|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 12 September 2007
doi: 10.1242/dev.005280
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

University of California San Francisco, Cardiovascular Research Institute, Box 2711, Rock Hall Room 384D, 1550 4th Street, San Francisco, CA 94158-2324, USA.
Author for correspondence (e-mail:
takashi.mikawa{at}ucsf.edu)
Accepted 27 July 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Proepicardium, Epicardium, Coronary vessel, Liver bud, Transcription factor, Wilms tumor 1, Capsulin (Epicardin, Pod1, Tcf21), Tbx18, Cfc1, Pax2, Paracrine signal, Heart development, Chick
| INTRODUCTION |
|---|
|
|
|---|
Physical blockage of PE cell entry to the embryonic heart results in the
loss of epicardial and coronary vessel formation
(Gittenberger-de Grott et al.,
2000
; Männer,
1993
; Pennisi et al.,
2003
). Although these studies demonstrate that the PE is the major
bona fide source of the coronary vasculature and that there is a specific
pathway through which PE cells reach the heart, nothing is known about how a
particular mesothelial cell population is induced to differentiate into the
PE. Genetic experiments suggest that PE development requires both cell
autonomous and non-autonomous activities. Epithelial-to-mesenchymal transition
from the epicardium requires Fog2 (friend of Gata2) expression in the
myocardium (Tevosian et al.,
2000
). Targeted inactivation of the Wilms tumor gene Wt1
results in incomplete epicardial coverage of the heart with fewer
subepicardial cells present (Moore et al.,
1999
). Migration of PE-derived cells is also impaired by
overexpression and antisense-mediated knockdown of the T-box transcription
factor gene Tbx5 in chick
(Hatcher et al., 2004
).
Disruption of the zinc-finger transcription factor gene Gata4 results
in defective PE formation (Watt et al.,
2004
). Recent studies suggest the involvement of secreted
signaling molecules in the specification and maintenance of the PE cell fate.
In mouse, the activity of the Gata4 lateral plate enhancer is
attenuated by the bone morphogenetic protein (BMP) antagonist noggin,
suggesting a role for BMP signaling in PE development
(Rojas et al., 2005
). In vitro
culture experiments suggest that BMP and fibroblast growth factor (FGF)
signaling activities can influence differentiation of the PE
(Kruithof et al., 2006
;
Schlueter et al., 2006
).
Although the above and other studies have provided significant insights
into the molecular basis of PE development, little is known about mechanisms
that initiate PE formation within the embryonic mesothelium. However, it is
known that the PE develops from a mesodermal cell population that overlays the
liver bud endoderm (Männer,
1992
; Männer et al.,
2001
; Nahirney et al.,
2003
; Virágh et al.,
1993
). Here, we tested the potential role of the liver bud in PE
induction. Data are presented to demonstrate that the liver bud can induce
expression of the PE marker genes Wt1, capsulin (also known as
Tcf21, epicardin and pod1) and Tbx18, both in vitro
and in vivo. The competency of mesothelium to respond to an inductive cue from
the liver bud is developmentally regulated. These data suggest that a
developmentally regulated competency of mesodermal cells to a localized
inductive signal might play a role in induction of the proepicardial marker
genes within the mesothelium.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Histology
Embryos were fixed with 10% formalin in phosphate-buffer (pH 7.2),
dehydrated through graded series of ethanol, embedded in paraffin and
sectioned at 6 µm. The sections were stained with hematoxylin and
eosin.
In situ hybridization
Using the following primers, we carried out reverse transcriptase (RT)-PCR
to obtain DNA templates for the synthesis of digoxigenin (Wt-1 and
capsulin) or fluorescein (Hex, also known as Prh and
Probox)-labeled riboprobes. For Wt1,
5'-CTGGCACTCGTCGGACATCT-3' and CGGACCCCCTACAACAGTGA; for capsulin,
5'-TCACACACGCTCACTCACTGACTC-3' and
5'-TCTGGACCTGCTTTCCTTCCTG-3'; for Hex,
5'-GACAAAGAAGCAACGGACTC-3' and
5'-GGCAAAATCCTCCAAAATGCG-3'. After PCR products were ligated into
the pCRII-TOPO plasmid vector (Invitrogen, CA), the sequence and orientation
of the inserts were confirmed by sequencing. The plasmid used to synthesize
the digoxigenin-labeled Pax2 probe
(Obara-Ishihara et al., 1999
)
was a gift from Dr Herzlinger (Cornell University Medical College, New York,
NY). We used a 1 kb partial cDNA clone of Tbx18 and 1 kb full-length
cDNA of Cfc1 (Schlueter et al.,
2006
) kindly provided by Dr Brand (University of Würzburg,
Germany). Normal or implanted embryos were fixed with 4% paraformaldehyde and
processed for single or double whole-mount in situ hybridization
(Hurtado and Mikawa, 2006
).
For double in situ hybridization, modifications were made as follows. A
riboprobe for Wt1 was first detected using anti-digoxigenin antibody
and NBT/BCIP substrate. After the removal of the antibody by incubating twice
with glycine-HCl (pH 2.2), the Hex probe was detected using
anti-fluorescein antibody and BCIP substrate. After color development was
completed, embryos were fixed with 4% paraformaldehyde in phosphate-buffered
saline (PBS), embedded in wax and sectioned at 10 µm using a microtome.
Explant culture
Chick lateral embryonic fragments (cLEF) were isolated from the 4- to
7-somite level of stage 10-11 embryos, excluding the hepatogenic endoderm
demarked by Hex expression according to Zhang et al.
