that was observed in Scl- null mice
(Muroyama et al., 2005) can be
attributed to loss of positive feedback from Gata3
(Karunaratne et al., 2002). A
diagram of the proposed network is shown in
Fig. 8.
Foxn4 activates Dll4 and Mash1
By loss- and gain-of-function experiments we found that Foxn4 is
necessary and sufficient to activate Dll4 and Mash1
expression. We subsequently showed that Mash1 can also induce ectopic
expression of Dll4 in chick spinal cord. This suggests that the
conserved Mash1/Brn binding site in the Dll4 upstream region,
reported by Castro et al. (Castro et al.,
2006), is functional in vivo and further suggested that Foxn4
might activate Dll4 indirectly through Mash1. However, we found that
Mash1 is not required for initiation of Dll4 expression in the mouse
because Dll4 is expressed normally in the p2 domain of E10.5
Mash1-null spinal cord. It is possible that Mash1 might be required
to maintain Dll4 expression after E10.5, but we have not examined
older embryos. Alternatively, a requirement for Mash1 in the initiation of
Dll4 expression might be masked in Mash1 mutant mice through
compensatory upregulation of a related proneural factor such as Ngn1 (Neurog1)
or Ngn2 (Neurog2). It is also possible that Foxn4 induces Dll4
directly; in endothelial cells, for example, Foxc1 and/or Foxc2 are known to
activate Dll4 by binding directly to a Fox-binding site in the
Dll4 gene upstream region (Seo et
al., 2006).
|
50% less V2b INs than normal
(Li et al., 2005), despite the
fact that Foxn4 and Dll4 are both expressed normally
(Fig. 6D and data not shown).
More work needs to be done to establish the precise role of Mash1 in V2b IN
development.
Notch1 is required for V2b interneuron development
The connection between Foxn4, Dll4 and Mash1 led us to explore the role of
Notch-Delta signalling more directly. We previously reported that when Notch1
function was disrupted in the ventral spinal cord, the result was a 30%
overproduction of (Chx10, Lhx3) double-positive V2a INs and an 18% loss
of [Islet 1 (Isl1), Lhx3] double-positive MNs, although the total number of
Islet-positive MNs was unchanged (Yang et
al., 2006). This was originally interpreted as a fate switch from
MN to V2 IN production. However, in the present study we found that
Gata3-positive V2b INs were completely lost, whereas the number of
Hb9-positive MNs was not changed significantly in the Notch1 mutant.
Therefore, we conclude that the increase in V2a INs is more likely to result
from respecification of V2b INs than from respecification of MNs to V2a INs.
Since the V2 phenotype of the conditional Notch1 mutant is analogous
to that of the Foxn4-null mouse, it appears that both Notch1 and
Foxn4 activities are required for V2b IN production.
The default behaviour of p2 progenitors in the absence of Notch1 or Foxn4
activity is to differentiate as V2a INs, suggesting that active Notch1 acts
cell-autonomously in collaboration with Foxn4 to drive V2b development. We
have not been able to address directly the question of whether Notch1 acts in
a cell-autonomous fashion in V2b INs. However, we observed that electroporated
Dll4 is co-expressed with endogenous Chx10 in some V2a INs
(Fig. 5C), suggesting that
Dll4-mediated inhibition of V2a INs is non-cell-autonomous, as expected from
the classical view of Notch-Delta neighbour-to-neighbour signalling. This
contrasts with Foxn4, which was never co-expressed with Chx10, in
keeping with its expected cell-autonomous role. A cell-autonomous role for
Notch is indicated by the requirement for presenilin 1 (Psen1) for V2b lineage
development (Peng et al.,
2007). Psen1 is involved in the intracellular cleavage of Notch
(Wines-Samuelson and Shen,
2005). It also fits with the report that Notch1 binds to an
enhancer in the upstream region of the Gata2 gene during
hematopoiesis (Robert-Moreno et al.,
2005).
Why does Dll4 electroporation inhibit V2a IN production without causing a
compensatory increase in V2b INs in p2? Perhaps dll4 electroporation
reduces the total number of V2 INs (V2a +V2b) by inhibiting production of V2
progenitors from their neuroepithelial precursors, while simultaneously
biasing the fate of the remaining V2 progenitors from V2a towards V2b. If so,
the fact that there is no significant change in the number of V2b INs in our
electroporation experiments at st14-16 might be the result of two equal but
opposing effects. If this explanation is correct, then the precise outcome of
the experiment might depend critically on the time of electroporation, because
this could alter the magnitude of one effect versus the other. Consistent with
this idea, we found a small reduction in the number of V2b INs (as well as a
reduction in V2a INs) when we electroporated at st11-12. Peng et al.
