|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 13 December 2006
doi: 10.1242/dev.02727
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Center for Basic Neuroscience, UT Southwestern Medical Center, Dallas, TX
75390, USA.
2 Department of Psychiatry, UT Southwestern Medical Center, Dallas, TX 75390,
USA.
3 Smilow Neuroscience Program and the Department of Cell Biology, New York
University School of Medicine, New York, NY 10016, USA.
* Author for correspondence (e-mail: jane.johnson{at}utsouthwestern.edu)
Accepted 2 November 2006
| SUMMARY |
|---|
|
|
|---|
Key words: Mash1 (Ascl1), bHLH transcription factor, Spinal cord development, In vivo genetic fate mapping, Mouse
| INTRODUCTION |
|---|
|
|
|---|
Transcription factors of the Basic helix-loop-helix (bHLH) family are one
class of molecules essential in both neurogenesis and gliogenesis from
Drosophila to mammals (reviewed by
Bertrand et al., 2002
;
Rowitch, 2004
). Here we use
recombination-based lineage tracing in vivo to identify the position within
the neural lineage marked by the bHLH factor, Ascl1 (previously Mash1).
Ascl1 is a vertebrate homolog of the Drosophila proneural
genes of the Achaete-scute complex
(Johnson et al., 1990
). Ascl1
is present within the ventricular zone, in at least some mitotically active
cells, in distinct regions along the rostrocaudal and dorsoventral axes of the
neural tube (Guillemot et al.,
1993
; Helms et al.,
2005
; Ma et al.,
1997
; Porteus et al.,
1994
; Torii et al.,
1999
). Over the past decade, analyses of mice null for
Ascl1 have demonstrated its essential role in the generation of
specific subsets of neurons in many regions, including the forebrain,
hindbrain, autonomic nervous system, olfactory epithelium, retina and spinal
cord (Akagi et al., 2004
;
Blaugrund et al., 1996
;
Casarosa et al., 1999
;
Cau et al., 1997
;
Guillemot et al., 1993
;
Helms et al., 2005
;
Hirsch et al., 1998
;
Pattyn et al., 2004
). Roles
for Ascl1 in inducing neuronal differentiation and in neuronal specification
were revealed by combining results from the mouse mutant with those from
overexpression paradigms in cell culture
(Farah et al., 2000
) or chick
neural tube (Nakada et al.,
2004
). For example, in the chick neural tube, high levels of Ascl1
induce cells to stop cycling, move laterally out of the ventricular zone, and
begin expressing both general neuronal markers and neuronal-type-specific
markers (Helms et al., 2005
;
Kriks et al., 2005
;
Müller et al., 2005
;
Nakada et al., 2004
). Loss of
Ascl1 function results in loss or decrease of specific interneuron populations
in the mouse spinal cord (Helms et al.,
2005
; Li et al.,
2005
). In addition to these specific losses, there is a more
general defect as cells stall in the ventricular zone and different aspects of
neuronal differentiation become uncoordinated
(Casarosa et al., 1999
;
Helms et al., 2005
;
Horton et al., 1999
;
Torii et al., 1999
). Together,
these studies define Ascl1 as an essential player in vertebrate neuronal
differentiation and specification.
Although not studied as extensively, there are accumulating data that
suggest Ascl1 is a player in oligodendrogenesis as well as neurogenesis. Ascl1
was first described in oligodendrocyte progenitor cells isolated from optic
nerve (Kondo and Raff, 2000
;
Wang et al., 2001
), and more
recently it was shown to overlap with markers of oligodendrocyte precursors in
the telencephalon (Gokhan et al.,
2005
) although its requirement in these cells is not clear. At
postnatal stages, Ascl1 functions in the telencephalic subventricular zone
(SVZ), the source of replenishing neurons in the olfactory bulb and
oligodendrocytes in the cortex (Parras et
al., 2004
). In Ascl1 mutants, there is a decrease in
neurons and oligodendrocytes, with an increase in astrocytes in cell cultures
derived from telencephalic SVZ. It is not clear from these studies whether
Ascl1 is present and functions in a progenitor common to both neurons and
oligodendrocytes, or whether it is present in precursors restricted to either
of these two lineages.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Nestin-CreERT2 was created by subcloning
CreERT2 from pCreERT2
(Indra et al., 1999
) into the
SalI and NheI site of Nestin Xh5 plasmid (gift from W.