(Zhang et al., 2004
). The
quail liver buds (qLiB) and PE (qPE) were isolated from stage 17 embryos using
a fine glass capillary and finely sharpened forceps. Lung buds (qLuB) were
isolated from stage 20-21 quail embryos and freed from Wt1- positive
mesothelium (Carmona et al.,
2001
). These embryonic tissue fragments were either cultured alone
or co-cultured with various combinations in a hanging drop (20 µl) of
Medium 199 (Invitrogen, CA) for 24 or 44 hours in a CO2
incubator.
RNA isolation, RT-PCR and qRT-PCR
Total RNA was isolated from cultured explants with Trizol (Invitrogen, CA)
according to the manufacturer's instructions. RNA (20-70 ng) was reverse
transcribed in 10 µl total volume using SuperScript First-Strand Synthesis
System for RT-PCR (Invitrogen, CA) with an oligo (dT)12-18 primer.
A negative control was done in parallel without SuperScript II reverse
transcriptase. PCR amplification was performed in a 25 µl total volume
using Taq DNA polymerase (New England Biolabs, MA). Glyceraldehyde-3-phosphate
dehydrogenase (Gapdh) was used to normalize the template input
(1/60-1/320 of the total reverse-transcription reaction). The number of cycles
was optimized for each primer pair to remain within the linear range of
amplification. Electrophoresis of PCR samples (5 µl) was conducted on a
1.5% agarose gel. Kodak EDAS 290 (Kodak, NY) was used to capture digital
images of the gel. Relative levels of band intensity were quantified by using
Multi-Analyst version 1.0.2 software (Bio-Rad Laboratories, CA). Primers used
for PCR were as follows. For chick/quail Wt1 (c/qWt1),
5'-TCTAGGGGACCAGCAGTACTC-3' and
5'-GATATGGTTTTTCACCAGTGTGC-3'; for chick/quail capsulin
(c/qcapsulin), 5'-GGGTCCTCTCTGGATCTATATCAC-3' and
5'-GCCATTCTCGCCATTGGAT-3'; for chick/quail Pax2
(c/qPax2), 5'-AAGTAGCGACCCCCAAAGTAGTG-3' and
5'-CCCTCGGATACATCTTCATCACG-3'; for chick/quail Gapdh
(c/qGapdh), 5'-CAGCCTTCACTACCCTCTTG-3' and
5'-ACGCCATCACTATCTTCCAG-3'; for chick Gapdh
(cGadph), 5'-GGCATTGCACTGAATGACCAT-3' and
5'-TCTCCCACCTCCCCCAGGTG-3'; for quail Gapdh
(qGadph), 5'-GGCATTGCACTGAATGACAAC-3' and
5'-TCTCCCACCTCCCCCAGGCT-3'; for chick Wt1
(cWt1), 5'-ACAATTTGTACCAAATGACGTCACAA-3' and
5'-GATGGGACAGCTTGAAGTATCG-3'; for chick Tbx18
(cTbx18), 5'-GGAATTTGAAGACAAATAACACA-3' and
5'-AAGGGAATTTCTCATACTGCG-3'; for chick Cfc1
(cCfc1), 5'-GTCTGCGCTGATTTGCCTTCTCAC-3' and
5'-ACAATGAAAATTCAATACTTAAGGCATAG-3'. The same primer sets were
used for quantitative real-time PCR (qRT-PCR) using the ABI 7900HT sequence
detection system (Applied Biosystems, CA) and BIO-RAD iTaq SYBR Green Supermix
with ROX (Bio-Rad Laboratories, CA). Relative levels of gene expression were
quantified based on the threshold cycle obtained from three independent
reactions and were normalized to cGapdh.
Implantation and whole-embryo culture
Chick embryos were set-up in whole-embryo culture as previously described
[EC method (Chapman et al.,
2001
)]. Briefly, the embryos were attached to pieces of filter
paper and placed on agar/albumen gel (50% thin albumen, 0.0615 M NaCl, 0.3%
Bacto-Agar, Becton Dickinson, MD) after removal of the yolk. Donor tissues,
such as the liver bud, lung bud, stomach and sinoatrial myocardium were
isolated from quail embryos at stages 17 and 21-22. Stomach was identified as
a swelling of the gut tube immediately posterior to the lung bud. After
isolation, it was cut into four pieces to obtain similar-sized implants as the
liver bud and lung bud. Sinoatrial myocardium was isolated from stage 17
embryos. In our hands, isolation of these endodermal tissues at or before
stage 16 was unsuccessful. Implants were placed in various sites of posterior
lateral regions of the chick host at various developmental stages. Operated
embryos were incubated at 38°C for 20 hours in a humidified chamber.
Implantation was made mainly on the left side of the host embryo to avoid the
prominent Wt1 expression on the right side of the embryo
(Schlueter et al., 2006
); the
contralateral side acted as a negative control.
Immunohistochemistry
Embryos were fixed in 4% paraformaldehyde in PBS for 2-4 hours at 4°C,
cryoprotected by 30% sucrose in PBS and embedded in OCT compound for frozen
sectioning. Frozen sections 12 µm thick were cut, rehydrated in PBS and
incubated with blocking solution (1% bovine serum albumin and 0.5% TritonX-100
in PBS). Sections were incubated at 4°C overnight with primary antibodies
diluted in blocking solution. Primary antibodies used in this study were the
following: monoclonal QCPN antibody (supernatant, Developmental Studies
Hybridoma Bank, IA) diluted 1:8, rabbit anti-Wt1 antibody (C19, Santa-Cruz,
CA) diluted 1:50, and rabbit anti-Pax2 antibody (Zymed, CA) diluted 1:50.