(Peng et al., 2007) also found
a reduction in total V2 INs in their electroporation experiments at st13. This
model is necessarily speculative and other explanations are possible.
Notch1/Dll4 signalling breaks symmetry and splits the V2 lineage
What is the mode of action of Notch1 in V2 IN development? One possibility
might be that p2 progenitors normally generate V2a INs first, before switching
to V2b production, and that Dll4/Notch1 is needed to keep some progenitors in
cycle long enough to generate V2b INs. In that case, eliminating Notch
signalling might be expected to cause accelerated differentiation along the
V2a pathway and loss of V2b differentiation, as observed. However, there is no
evidence that V2a INs are formed before V2b INs. Chx10 and
Gata3 are both expressed together for the first time at E10.5 in
mouse (Liu et al., 1994;
Nardelli et al., 1999). V2a
and V2b subpopulations are formed simultaneously in chicken too
(Karunaratne et al., 2002). We
therefore propose that Notch1-Delta signalling has two consecutive or parallel
functions in the p2 progenitor domain: (1) it inhibits neuroepithelial
(radial) precursors from differentiating prematurely into V2 progenitors; and
(2) it segregates V2 progenitors into V2a and V2b sub-lineages, inhibiting V2a
and promoting V2b development.
The majority of cells that co-express Foxn4 and Dll4 are closely apposed pairs of cells at the ventricular surface, and these are likely to represent the products of recent progenitor cell divisions (Fig. 4A-D). This observation suggests that Dll4/Notch1 interactions involve sibling pairs of cells that have not yet separated after division, and is consistent with the idea that a single V2a/V2b progenitor cell might generate one V2a and one V2b neuron, as illustrated schematically in Fig. 9. Alternatively, bipotential V2a/V2b progenitors might divide asymmetrically to generate a dedicated V2a progenitor and a dedicated V2b progenitor, which can undergo a further symmetrical division(s) before terminal differentiation. Either of these scenarios would be consistent with our observations that approximately equal numbers of V2a and V2b INs are formed under normal circumstances and that twice the normal number of V2a INs form in the absence of Notch1 (Fig. 7D).
|
). It
is possible that V2a and V2b INs are also a complementary
excitatory/inhibitory pair - V2a INs are known to be glutamatergic and
excitatory in zebrafish (Kimura et al.,
2006), but the neurotransmitter phenotype of V2b INs has not yet
been established. It is possible that Notch-Delta signalling might be a
general mechanism for creating complementary pairs of INs.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/19/3427/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: Department of Pediatrics, Institute for Regeneration
Medicine, University of California at San Francisco, 513 Parnassus Avenue, San
Francisco, CA 94143-0525, USA
|
REFERENCES |
|---|
|
TOP
SUMMARY
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES |
|---|
Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J.
(1999). Notch signaling: cell fate control and signal integration
in development. Science
284,770
-776.
Benedito, R. and Duarte, A. (2005). Expression
of Dll4 during mouse embryogenesis suggests multiple developmental roles.
Gene Expr. Patterns 5,750
-755.[CrossRef][Medline]
Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J.
(2000). A homeodomain protein code specifies progenitor cell
identity and neuronal fate in the ventral neural tube.
Cell 101,435
-445.[CrossRef][Medline]
Casarosa, S., Fode, C. and Guillemot, F.
(1999). Mash1 regulates neurogenesis in the ventral
telencephalon. Development
126,525
-534.[Abstract]
Castro, D. S., Skowronsky-Krawzyck, D., Armant, O., Donaldson,
I. J., Parras, C., Hunt, C., Critchley, J. A., Nguyen, L., Gossler, A.,
Göttgens, B. et al. (2006). Proneural bHLH and Brn
proteins coregulate a neurogenic program through cooperative binding to a
conserved DNA motif. Dev. Cell
11,831
-844.[CrossRef][Medline]
Duarte, A., Hirashima, M., Benedito, R., Trindade, A., Diniz,
P., Bekman, E., Costa, L., Henrique, D. and Rossant, J.
(2004). Dosage-sensitive requirement for mouse Dll4 in artery
development. Genes Dev.
18,2474
-2478.
Dunwoodie, S. L., Henrique, D., Harrison, S. M. and Beddington,
R. S. (1997). Mouse Dll3: a novel divergent Delta gene which
may complement the function of other Delta homologues during early pattern
formation in the mouse embryo. Development
124,3065
-3076.[Abstract]
Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S.,
Kawakami, A., van Heyningen, V., Jessell, T. M. and Briscoe, J.