Zhong, Yale University). The rat Nestin gene was initially identified
to contain four exons spanning three introns
(Lendahl et al., 1990
) and was
recently identified to contain five exons spanning four introns
(Wiese et al., 2004
). The Xh5
plasmid contains
5.4 kb upstream of the initiation codon, exons 1-4 and
adjacent introns 1-4, and part of the 5' region of exon 5 of rat nestin
(see Fig. S1A in the supplementary material). The Xh5 plasmid has been
previously published in other mouse models and contains similar elements to
Nes/PlacZ/3 introns (Beech et al.,
2004
; Petersen et al.,
2002
; Zimmerman et al.,
1994
). The Nestin-CreERT2 founder mice were
generated by pronuclear injection of SmaI digest of
Nes-CreERT2 into C57Bl/6J fertilized eggs. Five
independent lines were generated and the data presented here are from one line
(K). A detailed characterization of this transgenic strain will be published
elsewhere. A Nestin-CreERT2;R26R-stop-lacZ E11.5 embryo
induced with tamoxifen at E10.5 illustrates nervous system expression of the
transgene along the rostrocaudal axis (see Fig. S1B in the supplementary
material). No expression was seen in somites and no expression observed
outside of the CNS. A cross section through the neural tube reveals reporter
gene expression in the ventricular and mantle zones, and at this stage it is
enriched ventrally (see Fig. S1C in the supplementary material).
Cre reporter mouse strains R26R-stop-lacZ
(Soriano, 1999
) and
R26R-stop-YFP (Srinivas et al.,
2001
) were genotyped by PCR using published primers
(Soriano, 1999
): AAA GTC GCT
CTG AGT TGT TAT; GCG AAG AGT TTG TCC TCA ACC; GGA GCG GGA GAA ATG GAT ATG.
Ascl1 mutant strain (Guillemot et
al., 1993
) was genotyped by PCR using: CTCTTAGCCCAGAGGAAC;
GCAGCGCATCGCCTTCTATC; CCAGGACTCAATACGCAGGG. Tamoxifen induction of Cre
recombinase was accomplished by interperitoneal injection of pregnant females
at 9.5-15.5 days post-coitum (dpc) with 2-3 mg tamoxifen (Sigma, T55648) in
sunflower oil per 40 g body weight. Two injections of tamoxifen 6 hours apart
were used for experiments shown in Fig.
3.
Immunofluorescence, X-gal staining, and mRNA in situ hybridization
Embryonic day 10.5-13.5 embryos were dissected and processed as previously
described for whole mount for GFP or X-gal staining
(Gowan et al., 2001
), or for
cryosectioning for immunofluorescence and mRNA in situ hybridization
(Helms et al., 2005
). Briefly,
for cryosectioning, embryos were fixed in 4% formaldehyde for 2 hours at
4°C, rinsed well in phosphate buffer, cryoprotected in 30% sucrose, and
embedded frozen in OCT. Spinal columns were dissected from embryos older than
E15 and fixed in 2% formaldehyde for 16 hours at 4°C, before processing
for cryosection as above. Spinal columns were dissected from P14-P30 mice by
ventral laminectomy after anesthesia and trans-cardiac perfusion with 4%
formaldehyde. Tissue was fixed further for 2 hours at 4°C, vibratome
sectioned and X-gal stained, or fixed overnight at 4°C before processing
as above for cryosection.
|
mRNA in situ hybridization was performed essentially as described using a
combined protocol (Birren et al.,
1993
; Ma et al.,
1998
). A detailed protocol is available upon request.
Ascl1 and Cre antisense probes were made from plasmids
containing the coding region of each gene.
| RESULTS |
|---|
|
|
|---|
Analysis of GFP fluorescence and Cre mRNA in situ in
Ascl1-GIC embryos demonstrated that the BAC sequences contain
sufficient information to direct expression specifically in Ascl1
domains, including those not detected when smaller genomic sequences were used
(Verma-Kurvari et al., 1996
).
GFP in whole mount was detected in the ventral telencephalon, midbrain and
hindbrain, and dorsal neural tube (Fig.
2A). The activity of the Cre recombinase was demonstrated by
crossing Ascl1-GIC mice with the Cre-reporter mouse line,
R26R-stop-lacZ (Soriano,
1999
). Whole mount X-gal stained Ascl1-GIC;R26R-stop-LacZ
embryos permanently report the cells or their progeny that have expressed
active Cre any time before that stage. At E10.5, there was extensive X-gal
staining in midbrain (Fig. 2B).
Staining in developing sympathetic neurons was just beginning to be detected
at E10.5 but was clearly evident by E11.5
(Fig. 2B,C). E11.5 also
revealed expression in the enteric nervous system, diencephalon and hindbrain,
with low expression in the dorsal neural tube
(Fig. 2C,C'). By E12.5,
expression in the dorsal neural tube was clearly detected
(Fig. 2D,D'). These
temporal and spatial expression characteristics reflect expression of
endogenous Ascl1 (Guillemot and
Joyner, 1993
). Cre and Ascl1 detected by mRNA in
situ hybridization demonstrates that Cre was present in an
Ascl1-specific pattern in the dorsal neural tube at E11.5
(Fig. 2E,F), and in the enteric
(Fig. 2G,H) and sympathetic
(Fig. 2I,J) nervous systems.
Taken together, these data demonstrate that GFP and Cre in the
Ascl1-GIC transgenic mouse strain are expressed in an
Ascl1-restricted pattern.