After three washes with PBS, the sections were incubated with secondary
antibodies (goat anti-mouse IgG conjugated with Alexa-Fluor-488 and/or goat
anti-rabbit IgG conjugated with Alexa-Fluor-594; Molecular Probes, OR) and
4',6-diamidino-2-phenylindole (DAPI; for counter staining) for 2 hours
at room temperature. Sections were washed three times in PBS and mounted with
Aqua Poly/Mount (Polysciences, PA). Images were captured by using a Spot RT
Slider 2.3.1 (Diagnostic Instruments, MI) and Spot software 3.5.9 (Diagnostic
Instruments, MI). Adobe Photoshop 7.0.1 (Adobe Systems, CA) was used to
pseudocolor and superimpose the captured images.
|
| RESULTS |
|---|
|
|
|---|
Although all four PE marker genes were detectable in our in situ
hybridization condition, none of these markers is exclusive to the PE.
Expression of both Wt1 and capsulin were also detected in the
intermediate mesoderm (Fig.
1A,C,E,G and Fig.
2A,B). Tbx18 was expressed not only in the PE but also in
the somites, intermediate mesoderm and limb bud
(Fig. 1I,K and
Fig. 2C), consistent with
previous reports (Haenig and Kispert,
2004
). Cfc1 expression was widely detectable in the
lateral plate mesoderm and the myocardium of looping heart tube in addition to
the PE (Fig. 1M,N and
Fig. 2D), as reported
(Schlueter et al., 2006
).
Therefore, there appears to be no single PE marker that can distinguish the
induction or specification of the PE fate from those of other mesodermal
tissues, such as the intermediate mesoderm. However, the expression of a
transcription factor, Pax2, was detected in the intermediate
mesoderm, as previously described
(Obara-Ishihara et al., 1999
),
but was absent in the PE cells (Fig.
2E). Consistent results were obtained from our immunohistochemical
analysis (Fig. 2F,G). The
intermediate mesoderm is immunoreactive to both anti-Wt1 and anti-Pax2
antibodies. By contrast, the PE showed a detectable level of immunoreactivity
for Wt1 but not for Pax2. Thus, the differential expression of Pax2
allowed us to distinguish the induction of characteristics of the PE from
those of the intermediate mesoderm in the present study.
In vitro induction of PE marker expression
To examine whether the liver bud has the capacity to induce PE marker gene
expression in mesodermal cells, we developed a simple explant co-culture assay
system (Fig. 3A). In brief, a
chick lateral embryonic fragment was isolated as the responder tissue at stage
10-11 (prior to overt induction of bona fide PE cells) and was co-cultured
with the quail liver bud as the inducer tissue. Using reverse transcriptase
(RT)-PCR, relative amounts of PCR products of the positive PE marker genes
Wt1 and capsulin, and of a negative marker gene, Pax2, were
examined (Fig. 3B,C). Under our
RT-PCR conditions, weak signals for Wt1, capsulin, and Pax2
were detected in a control explant, which contained a responder tissue alone.
By contrast, significantly stronger signals of Wt1 and capsulin were
obtained when a responder lateral tissue was co-cultured with an inducer liver
bud (Fig. 3B), exhibiting a
two- to three-fold increase of signal intensity
(Fig. 3C). Importantly, no
significant increase of an intermediate mesoderm marker, Pax2, was
induced by co-cultured liver bud (Fig.
3B,C).
|
In vivo liver bud implantation leads to ectopic expression of PE marker genes
The above results suggest that the liver bud has a capacity to induce PE
marker expressions in a co-cultured lateral fragment of early embryos.
However, we still do not know whether the liver bud can exert such inductive
effects in vivo. It also remains unclear whether all or a part of responding
tissues are induced to express PE marker genes. We addressed these points in
the in vivo implantation assay, which provides spatial resolution of the
competent tissues. The in vivo inductive potency of the liver bud on PE marker
expression was tested by implanting single donor quail liver buds into host
chick embryo and analyzing ectopic expression of PE marker genes in host
tissues at the site of implantation (Fig.
4). A quail liver bud was implanted into 13- to 20-somite levels
of the host chick embryo at stages 12-14
(Fig. 4A,B). Implanted embryos
were allowed to develop on an agar-albumen gel
(Chapman et al., 2001
) for 20
hours. To control for the effects of implantation, a lung bud was implanted
into different embryos. Ectopic expression of PE marker genes at the implanted
site was examined by whole-mount in situ hybridization. Ectopic capsulin gene
expression was detected at the implanted site in 55.0% of liver bud-implanted
embryos (6/11; Fig. 4C,D),
whereas ectopic expression of Tbx18 was found in 37.5% (3/8;
Fig. 4E,F). In no case was
Pax2 expression induced at the site of liver bud implantation
(Fig. 4G,H). In situ
hybridization for Hex transcripts in implanted embryos showed
positive signals at the implanted site in all cases (n=5)
(Fig. 4I,J), suggesting that
implanted liver bud retains its hepatic identity. In addition, none of the
lung-implanted embryos (capsulin, n=4; Tbx18, n=6) showed
ectopic expression of these markers (Fig.
4K-N). The data suggested that ectopic PE marker expression is
induced by implanted liver bud in a tissue-specific manner, rather than as a
result of either a surgical operation or the presence of exogenous tissue.