(1997). Pax6 controls progenitor cell identity and neuronal fate
in response to graded Shh signaling. Cell
90,169
-180.[CrossRef][Medline]
Gouge, A., Holt, J., Hardy, A. P., Sowden, J. C. and Smith, H.
K. (2001). Foxn4 - a new member of the forkhead gene family
is expressed in the retina. Mech. Dev.
107,203
-206.[CrossRef][Medline]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A.,
Anderson, D. J. and Joyner, A. L. (1993). Mammalian
achaete-scute homolog 1 is required for the early development of olfactory and
autonomic neurons. Cell
75,463
-476.[CrossRef][Medline]
Hamburger, V. and Hamilton, H. L. (1951). A
series of normal changes in the development of the chick embryo. J.
Morphol. 88,49
-92.[CrossRef]
Itasaki, N., Bel-Vialar, S. and Krumlauf, R.
(1999). `Shocking' developments in chick embryology:
electroporation and in ovo gene expression. Nat. Cell
Biol. 1,E203
-E207.[CrossRef][Medline]
Ivanova, A., Agochiya, M., Amoyel, M. and Richardson, W. D.
(2004). Receptor tyrosine phosphatase zeta/beta in astrocyte
progenitors in the developing chick spinal cord. Gene Expr.
Patterns 4,161
-166.[CrossRef][Medline]
Karunaratne, A., Hargrave, M., Poh, A. and Yamada, T.
(2002). GATA proteins identify a novel ventral interneuron
subclass in the developing chick spinal cord. Dev.
Biol. 249,30
-43.[CrossRef][Medline]
Kiehn, O. (2006). Locomotor circuits in the
mammalian spinal cord. Annu. Rev. Neurosci.
29,279
-306.[CrossRef][Medline]
Kimura, Y., Okamura, Y. and Higashijima, S.
(2006). alx, a zebrafish homolog of Chx10, marks ipsilateral
descending excitatory interneurons that participate in the regulation of
spinal locomotor circuits. J. Neurosci.
26,5684
-5697.
Lewis, K. E. (2006). How do genes regulate
simple behaviours? Understanding how different neurons in the vertebrate
spinal cord are genetically specified. Philos. Trans. R. Soc. Lond.
B Biol. Sci. 361,45
-66.
Li, S., Mo, Z., Yang, X., Price, S. M., Shen, M. M. and Xiang,
M. (2004). Foxn4 controls the genesis of amacrine and
horizontal cells by retinal progenitors. Neuron
43,795
-807.[CrossRef][Medline]
Li, S., Misra, K., Matise, M. P. and Xiang, M.
(2005). Foxn4 acts synergistically with Mash1 to specify subtype
identity of V2 interneurons in the spinal cord. Proc. Natl. Acad.
Sci. USA. 102,10688
-10693.
Lindsell, C. E., Boulter, J., diSibio, G., Gossler, A. and
Weinmaster, G. (1996). Expression patterns of Jagged, Delta1,
Notch1, Notch2, and Notch3 genes identify ligand-receptor pairs that may
function in neural development. Mol. Cell. Neurosci.
8, 14-27.[CrossRef][Medline]
Liu, I. S., Chen, J. D., Ploder, L., Vidgen, D., van der Kooy,
D., Kalnins, V. I. and McInnes, R. R. (1994). Developmental
expression of a novel murine homeobox gene (Chx10): evidence for roles in
determination of the neuroretina and inner nuclear layer.
Neuron 13,377
-393.[CrossRef][Medline]
Louvi, A. and Artavanis-Tsakonas, S. (2006).
Notch signalling in vertebrate neural development. Nat. Rev.
Neurosci. 7,93
-102.[CrossRef][Medline]
Lu, Q. R., Yuk, D., Alberta, J. A., Zhu, Z., Pawlitzky, I.,
Chan, J., McMahon, A., Stiles, C. D. and Rowitch, D. H.
(2000). Sonic hedgehog-regulated oligodendrocyte lineage genes
encoding bHLH proteins in the mammalian central nervous system.
Neuron 25,317
-329.[CrossRef][Medline]
Mailhos, C., Modlich, U., Lewis, J., Harris, A., Bicknell, R.
and Ish-Horowicz, D. (2001). Delta4, an endothelial specific
notch ligand expressed at sites of physiological and tumor angiogenesis.
Differentiation 69,135
-144.[CrossRef][Medline]
Mizuguchi, R., Kriks, S., Cordes, R., Gossler, A., Ma, Q. and
Goulding, M. (2006). Ascl1 and Gsh1/2 control inhibitory and
excitatory cell fate in spinal sensory interneurons. Nat.