Ascl1-expressing cells produce both neurons and oligodendrocytes
Ascl1 is restricted to the ventricular zone in the neural tube and is known
to be required for neuronal differentiation and specification of subsets of
neurons in multiple regions of the nervous system. Ascl1 has also been
reported in cells that will become oligodendrocytes
(Gokhan et al., 2005
;
Kondo and Raff, 2000
;
Parras et al., 2004
;
Wang et al., 2001
). As Ascl1
disappears as cells exit the cell cycle and differentiate, the identity and
extent of mature neural cells that comprise the Ascl1 lineage is unknown. To
assess the neural cell types derived from the Ascl1 lineage we analyzed
lacZ expression in P30 spinal cords of
Ascl1-GIC;R26R-stop-lacZ mice. This revealed that the contribution of
cells from the Ascl1 lineage was surprisingly broad in the spinal cord and
included cells located throughout gray and white matter tissue, and in cells
surrounding the central canal (Fig.
2K), a pattern seen at all spinal cord levels.
|
Transgenic mice expressing a tamoxifen-inducible Cre recombinase allow stage-specific fate mapping of the Ascl1-lineage
During neural development, the ventricular zone of the neural tube contains
progenitor cells that will give rise to neurons during the period of
neurogenesis (
E9-14) and oligodendrocytes during gliogenesis
(
E13-postnatal). At E10.5, Ascl1 is present in ventricular zone cells, a
subset of which will incorporate BrdU
(Helms et al., 2005
). Thus,
although Ascl1 is best known for its function in neuronal development, the
fate-mapping data demonstrate that it is present in cells that will give rise
to both neurons and oligodendrocytes. We could either be detecting Ascl1
present in early neural tube ventricular zone cells that will differentiate to
neurons early and then later to oligodendrocytes, or we could be detecting
precursors restricted to a neuronal lineage, and then later, precursors
restricted to an oligodendrocyte lineage. To distinguish between these two
possibilities, we generated additional transgenic mice,
Ascl1-CreERTM, that replaced the Ascl1 coding sequence
in the BAC transgene with that encoding the tamoxifen-inducible Cre
recombinase (CreERTM)
(Hayashi and McMahon, 2002
)
carrying a heterologous 3' UTR (Fig.
1). Two independent lines were generated that express the
CreTM transgene in a similar pattern but at different levels
(compare Fig. 3C and
Fig. 4C with Fig. S2 in the
supplementary material). The line with the highest expression in the spinal
neural tube was used for studies reported here.
Cre activity, detected using the R26R-stop-lacZ reporter line,
reflects known Ascl1 expression during neurogenesis in the developing
spinal cord. Ascl1-CreERTM;R26R-stop-lacZ embryos treated with
tamoxifen at E9.5, 10.5, 11.5 and 12.5 were harvested 24 hours later and
stained with X-gal (Fig. 3A-D).
In a similar way to the Acsl1-GIC (Fig.
2), strong expression in midbrain regions was initiated first in
sympathetic neurons, with neural tube just beginning to be detected at E10.5
(Fig. 3A,A'). At
E11.5-13.5, X-gal staining reflected Ascl1 expression and was
detected in the ventral telencephalon, midbrain and hindbrain, and dorsal
neural tube (Fig. 3B-D). By
contrast to X-gal staining in Ascl1-GIC, which reported an
accumulation of all Ascl1-derived cells, the Ascl1-CreERTM
reported a subset and illustrated the temporal control of Cre activity in this
transgenic line. For example, note the absence of sympathetic neuron labeling
at E11.5 and 12.5 in the Ascl1-CreERTM versus the
Ascl1-GIC (compare Fig.
2C,D with Fig.
3B,C). Vibratome sections from the whole-mount stained embryos
confirmed that Ascl1 lineage cells became sympathetic and ventral interneurons
before E10.5, and dorsal horn neurons at E11-13
(Fig. 3A'-D')
(Helms et al., 2005
;
Li et al., 2005
;
Lo et al., 1991
;
Mizuguchi et al., 2006
;
Wildner et al., 2006
).
Triple-label immunofluorescence on a cross section of an E10.5
Ascl1-CreERTM;R26R-stop-YFP embryo treated with tamoxifen at
E9.0 demonstrated accurate expression of Cre in the Ascl1 lineage in three
populations of neurons at this stage (Fig.
3E). The position of the YFP+ cells relative to Lhx1+ and/or Lhx5+
cells and the overlap with Lmx1b identified these cells as dorsal interneurons
dI3 and dI5, and a ventral neuronal population (V2), as has been previously
reported for Ascl1 lineages (Helms et al.,
2005
; Li et al.,
2005
). mRNA in situ hybridization of Cre in
Ascl1-CreERTM at E11.5 was restricted to the dorsal neural tube,
as expected for Ascl1 expression at this stage (compare
Fig. 2E,
Fig. 3F with
Fig. 3G). Interestingly, the
precise distribution of the mRNA accumulation in the mediolateral axis was
distinct from endogenous Ascl1, with the mRNA accumulating at the
lateral edges of the ventricular zone (Fig.