These data, however, did not rule out the possibility that ectopic
expression of PE marker genes might be due to the gene expression in donor
cells, such as contaminating bona fide PE progenitor cells, rather than to
induced expression in surrounding host cells. In our hands, it was difficult,
if not impossible, to precisely identify a donor quail tissue in a host chick
embryo using in situ hybridization. To clarify whether induction occurs in the
host-derived tissue or in donor cells, we used immunohistochemistry, which
provided higher resolution for the analysis of both the distribution of donor
cells and marker gene expression in implanted embryos. The donor cells were
detected using the QCPN antibody, which is specific for quail-derived implant
tissue (Selleck and Bronner-Fraser,
1995
), and induced expression of a PE marker was identified using
a monoclonal antibody specific for Wt1 (Figs
5,
6).
Out of 18 liver bud-implanted embryos, five developed with malformations,
and 13 developed without any detectable malformation
(Fig. 5A,B). Only the latter
population was processed for subsequent immunohistochemical inspection. Strong
fluorescent signals of endogenous Wt1 were detected in the intermediate
mesoderm and dorsal mesothelium (Fig.
5C,D; asterisks), as seen in the above whole-mount in situ
hybridization data (Fig. 2).
The data are also consistent with the previous studies
(Carmona et al., 2001
). In
addition, ectopic nuclear staining for Wt1 was detected adjacent to the
QCPN-positive donor tissue (9/13; Fig.
5C), although fluorescent signals of the ectopic Wt1 were
significantly weaker than those of endogenous Wt1 seen in intermediate
mesoderm and dorsal mesothelium. Higher-magnification inspection revealed that
ectopic Wt1 staining was predominantly detected in the host-derived cells in
the mesothelial lining of the body cavity and was rarely seen in other host
tissues, such as the underlying mesenchymal tissue, or in the implant itself
(Fig. 5D). Sister sections
double-immunostained with anti-Pax2 and QCPN antibodies showed no evidence for
ectopic Pax2 expression in the host tissue at the implanted site
(Fig. 5E,F).
|
Induction of PE marker genes was not evident when other endoderm-derived tissues, such as lung (n=6) and stomach (n=6), were used (Fig. 6A-L), although weak fluorescent signals above the background level were observed in some stomach-implanted embryos (Fig. 6G-L). These results demonstrate that the liver bud is capable of inducing surrounding mesodermal cells, particularly mesothelial cells, to express PE marker genes. The data also show that the mesodermal cell population preferentially responds to instructive cue(s) provided by the liver bud, more so than other endoderm-derived tissues.
In addition to the liver bud, the sinoatrial myocardium has been suggested
to be a potential source of inductive signals
(Majesky, 2004
). Quail-derived
sinoatrial myocardium was implanted into the posterior lateral region of stage
12-13 host chick embryos. After 20 hours of incubation, the embryos were
fixed, cryosectioned and stained with anti-Wt1 or anti-Pax2 antibodies. No
embryos (n=5) showed a detectable level of ectopic Wt1 or Pax2
expression adjacent to the myocardial implant (data not shown).
Dynamic changes of PE-inducing activity and competency during embryogenesis
Whereas the liver continuously develops and exists throughout much of
embryogenesis, PE formation takes place during a defined embryonic-stage
window, stages 14-17. This suggested to us that the production of inducing
signal(s) by the liver bud and/or competency of the mesoderm to respond to
these signals is developmentally and spatially regulated. To address this
possibility, induction of PE marker gene expression was monitored at various
regions of host chick embryos at different developmental stages, by implanting
liver buds obtained from the donor quail embryo at different developmental
stages (Fig. 6M-X). Induction
of Wt1 expression was not seen when host chick embryos were younger than stage
12 (0/11, Fig. 6M-R),
regardless of implantation sites in the posterior-lateral region
(Fig. 7, left). By contrast,
induction of Wt1 expression was evident with a higher frequency (5/11;
Fig. 7, middle) when stage 17
liver bud (Fig. 5) was
implanted in host embryos at stages 12-13-. The inductive activity
of liver fragments from stage 21-22 embryos was less prominent, as judged by
signal intensity in ectopic Wt1-positive cells and by the number of these
cells (Fig. 6S-X).
|
| DISCUSSION |
|---|
|
|
|---|
Inductive interaction(s) between the liver bud and mesothelium
The close association between PE formation and liver development has been
shown previously by morphological studies
(Männer, 1992
;
Männer et al., 2001
;
Nahirney et al., 2003
;
Virágh et al., 1993
).
Consistent with these reports, our histological and in situ hybridization
analyses have revealed the close proximity between developing PE and liver
bud. Transcripts of PE marker genes in the PE-forming region become detectable
by stage 11-12, just before the PE development becomes morphologically
detectable. Wt1-positive cells were seen in the mesothelium on the
right side of the embryo in close proximity to the Hex-positive liver
bud, which is also more pronounced on the right side. Close association
between the liver bud and PE was also seen at later stages, when PE villi were
seen in the vicinity of underlying liver bud or liver primordium. Thus, the
spatial proximity of the liver bud and PE-forming site is consistent with
inductive interactions between these two embryonic tissues.
|
Although expression of Wt1 and capsulin is not detectable in the
myocardium or endocardium, they are both highly expressed in the intermediate
mesoderm (Carmona et al., 2001
;
Hidai et al., 1998
;
Moore et al., 1999
;
von Scheven et al., 2006
).