Neurosci. 9,770
-778.[CrossRef][Medline]
Muroyama, Y., Fujiwara, Y., Orkin, S. H. and Rowitch, D. H.
(2005). Specification of astrocytes by bHLH protein SCL in a
restricted region of the neural tube. Nature
438,360
-363.[CrossRef][Medline]
Nardelli, J., Thiesson, D., Fujiwara, Y., Tsai, F. Y. and Orkin,
S. H. (1999). Expression and genetic interaction of
transcription factors GATA-2 and GATA-3 during development of the mouse
central nervous system. Dev. Biol.
210,305
-321.[CrossRef][Medline]
Peng, C. Y., Yajima, H., Burns, C. E., Zon, L. I., Sisodia, S.
S., Pfaff, S. L. and Sharma, K. (2007). Notch and MAML
signaling drives Scl-dependent interneuron diversity in the spinal cord.
Neuron 53,813
-827.[CrossRef][Medline]
Robert-Moreno, A., Espinosa, L., de la Pompa, J. L. and Bigas,
A. (2005). RBPjkappa-dependent Notch function regulates Gata2
and is essential for the formation of intra-embryonic hematopoietic cells.
Development 132,1117
-1126.
Rowitch, D. H. (2004). Glial specification in
the vertebrate neural tube. Nat. Rev. Neurosci.
5, 409-419.[Medline]
Schubert, F. R. and Lumsden, A. (2005).
Transcriptional control of early tract formation in the embryonic chick
midbrain. Development
132,1785
-1793.
Seo, S., Fujita, H., Nakano, A., Kang, M., Duarte, A. and Kume,
T. (2006). The forkhead transcription factors, Foxc1 and
Foxc2, are required for arterial specification and lymphatic sprouting during
vascular development. Dev. Biol.
294,458
-470.[CrossRef][Medline]
Smith, E., Hargrave, M., Yamada, T., Begley, C. G. and Little,
M. H. (2002). Co-expression of SCL and GATA3 in the V2
interneurons of the developing mouse spinal cord. Dev.
Dyn. 224,231
-237.[CrossRef][Medline]
Tanabe, Y., William, C. and Jessell, T. M.
(1998). Specification of motor neuron identity by the MNR2
homeodomain protein. Cell
95, 67-80.[CrossRef][Medline]
Thaler, J., Harrison, K., Sharma, K., Lettieri, K., Kehrl, J.
and Pfaff, S. L. (1999). Active suppression of interneuron
programs within developing motor neurons revealed by analysis of homeodomain
factor HB9. Neuron 23,675
-687.[CrossRef][Medline]
Wines-Samuelson, M. and Shen, J. (2005).
Presenilins in the developing, adult and ageing cerebral cortex.
Neuroscientist 11,441
-451.
Yang, X., Tomita, T., Wines-Samuelson, M., Beglopoulos, V.,
Tansey, M. G., Kopan, R. and Shen, J. (2006). Notch1
signaling influences V2 interneuron and motor neuron development in the spinal
cord. Dev. Neurosci. 28,102
-117.[CrossRef][Medline]
Zhou, Y., Yamamoto, M. and Engel, J. D. (2000).
GATA2 is required for the generation of V2 interneurons.
Development 127,3829
-3838.[Abstract]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
|
|
 |
|
  R. M. Henke, T. K. Savage, D. M. Meredith, S. M. Glasgow, K. Hori, J. Dumas, R. J. MacDonald, and J. E. Johnson Neurog2 is a direct downstream target of the Ptf1a-Rbpj transcription complex in dorsal spinal cord Development, September 1, 2009; 136(17): 2945 - 2954. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Nikolaou, T. Watanabe-Asaka, S. Gerety, M. Distel, R. W. Koster, and D. G. Wilkinson Lunatic fringe promotes the lateral inhibition of neurogenesis Development, August 1, 2009; 136(15): 2523 - 2533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Iulianella, M. Sharma, G. B. Vanden Heuvel, and P. A. Trainor Cux2 functions downstream of Notch signaling to regulate dorsal interneuron formation in the spinal cord Development, July 15, 2009; 136(14): 2329 - 2334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Boni, K. Urbanek, A. Nascimbene, T. Hosoda, H. Zheng, F. Delucchi, K. Amano, A. Gonzalez, S. Vitale, C. Ojaimi, et al. Notch1 regulates the fate of cardiac progenitor cells PNAS, October 7, 2008; 105(40): 15529 - 15534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Kimura, C. Satou, and S.-i. Higashijima V2a and V2b neurons are generated by the final divisions of pair-producing progenitors in the zebrafish spinal cord Development, September 15, 2008; 135(18): 3001 - 3005. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