3G), suggesting a role for the 3' UTR in stabilization of
the mRNA (Verma-Kurvari et al.,
1998
). Overall, within the neural tube, the Cre activity in the
Ascl1-CreERTM transgenic line reflects expression recapitulating
endogenous Ascl1.
|
Ascl1 expression defines lineage-restricted precursors
Results from the experiments described above suggest that Ascl1 is present
in lineage-restricted precursor cells, both during neurogenesis and later
during oligodendrogenesis. To further test this idea, two experiments were
performed. One examined the fate of Ascl1-expressing cells from different
stages in the mature spinal cord (Fig.
4), and the other examined whether lineage-marked cells could be
found in cycling cells in the ventricular zone
(Fig. 5).
In the first experiment, R26R-stop-lacZ females crossed to Ascl1-CreERTM males were treated with tamoxifen at 10.5 dpc (embryos undergoing neurogenesis), or 15.5 dpc (embryos undergoing gliogenesis), and the resulting offspring were analyzed for lacZ expression at P30. Activation of Cre at E10.5 resulted in restricted and dense lacZ reporter activity in neurons of the dorsal horn primarily in Lamina I-III, and a few scattered cells in other parts of the gray matter (Fig. 4B). X-gal stained cells were noticeably absent from the spinal cord white matter and central canal (compare Fig. 2K and Fig. 4B). Within the dorsal horn, coexpression of ß-gal with NeuN but not APC using double-label immunofluorescence confirmed the identity of these cells as neurons (Fig. 4E,F). By contrast, activating Cre recombinase with tamoxifen at E15.5 resulted in a majority of the X-gal stained cells scattered throughout the white matter at P30 (Fig. 4C). The lineage-traced cells coexpressed the oligodendrocyte marker APC (Fig. 4H) but not the neuronal marker NeuN, even when located in the gray matter (Fig. 4C,G). The lacZ-expressing cells did not coexpress GFAP, indicating that they were not astrocytes (data not shown). Additional time points of tamoxifen treatment confirmed these findings (Fig. 4K-N). Tamoxifen treatment at E9.5 or 12.5 yielded neurons only, while tamoxifen in early postnatal stages yielded oligdendrocytes only. In the absence of tamoxifen, there was no leaky expression of the reporter detected. Thus, these results support the conclusion that Ascl1 is present in oligodendrocyte-restricted precursors in the spinal neural tube by E15.5.
To demonstrate that the experimental paradigm used here can detect Cre
activity in common neural progenitors in the ventricular zone, a novel
Nestin-CreERT2 mouse strain (see Materials and methods and
Fig. S1 in the supplementary material) that has a tamoxifen-inducible Cre
(Feil et al., 1996
;
Indra et al., 1999
) under the
control of the promoter and enhancer sequences of the Nestin gene
(Lendahl et al., 1990
;
Zimmerman et al., 1994
) was
used. Nestin is an intermediate filament protein that is transiently expressed
in progenitor cells common to neurons, oligodendrocytes and astrocytes
(reviewed by Wiese et al.,
2004
). By contrast to what was seen with the
Ascl1-CreERTM strain, activation of Cre in
Nestin-expressing cells at E10.5 and analysis at P30 resulted in
X-gal stained cells in both gray and white matter
(Fig. 4D). Consistent with the
presence of Nestin in neural progenitor cells in the ventricular zone, the
lineage-traced cells co-labeled with the neuronal marker NeuN, the
oligodendrocyte marker APC or the astrocytic marker GFAP
(Fig. 4I,J and data not
shown).
|
Ascl1 facilitates restriction of progenitor cells to the neuronal lineage during neurogenesis
It is known that Ascl1 functions in neuron differentiation and neuron
specification in mouse and chick spinal neural tubes
(Helms et al., 2005
;
Nakada et al., 2004
;
Torii et al., 1999
). Here we
address the role of Ascl1 in neuron-restricted precursors (
E11 marked
cells) by following their fate in an Ascl1 null background.
Ascl1-CreERTM;R26R-stop-YFP;Ascl1+/+ or
Ascl1-CreERTM;R26R-stop-YFP;Ascl1-/-embryos were
treated with tamoxifen at E10.5 and the characteristics of the YFP+ cells were
examined at E11.5 and 17.5 (Figs
5,
6). As reported in the previous
section, the recombined cells expressing YFP were postmitotic and found
lateral to the ventricular zone as soon as they could be detected
(Fig. 5A,A'). By
contrast, in the Ascl1 mutant, the YFP+ cells aberrantly persisted
in the ventricular zone, and some of these cells remained in the cell cycle
(Fig. 5B,B'). We next
examined whether the fate of these cells was altered in later development. As
the Ascl1 null is neonatal lethal
(Guillemot et al., 1993
), we
harvested embryos at E17.5. Normally most YFP+ cells generated from
the E10.5 tamoxifen treatment coexpressed NeuN, a neuronal marker (88%;
Fig. 6A, graph). Only rarely,
if at all, did the YFP+ cells express markers for oligodendrocytes
(Sox10+ or Olig2+;
Fig. 6B,E, graph), astrocytes
(GFAP+ or Glast+;
Fig. 6C,D) or mitotically
active cells (BrdU+ or Ki67+;
Fig. 6F, and data not shown).