Therefore, Wt1, capsulin and Tbx18 alone cannot discriminate
induction of the PE from that of non-PE cell types, including the intermediate
mesoderm. However, we found that expression of an intermediate mesoderm
marker, Pax2, is not detectable in the PE. Thus, the present study
monitored the inductive role of the liver bud by analyzing the expression of
both Wt1, capsulin and Tbx18 as positive PE markers and
Pax2 as a negative PE marker. Identification of more molecular
markers specific to PE cells will be needed to assign a definitive role to
liver bud-derived cue(s) in PE induction.
|
|
Inductive activity of the liver bud
Our data suggest that a high capacity to induce PE marker expression is
predominantly held by the liver bud and is not shared by other
endoderm-derived tissues, such as the lung bud or stomach. Although the basis
for restricting PE development near the liver bud remains to be addressed, it
is known that the mesothelial layer is dissociated from the endoderm by
intervening mesenchymal tissue, which later gives rise to smooth muscle and
supporting connective tissue. One exception is the liver bud, in which the
endoderm undergoes outgrowth towards septum transversum mesenchyme
(Rossi et al., 2001
). This
morphogenetic event results in closer contact between the liver bud endoderm
and mesothelium (see Fig. S1 in the supplementary material). Thus, in addition
to region-specific inductive cue(s), physical proximity might play a role in
liver bud-dependent PE induction.
Although our data suggest that a signal(s) from the liver bud is sufficient
to induce PE marker genes in a naïve mesodermal tissue, it remains
unclear whether this organ rudiment is necessary for PE induction. It would be
interesting to analyze a mutant animal model(s) in which the liver bud
formation is specifically impaired. For example, mutant mouse embryos lacking
both Foxa1 and Foxa2 genes do not form the liver bud
(Lee et al., 2005
).
Unfortunately, the mutant embryos show a significant delay in the development
of many organs at E9.5 (Lee et al.,
2005
), when the PE begins to develop in wild-type embryos
(Majesky, 2004
;
Muñoz-Chápuli et al., 2002), and die shortly thereafter.
Therefore, it still remains unsolved whether a liver bud-derived signal(s) is
necessary for PE induction in the animal model.
Currently, molecules that mediate the PE-inducing activity of the liver bud
are undefined. Recent studies have shown that BMP and FGF signaling can affect
the differentiation of the PE. Both supplying and blocking BMP signaling
result in a loss of PE marker gene expression and concomitant stimulation of
cardiac myocyte differentiation (Schlueter
et al., 2006
). FGF2 can stimulate growth of the PE and inhibit its
myocardial differentiation (Kruithof et
al., 2006
). Although these studies suggest that appropriate levels
of BMP and FGF signals are required to maintain PE identity, the in vivo
function of these proteins appears to be complicated by the complex expression
patterns of different ligands in and around the PE-forming region
(Kruithof et al., 2006
;
Schlueter et al., 2006
;
Somi et al., 2004
). Both BMP
and FGF family member genes are highly expressed in the lung even before
initiation of its branching morphogenesis
(Bellusci et al., 1996
;
Bellusci et al., 1997
;
Narita et al., 2000
;
Sakiyama et al., 2000
). Our
data showing no or very low PE-inducing activity of the lung are inconsistent
with the idea that BMPs and FGFs are key mediators of PE-inducing activity.
Comprehensive analysis of molecular components specific to the liver bud might
provide insights into inducing factor(s) responsible for PE development. To
our knowledge, there is no published database regarding paracrine factors that
are specifically expressed in the liver bud. Furthermore, our survey of the
unpublished microarray data (H. Yoshitomi and K. S. Zaret, personal
communication) that had kindly been provided to us did not reveal any
paracrine factor expressed exclusively in a liver bud-specific manner.
Therefore, we examined several candidate paracrine factors that have been chosen based on the following four criteria: (i) implicated in patterning the heart and foregut endoderm (Bmp4, Bmp7, noggin, follistatin, Cripto (Cfc1), Wnt3a, Dkk1, and sFRP3); (ii) expressed in the endoderm (Shh); (iii) implicated in vessel development (Fgf2, Pdgf); and (iv) known liver-expressed paracrine factors (HGF, albumin as a control). We found that Tbx18 was upregulated by many factors, including Bmp4, Dkk1, Fgf2, follistatin, Hgf, noggin, Pdgf, Shh, sFRP3 and Wnt3a. By contrast, Wt1 was upregulated only by noggin, Shh and Wnt3a. None of these factors upregulated Cfc1. These data are presented as supplemental material (see Fig. S2 in the supplementary material). The results suggest that each PE marker gene exhibited a distinct spectrum of responsiveness to paracrine factors used, raising the possibility that PE development is induced by rather complex mechanisms involving multiple factors. Identification of true inducing factors will require future study.
Inductive response of the mesothelium to a liver bud-derived signal(s)
Whereas specification of the liver endoderm begins at about the 6-somite
stage in chick and at the 7- to 8-somite stage in mouse (reviewed in
Zaret, 2000
), the overlaying
mesothelium undergoes PE formation much later, in a defined developmental
window - stages 14-17. Our implantation study suggests that the competency of
naïve mesoderm, particularly mesothelial cells, to respond to the liver
bud-derived inducing signal is developmentally regulated. Liver bud-dependent
induction of Wt1 in host embryos became detectable at stage 12, but
not before. Thus, developmentally regulated competency of the mesothelium
might play a role in restricting PE induction to a specific region and time
during embryogenesis. It is currently unclear whether this competency is
inherent in all mesothelial cells or whether it is induced within the
mesothelium by other neighboring tissues. In mammalian embryos, it has been
proposed that Wt1-positive serosal mesothelial cells migrate to cover
the mesentery and, subsequently, the entire gut
(Wilm et al., 2005
). It will
be important in the future to examine how the mode of mesothelium formation is
related to the competency of mesothelium to respond to PE-inducing
signals.