By contrast, YFP+ cells in the Ascl1 null were less likely
to become neurons (54% NeuN+;
Fig. 6A') and more likely
to coexpress markers of the other cell identities
(Fig. 6B'-F'). The
percentage of YFP+ cells coexpressing Olig2 and Glast increased
from essentially zero to 16 and 22%, respectively
(Fig. 6D',E'). The
Olig2 cells probably represent immature oligodendrocytes, as there was no
increase in Sox10 (Fig.
6B'). Likewise, the increase in YFP+ cells
expressing Glast probably represents immature astrocytes, as they are largely
postmitotic, and thus not progenitor cells (only 1.8 and 0.63% of
YFP+ cells were BrdU+ or Ki67+, respectively;
Fig. 6F', graph), and
only a small percentage of YFP+ cells labeled with the astrocyte
marker GFAP+ (2%; Fig.
6C'). This shift in the fate of cells in the Ascl1
null from mature neurons to cells expressing immature glia markers supports a
role for Ascl1 for efficient differentiation of progenitors to a neuronal
lineage during neurogenesis.
| DISCUSSION |
|---|
|
|
|---|
|
We demonstrate that Ascl1 is required for efficient neuronal
differentiation. This supports conclusions from previous studies
(Casarosa et al., 1999
;
Horton et al., 1999
;
Torii et al., 1999
), but here
we follow the fate of the mutant cell into the late-stage embryo.
Ascl1 mutant cells identified at E10.5 were less likely to become
neurons (30% reduction) than if Ascl1 was present. The neurons that did
develop may have used an alternative neural bHLH factor such as Neurog1,
Neurog2 and Neurod4 (previously Ngn1, Ngn2 and Math3, respectively) and if so
the specification of neuronal type may be altered, as suggested by previous
studies (Helms et al., 2005
;
Kriks et al., 2005
;
Mizuguchi et al., 2006
;
Nakada et al., 2004
;
Wildner et al., 2006
). In
addition to the reduction in the percentage of YFP+ cells that became neurons,
in the Ascl1 null some cells were maintained in an aberrant
progenitor state - as defined by BrdU incorporation and expression of Ki67,
and expression of Olig2 in the absence of Sox10 - or aberrantly became
astrocytic as defined by Glast and GFAP expression
(Fig. 6). The simplest
interpretation of these data is that the mutant cells have a diminished
capacity to differentiate properly. However, this interpretation is
complicated by the fact that the loss of Ascl1 results in an increase in
expression from the Ascl1 locus due to negative feedback
(Horton et al., 1999
;
Meredith and Johnson, 2000
).
Thus, in the Ascl1 null, we may be detecting upregulation of Cre in
cells not normally expressing Ascl1.
The specific pathways controlled by Ascl1 continue to be an open question.
The best-characterized downstream effect of Ascl1 activity is the increase in
expression of the Notch ligands Delta1 and Delta3, which should activate Notch
signaling in adjacent cells and suppress differentiation (reviewed by
Yoon and Gaiano, 2005
). What
other changes in gene expression are controlled by Ascl1 to induce the cell to
differentiate? The transcriptional targets for Ascl1 may be the same in both
neurogenesis and oligodendrogenesis; however, it is also possible that the
downstream targets change during these two processes based on the
context-dependent co-factors.
Ascl1 in oligodendrocyte lineage-restricted precursor cells
Our results demonstrate Ascl1-expressing cells in the spinal
neural tube give rise to oligodendrocytes throughout the spinal cord dorsally
and ventrally, with an enrichment in the dorsal funiculus. Furthermore, the
Ascl1-derived oligodendrocytes begin appearing after E14.5, suggesting that
they may represent the latedeveloping oligodendrocytes originating from the
dorsal neural tube rather than the early oligodendrocytes generated as early
as E12.5 from more ventral regions (reviewed by
Cai et al., 2005
;
Fogarty et al., 2005
;
Richardson et al., 2006
;
Vallstedt et al., 2005
).
Expression of Pax7 and Ascl1 in a subset of the Olig2 cells at E14.5 suggested
that the dorsal oligodendrocytes originate from dP3, dP4 and dP5
(Cai et al., 2005
), progenitor
domains defined by Ascl1 (Gross et al.,
2002
; Helms et al.,
2005
; Müller et al.,
2002
). We used a newly generated antibody to demonstrate that at
E16.5 Ascl1 was not restricted to dorsal domains but rather was detected
throughout the ventricular zone and in scattered cells of the gray and white
matter. This suggests that the oligodendrocytes derived from these cells are
late formed but are not necessarily restricted to a dorsal origin. However,
genetic fate mapping of another gene, Msx3, which is restricted to the dorsal
neural tube, resulted in oligodendrocytes concentrated in the dorsal funiculus
(M. Fogarty, Thesis, University of London, 2005), similar to that seen here
for Ascl1. This contrasts with the distribution of oligodendrocytes derived
from nestin-expressing cells from
E11
(Fig. 4C,D), illustrating the
distinct temporal and spatial origins of these populations.
The function of Ascl1 in the oligodendrocyte lineage in the spinal cord has
not been addressed in the Ascl1 mutant. Discerning the phenotype in
the oligodendrocyte population is complicated by the disruption of the
progenitor domain at earlier stages (Figs
5,
6). However, a role for Ascl1
in the development of the oligodendrocyte lineage in the postnatal brain has
recently been examined (Parras et al.,
2004
). The SVZ in the postnatal forebrain is the source for the
rostral migratory stream (RMS), which supplies the olfactory bulb with neurons
and oligodendrocytes (Marshall et al.,
2003
; Pencea and Luskin,
2003
). Recently, it was demonstrated using a short-term
lineage-tracing method that Ascl1 in the SVZ and RMS identifies the
transit amplifying cells that give rise to these cells
(Parras et al., 2004
).
Furthermore, in the Ascl1 mutant, neurosphere cultures derived from
this region are altered in their potential; they have a decreased ability to
generate both the neurons and oligodendrocytes, whereas there is an increase
in generation of astrocytes (Parras et
al., 2004
). The precise function of Ascl1 in the oligodendrocyte
lineage in embryonic and postnatal stages remains to be determined.
Understanding the full repertoire of Ascl1 function in nervous system
development will require dissection of these functions in a conditional
Ascl1 knockout paradigm.
The results presented here place Ascl1 distinctly in cells that are transitioning from cycling progenitor or stem cells to progenitors with limited potential for cell division and restrictions on the cell types formed. Importantly, oligodendrocytes derived from the Ascl1 lineage may be more extensive than previously appreciated. Indeed, Ascl1 cannot be thought of as simply a neuronal differentiation factor, but rather as a more general differentiation factor, and the cell type that arises depends on the stage at which Ascl1 is expressed.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/2/285/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Akagi, T., Inoue, T., Miyoshi, G., Bessho, Y., Takahashi, M.,
Lee, J. E., Guillemot, F. and Kageyama, R. (2004).
Requirement of multiple basic helix-loop-helix genes for retinal neuronal
subtype specification. J. Biol. Chem.
279,28492
-28498.
Beech, R. D., Cleary, M. A., Treloar, H. B., Eisch, A. J., Harrist, A. V., Zhong, W., Greer, C. A., Duman, R. S. and Picciotto, M. R. (2004). Nestin promoter/enhancer directs transgene expression to precursors of adult generated periglomerular neurons. J. Comp. Neurol. 475,128 -141.[CrossRef][Medline]
Bertrand, N., Castro, D. S. and Guillemot, F. (2002). Proneural genes and the specification of neural cell types. Nat. Rev. Neurosci. 3, 517-530.[CrossRef][Medline]
Birren, S. J., Lo, L. and Anderson, D. J. (1993). Sympathetic neuroblasts undergo a developmental switch in trophic dependence. Development 119,597 -610.[Abstract]
Blaugrund, E., Pham, T. D., Tennyson, V. M., Lo, L., Sommer, L., Anderson, D. J. and Gershon, M. D. (1996). Distinct subpopulations of enteric neuronal progenitors defined by time of development, sympathoadrenal lineage markers and Mash-1-dependence. Development 122,309 -320.[Abstract]
Cai, J., Qi, Y., Hu, X., Tan, M., Liu, Z., Zhang, J., Li, Q., Sander, M. and Qiu, M. (2005). Generation of oligodendrocyte precursor cells from mouse dorsal spinal cord independent of Nkx6 regulation and Shh signaling. Neuron 45, 41-53.[CrossRef][Medline]
Casarosa, S., Fode, C. and Guillemot, F. (1999). Mash1 regulates neurogenesis in the ventral telencephalon. Development 126,525 -534.[Abstract]
Cau, E., Gradwohl, G., Fode, C. and Guillemot, F. (1997). Mash1 activates a cascade of bHLH regulators in olfactory neuron progenitors. Development 124,1611 -1621.[Abstract]
Farah, M. H., Olson, J. M., Sucic, H. B., Hume, R. I., Tapscott, S. J. and Turner, D. L. (2000). Generation of neurons by transient expression of neural bHLH proteins in mammalian cells. Development 127,693 -702.[Abstract]
Feil, R., Brocard, J., Mascrez, B., LeMeur, M., Metzger, D. and
Chambon, P. (1996). Ligand-activated site-specific
recombination in mice. Proc. Natl. Acad. Sci. USA
93,10887
-10890.