Concluding remarks
It is well-established that interactions between endoderm and mesoderm are
crucial for heart and liver development. Induction of cardiogenic mesoderm
depends upon paracrine signals from the underlying endoderm
(Lough et al., 1996
;
Schultheiss et al., 1997
)
(reviewed in Lough and Sugi,
2000
), and signals from the resulting cardiogenic mesoderm in turn
initiate hepatic cell differentiation and liver bud formation in the ventral
endoderm (Fukuda-Taira, 1981
;
Gualdi et al., 1996
) (reviewed
in Duncan, 2003
). The results
presented in this study suggest a subsequent inductive event in which the
liver bud induces the overlying mesothelium to initiate PE development. Thus,
reciprocal tissue interactions and a differential movement of the mesoderm and
endoderm (Matsushita, 1996
)
might be crucial in coordinating the generation of the myocardium and
epicardial/coronary vessel precursors from neighboring regions of the mesoderm
at different stages of development.
Recent studies suggest that the PE is not only the major source of
endothelial, smooth muscle and fibroblast cells of the coronary vasculature
but that it also has the potential to produce many other cardiac cell types,
such as blood, mesenchymal and myocardial cells, either in vivo or under
certain experimental conditions (Kruithof
et al., 2006
; Schlueter et
al., 2006
; Tomanek et al.,
2006
) (reviewed in Wessels and
Pérez-Pomares, 2004
). Elucidating cellular and molecular
mechanisms that control fate decisions of PE-derived cells will provide a
foundation for rational therapeutics of coronary disorders in adults as well
as the basis for understanding normal and aberrant coronary vessel
development.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/20/3627/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Bellusci, S., Henderson, R., Winnier, G., Oikawa, T. and Hogan, B. L. (1996). Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 122,1693 -1702.[Abstract]
Bellusci, S., Grindley, J., Emoto, H., Itoh, N. and Hogan, B. L. (1997). Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development 124,4867 -4878.[Abstract]
Bogers, A. J., Gittenberger-de Groot, A. C., Poelmann, R. E., Péault, B. M. and Huysmans, H. A. (1989). Development of the origin of the coronary arteries, a matter of ingrowth or outgrowth? Anat. Embryol. 180,437 -441.[CrossRef][Medline]
Carmona, R., Gonzalez-Iriarte, M., Pérez-Pomares, J. M. and Muñoz-Chápuli, R. (2001). Localization of the Wilm's tumour protein WT1 in avian embryos. Cell Tissue Res. 303,173 -186.[CrossRef][Medline]
Chapman, S. C., Collignon, J., Schoenwolf, G. C. and Lumsden, A. (2001). Improved method for chick whole-embryo culture using a filter paper carrier. Dev. Dyn. 220,284 -289.[CrossRef][Medline]
Dettman, R. W., Denetclaw, W., Jr, Ordahl, C. P. and Bristow, J. (1998). Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev. Biol. 193,169 -181.[CrossRef][Medline]
Duncan, S. A. (2003). Mechanisms controlling early development of the liver. Mech. Dev. 120, 19-33.[CrossRef][Medline]
Fukuda-Taira, S. (1981). Hepatic induction in the avian embryo: specificity of reactive endoderm and inductive mesoderm. J. Embryol. Exp. Morphol. 63,111 -125.[Medline]
Gittenberger-de Groot, A. C., Vrancken Peeters, M.-P. F. M.,
Bergwerff, M., Mentink, M. M. and Poelmann, R. E. (2000).
Epicardial outgrowth inhibition leads to compensatory mesothelial outflow
tract collar and abnormal cardiac septation and coronary formation.
Circ. Res. 87,969
-971.
Gualdi, R., Bossard, P., Zheng, M., Hamada, Y., Coleman, J. R.
and Zaret, K. S. (1996). Hepatic specification of the gut
endoderm in vitro: cell signaling and transcriptional control.
Genes Dev. 10,1670
-1682.
Haenig, B. and Kispert, A. (2004). Analysis of TBX18 expression in chick embryos. Dev. Genes Evol. 214,407 -411.[Medline]
Hamburger, V. and Hamilton, J. L. (1951). A series of normal nornal stages in the development of the chick embryo. J. Morphol. 88,49 -92.[CrossRef]
Hatcher, C. J., Diman, N. Y., Kim, M. S., Pennisi, D., Song, Y.,
Goldstein, M. M., Mikawa, T. and Basson, C. T. (2004). A role
for Tbx5 in proepicardial cell migration during cardiogenesis.
Physiol. Genomics 18,129
-140.
Hidai, H., Bardales, R., Goodwin, R., Quertermous, T. and Quertermous, E. E. (1998). Cloning of capsulin, a basic helix-loop-helix factor expressed in progenitor cells of the pericardium and the coronary arteries. Mech. Dev. 73, 33-43.[CrossRef][Medline]
Hiruma, T. and Hirakow, R. (1989). Epicardial formation in embryonic chick heart: computer-aided reconstruction, scanning, and transmission electron microscopic studies. Am. J. Anat. 184,129 -138.[CrossRef][Medline]
Ho, E. and Shimada, Y. (1978). Formation of the epicardium studied with the scanning electron microscope. Dev. Biol. 66,579 -585.[CrossRef][Medline]
Hurtado, R. and Mikawa, T. (2006). Enhanced sensitivity and stability in two-color in situ hybridization by means of a novel chromagenic substrate combination. Dev. Dyn. 235,2911 -2916.