Fogarty, M., Richardson, W. D. and Kessaris, N.
(2005). A subset of oligodendrocytes generated from radial glia
in the dorsal spinal cord. Development
132,1951
-1959.
Gokhan, S., Marin-Husstege, M., Yung, S. Y., Fontanez, D.,
Casaccia- Bonnefil, P. and Mehler, M. F. (2005).
Combinatorial profiles of oligodendrocyte-selective classes of transcriptional
regulators differentially modulate myelin basic protein gene expression.
J. Neurosci. 25,8311
-8321.
Gowan, K., Helms, A. W., Hunsaker, T. L., Collisson, T., Ebert, P. J., Odom, R. and Johnson, J. E. (2001). Crossinhibitory activities of Ngn1 and Math1 allow specification of distinct dorsal interneurons. Neuron 31,219 -232.[CrossRef][Medline]
Gross, M. K., Dottori, M. and Goulding, M. (2002). Lbx1 specifies somatosensory association interneurons in the dorsal spinal cord. Neuron 34,535 -549.[CrossRef][Medline]
Guillemot, F. and Joyner, A. (1993). Expression of murine Achaete-Scute and Notch homologues in the developing central nervous system. Mech. Dev. 42,171 -185.[CrossRef][Medline]
Guillemot, F., Lo, L. C., Johnson, J. E., Auerbach, A., Anderson, D. J. and Joyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required for the early development of olfactory and autonomic neurons. Cell 75,463 -476.[CrossRef][Medline]
Haubensak, W., Attardo, A., Denk, W. and Huttner, W. B.
(2004). Neurons arise in the basal neuroepithelium of the early
mammalian telencephalon: a major site of neurogenesis. Proc. Natl.
Acad. Sci. USA 101,3196
-3201.
Hayashi, S. and McMahon, A. P. (2002). Efficient recombination in diverse tissues by a tamoxifen-inducible form of Cre: a tool for temporally regulated gene activation/inactivation in the mouse. Dev. Biol. 244,305 -318.[CrossRef][Medline]
Helms, A. W., Battiste, J., Henke, R. M., Nakada, Y., Simplicio,
N., Guillemot, F. and Johnson, J. E. (2005). Sequential roles
for Mash1 and Ngn2 in the generation of dorsal spinal cord interneurons.
Development 132,2709
-2719.
Hirsch, M. R., Tiveron, M. C., Guillemot, F., Brunet, J. F. and Goridis, C. (1998). Control of noradrenergic differentiation and Phox2a expression by MASH1 in the central and peripheral nervous system. Development 125,599 -608.[Abstract]
Hogan, B., Costantini, F. and Lacy, E. (1986). Manipulating the Mouse Embryo: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Horton, S., Meredith, A., Richardson, J. A. and Johnson, J. E. (1999). Correct coordination of neuronal differentiation events in ventral forebrain requires the bHLH factor MASH1. Mol. Cell. Neurosci. 14,355 -369.[CrossRef][Medline]
Huttner, W. B. and Kosodo, Y. (2005). Symmetric versus asymmetric cell division during neurogenesis in the developing vertebrate central nervous system. Curr. Opin. Cell Biol. 17,648 -657.[CrossRef][Medline]
Indra, A. K., Warot, X., Brocard, J., Bornert, J. M., Xiao, J.
H., Chambon, P. and Metzger, D. (1999). Temporally-controlled
site-specific mutagenesis in the basal layer of the epidermis: comparison of
the recombinase activity of the tamoxifen-inducible Cre-ER(T) and Cre-ER(T2)
recombinases. Nucleic Acids Res.
27,4324
-4327.
Johnson, J. E., Birren, S. J. and Anderson, D. J. (1990). Two rat homologues of Drosophila achaete-scute specifically expressed in neuronal precursors. Nature 346,858 -861.[CrossRef][Medline]
Kondo, T. and Raff, M. (2000). Basic helix-loop-helix proteins and the timing of oligodendrocyte differentiation. Development 127,2989 -2998.[Abstract]
Kriks, S., Lanuza, G. M., Mizuguchi, R., Nakafuku, M. and
Goulding, M. (2005). Gsh2 is required for the repression of
Ngn1 and specification of dorsal interneuron fate in the spinal cord.
Development 132,2991
-3002.
Lendahl, U., Zimmerman, L. B. and McKay, R. D. G. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60,585 -595.[CrossRef][Medline]
Li, S., Misra, K., Matise, M. P. and Xiang, M.
(2005). Foxn4 acts synergistically with Mash1 to specify subtype
identity of V2 interneurons in the spinal cord. Proc. Natl. Acad.
Sci. USA 102,10688
-10693.
Lo, L.-C., Johnson, J. E., Wuenschell, C. W., Saito, T. and
Anderson, D. J. (1991). Mammalian achaete-scute
homolog 1 is transiently expressed by spatially-restricted subsets of early
neuroepithelial and neural crest cells. Genes Dev.
5,1524
-1537.
Lyons, D. A., Guy, A. T. and Clarke, J. D.
(2003). Monitoring neural progenitor fate through multiple rounds
of division in an intact vertebrate brain. Development
130,3427
-3436.
Ma, Q., Sommer, L., Cserjesi, P. and Anderson, D. J.
(1997). Mash1 and neurogenin1 expression patterns define
complementary domains of neuroepithelium in the developing CNS and are
correlated with regions expressing notch ligands. J.
Neurosci. 17,3644
-3652.
Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L. and Anderson, D. J. (1998). neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia. Neuron 120,469 -482.
Marshall, C. A., Suzuki, S. O. and Goldman, J. E. (2003). Gliogenic and neurogenic progenitors of the subventricular zone: who are they, where did they come from, and where are they going? Glia 43,52 -61.[CrossRef][Medline]
Meredith, A. and Johnson, J. E. (2000). Negative regulation of Mash1 expression in CNS development. Dev. Biol. 222,336 -346.[CrossRef][Medline]
Miyata, T., Kawaguchi, A., Saito, K., Kawano, M., Muto, T. and
Ogawa, M. (2004). Asymmetric production of surface-dividing
and non-surface-dividing cortical progenitor cells.
Development 131,3133
-3145.
Mizuguchi, R., Kriks, S., Cordes, R., Gossler, A., Ma, Q. and Goulding, M. (2006). Ascl1 and Gsh1/2 control inhibitory and excitatory cell fate in spinal sensory interneurons. Nat. Neurosci. 9,770 -778.[CrossRef][Medline]
Müller, T., Brohmann, H., Pierani, A., Heppenstall, P. A., Lewin, G. R., Jessell, T. M. and Birchmeier, C. (2002). The homeodomain factor Lbx1 distinguishes two major programs of neuronal differentiation in the dorsal spinal cord. Neuron 34,551 -562.[CrossRef][Medline]
Müller, T., Anlag, K., Wildner, H., Britsch, S., Treier, M.
and Birchmeier, C. (2005). The bHLH factor Olig3 coordinates
the specification of dorsal neurons in the spinal cord. Genes
Dev. 19,733
-743.
Nakada, Y., Hunsaker, T. L., Henke, R. M. and Johnson, J. E.
(2004). Distinct domains within Mash1 and Math1 are required for
function in neuronal differentiation versus cell-type specification.
Development 131,1319
-1330.
Noctor, S. C., Martinez-Cerdeno, V., Ivic, L. and Kriegstein, A. R. (2004). Cortical neurons arise in symmetric and asymmetric division zones and migrate through specific phases. Nat. Neurosci. 7,136 -144.[CrossRef][Medline]
Parras, C. M., Galli, R., Britz, O., Soares, S., Galichet, C., Battiste, J., Johnson, J. E., Nakafuku, M., Vescovi, A. and Guillemot, F. (2004). Mash1 specifies neurons and oligodendrocytes in the postnatal brain. EMBO J. 23,4495 -4505.[CrossRef][Medline]
Pattyn, A., Simplicio, N., van Doorninck, J. H., Goridis, C., Guillemot, F. and Brunet, J. F. (2004). Ascl1/Mash1 is required for the development of central serotonergic neurons. Nat. Neurosci. 7,589 -595.[CrossRef][Medline]
Pencea, V. and Luskin, M. B. (2003). Prenatal development of the rodent rostral migratory stream. J. Comp. Neurol. 463,402 -418.[CrossRef][Medline]
Petersen, P. H., Zou, K., Hwang, J. K., Jan, Y. N. and Zhong, W. (2002). Progenitor cell maintenance requires numb and numblike during mouse neurogenesis. Nature 419,929 -934.[CrossRef][Medline]
Porteus, M. H., Bulfone, A., Liu, J.-K., Puelles, L., Lo, L.-C. and Rubenstein, J. L. R. (1994). DLX-2, MASH-1, and MAP-2 expression and bromodeoxyuridine incorporation define molecularly distinct cell populations in the embryonic mouse forebrain. J. Neurosci. 14,6370 -6383.[Abstract]
Qian, X., Goderie, S. K., Shen, Q., Stern, J. H. and Temple, S. (1998). Intrinsic programs of patterned cell lineages in isolated vertebrate CNS ventricular zone cells. Development 125,3143 -3152.[Abstract]
Qian, X., Shen, Q., Goderie, S. K., He, W., Capela, A., Davis, A. A. and Temple, S. (2000). Timing of CNS cell generation: a programmed sequence of neuron and glial cell production from isolated murine cortical stem cells. Neuron 28, 69-80.[CrossRef][Medline]
Richardson, W. D., Kessaris, N. and Pringle, N. (2006). Oligodendrocyte wars. Nat. Rev. Neurosci. 7,11 -18.[CrossRef][Medline]
Roegiers, F. and Jan, Y. N. (2004). Asymmetric cell division. C