Kraus, F., Bénédicte, H. and Kispert, A. (2001). Cloning and expression analysis of the mouse T-box gene Tbx18. Mech. Dev. 100,83 -86.[CrossRef]
Kruithof, B. P., van Wijk, B., Somi, S., Kruithof-de Julio, M., Pérez Pomares, J. M., Weesie, F., Wessels, A., Moorman, A. F. and van den Hoff, M. J. (2006). BMP and FGF regulate the differentiation of multipotential pericardial mesoderm into the myocardial or epicardial lineage. Dev. Biol. 295,507 -522.[CrossRef][Medline]
Lee, C. S., Friedman, J. R., Fulmer, J. T. and Kaestner, K. H. (2005). The initiation of liver development is dependent on Foxa transcription factors. Nature 435,944 -947.[CrossRef][Medline]
Lough, J. and Sugi, Y. (2000). Endoderm and heart development. Dev. Dyn. 217,327 -342.[CrossRef][Medline]
Lough, J., Barron, M., Brogley, M., Sugi, Y., Bolender, D. L. and Zhu, X. (1996). Combined BMP-2 and FGF-4, but neither factor alone, induces cardiogenesis in non-precardiac embryonic mesoderm. Dev. Biol. 178,198 -202.[CrossRef][Medline]
Majesky, M. W. (2004). Development of coronary vessels. Curr. Top. Dev. Biol. 62,225 -259.[Medline]
Manasek, F. J. (1968). Embryonic development of the heart. I. A light and electron microscopic study of myocardial development in the early chick embryo. J. Morphol. 125,329 -365.[CrossRef][Medline]
Manasek, F. J. (1969). Embryonic development of the heart. II. Formation of the epicardium. J. Embryol. Exp. Morphol. 22,333 -348.[Medline]
Männer, J. (1992). The development of pericardial villi in the chick embryo. Anat. Embryol. 186,379 -385.[Medline]
Männer, J. (1993). Experimental study on the formation of the epicardium in chick embryos. Anat. Embryol. 187,281 -289.[Medline]
Männer, J., Pérez-Pomares, J. M., Macias, D. and Muñoz-Chápuli, R. (2001). The origin, formation and developmental significance of the epicardium: a review. Cells Tissues Organs 169,89 -103.[CrossRef][Medline]
Mikawa. T. (1999). Cardiac lineages. In Heart Development (ed. R. P. Harvey and N. Rosenthal), pp. 19-33. New York: Academic Press.
Mikawa, T. and Fischman, D. A. (1992).
Retroviral analysis of cardiac morphogenesis: discontinuous formation of
coronary vessels. Proc. Natl. Acad. Sci. USA
89,9504
-9508.
Matsushita, S. (1996). Fate mapping study of the endoderm of the 1.5-day-old chick embryo. Roux's Arch. Dev. Biol. 205,225 -231.[CrossRef]
Mikawa, T. and Gourdie, R. G. (1996). Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev. Biol. 174,221 -232.[CrossRef][Medline]
Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D. and Schedl, A. (1999). YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development 126,1845 -1857.[Abstract]
Muñnz-Chápuli, R., Macías, D., González-Iriarte, M., Carmona, R., Atencia, G. and Pérez-Pomares, J. M. (2002). The epicardium and epicardial-derived cells: multiple functions in cardiac development. Rev. Esp. Cardiol. 55,1070 -1082.[Medline]
Nahirney, P. C., Mikawa, T. and Fischman, D. A. (2003). Evidence for an extracellular matrix bridge guiding proepicardial cell migration to the myocardium of chick embryos. Dev. Dyn. 227,511 -523.[CrossRef][Medline]
Narita, T., Saitoh, K., Kameda, T., Kuroiwa, A., Mizutani, M., Koike, C., Iba, H. and Yasugi, S. (2000). BMPs are necessary for stomach gland formation in the chicken embryo: a study using virally induced BMP-2 and Noggin expression. Development 127,981 -988.[Abstract]
Obara-Ishihara, T., Kuhlman, J., Niswander, L. and Herzlinger, D. (1999). The surface ectoderm is essential for nephric duct formation in intermediate mesoderm. Development 126,1103 -1108.[Abstract]
Page, M. (1989). Changing patterns of cytokeratins and vimentin in the early chick embryo. Development 105,97 -107.[Abstract]
Pennisi, D. J., Ballard, V. L. and Mikawa, T. (2003). Epicardium is required for the full rate of myocyte proliferation and levels of expression of myocyte mitogenic factors FGF2 and its receptor, FGFR-1, but not for transmural myocardial patterning in the embryonic chick heart. Dev. Dyn. 228,161 -172.[CrossRef][Medline]
Pérez-Pomares, J. M., Macias, D., Garcia-Garrido, L. and Muñoz-Chápuli, R. (1998). The origin of the subepicardial mesenchyme in the avian embryo: an immunohistochemical and quail-chick chimera study. Dev. Biol. 200, 57-68.[CrossRef][Medline]
Plageman, T. F., Jr and Yutzey, K. E. (2005). T-box genes and heart development: putting the `T' in HearT. Dev. Dyn. 232,11 -20.[CrossRef][Medline]
Reese, D. E., Mikawa, T. and Bader, D. M.
(2002). Development of the coronary vessel system.
Circ. Res. 91,761
-768.
Rojas, A., De Val, S., Heidt, A. B., Xu, S. M., Bristow, J. and
Black, B. L. (2005). Gata4 expression in lateral mesoderm is
downstream of BMP4 and is activated directly by Forkhead and GATA
transcription factors through a distal enhancer element.
Development 132,3405
-3417.
Rosenquist, G. C. (1971). The location of the pregut endoderm in the chick embryo at the primitive streak stage as determined by radioautographic mapping. Dev. Biol. 26,323 -335.[CrossRef][Medline]
Rossi, J. M., Dunn, N. R., Hogan, B. L. and Zaret, K. S.
(2001). Distinct mesodermal signals, including BMPs from the
septum transversum mesenchyme, are required in combination for hepatogenesis
from the endoderm. Genes Dev.
15,1998
-2009.
Rychter, Z. and Ostadal, B. (1971). Mechanism of the development of coronary arteries in chick embryo. Folia Morphol. Praha 19,113 -124.[Medline]
Sakiyama, J., Yokouchi, Y. and Kuroiwa, A. (2000). Coordinated expression of Hoxb genes and signaling molecules during development of the chick respiratory tract. Dev. Biol. 227,12 -27.[CrossRef][Medline]
Schlueter, J., Männer, J. and Brand, T. (2006). BMP is an important regulator of proepicardial identity in the chick embryo. Dev. Biol. 295,546 -558.[CrossRef][Medline]
Schulte, I., Schlueter, J., Abu-Issa, R., Brand, T. and Männer, J. (2007). Morphological and molecular left-right asymmetries in the development of the proepicardium: a comparative analysis on mouse and chick embryos. Dev. Dyn. 236,684 -695.[CrossRef][Medline]
Schultheiss, T. M., Burch, J. B. and Lassar, A. B.
(1997). A role for bone morphogenetic proteins in the induction
of cardiac myogenesis. Genes Dev.
11,451
-462.
Selleck, M. A. J. and Bronner-Fraser, M. (1995). Origins of the avian neural crest: the role of neural plate-epidermal interactions. Development 121,525 -538.[Abstract]
Shimada, Y., Ho, E. and Toyota, N. (1981). Epicardial covering over myocardial wall in the chicken embryo as seen with the scanning electron microscope. Scan. Electron Microsc. 2,275 -280.
Somi, S., Buffing, A. A. M., Moorman, A. F. M. and van den Hoff, M. J. B. (2004). Dynamic patterns of expression of BMP isoforms 2, 4, 5, 6, and 7 during chick heart development. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 279,636 -651.[CrossRef][Medline]
Tevosian, S. G., Deconinck, A. E., Tanaka, M., Schinke, M., Litovsky, S. H., Izumo, S., Fujiwara, Y. and Orkin, S. H. (2000). FOG-2, a cofactor for GATA transcription factors, is essential for heart morphogenesis and development of coronary vessels from epicardium. Cell 101,729 -739.[CrossRef][Medline]
Tomanek, R. J., Ishii, Y., Holifield, J. S., Sjogren, C. L.,
Hansen, H. K. and Mikawa, T. (2006). VEGF family members
regulate myocardial tubulogenesis and coronary artery formation in the embryo.
Circ. Res. 98,947
-953.
Tremblay, K. D. and Zaret, K. S. (2005). Distinct populations of endodermal cells converge to generate the embryonic liver bud and ventral foregut tissues. Dev. Biol. 280, 87-99.[CrossRef][Medline]
Virágh, S., Gittenberger-de Groot, A. C., Poelmann, R. E. and Kálmán, F. (1993). Early development of quail heart epicardium and associated vascular and glandular structures. Anat. Embryol. 188,381 -393.[Medline]
von Scheven, G., Bothe, I., Ahmed, M. U., Alvares, L. E. and Dietrich, S. (2006). Protein and genomic organisation of vertebrate MyoR and Capsulin genes and their expression during avian development. Gene Expr. Patterns 6, 383-393.[CrossRef][Medline]
Vrancken Peeters, M.-P. F. M., Gittenberger-de Groot, A. C., Mentink, M. M. and Poelmann, R. E. (1999). Smooth muscle cells and fibroblasts of the coronary arteries derive from epithelial-mesenchymal transformation of the epicardium. Anat. Embryol. 199,367 -378.[CrossRef][Medline]
Waldo, K. L., Willner, W. and Kirby, M. L. (1990). Origin of the proximal coronary artery stems and a review of ventricular vascularization in the chick embryo. Am. J. Anat. 188,109 -120.[CrossRef][Medline]
Watt, A. J., Battle, M. A., Li, J. and Duncan, S. A.
(2004). GATA4 is essential for formation of the proepicardium and
regulates cardiogenesis. Proc. Natl. Acad. Sci. USA
101,12573
-12578.
Wessels, A. and Pérez-Pomares, J. M. (2004). The epicardium and epicardially derived cells (EPDCs) as cardiac stem cells. Anat. Rec. A Discov. Mol. Cell. Evol. Biol. 276,43 -57.[CrossRef][Medline]
Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B. E. and
Bader, D. M. (2005). The serosal mesoselium is a major source
of smooth muscle cells of the gut vasculature.
Development 132,5317
-5328.
Xavier-Neto, J., Shapiro, M. D., Houghton, L. and Rosenthal, N. (2000). Sequential programs of retinoic acid synthesis in the myocardial and epicardial layers of the developing avian heart. Dev. Biol. 219,129 -141.[CrossRef][Medline]
Zaret, K. S. (2000). Liver specification and early morphogenesis. Mech. Dev. 92, 83-88.[CrossRef][Medline]
Zhang, W., Yatskievych, T. A., Baker, R. K. and Antin, P. B. (2004). Regulation of Hex gene expression and initial stages of avian hepatogenesis by Bmp and Fgf signaling. Dev. Biol. 268,312 -326.[CrossRef][Medline]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||