|
|
|
|
|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 5 September 2007
doi: 10.1242/dev.008599
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 Cell Biology Department, NYU School of Medicine, New York, NY 10016,
USA.
2 Regeneron Pharmaceuticals, Tarrytown, NY 10591, USA.
3 Department of Medicine, NYU School of Medicine, New York, NY 10016, USA.
* Author for correspondence (e-mail: todorv01{at}med.nyu.edu)
Accepted 26 July 2007
 |
SUMMARY |
|---|
 TOP SUMMARY INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key words: LTBP1, TGF-ß, ECM, OFT septation, Mouse
|
INTRODUCTION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
).
LTBP1, LTBP3 and LTBP4 form a subgroup within the family, because they
covalently interact with latent TGF-ß. Latent TGF-ß is a dimer of
the mature cytokine non-covalently bound to its propeptide, the latency
associated protein (LAP). This complex is referred to as the small latent
complex (SLC), whereas the tri-molecular complex composed of an LTBP and the
SLC is dubbed the large latent complex (LLC). Numerous in vitro experiments
have indicated the importance of LTBPs as regulators of TGF-ß function:
LTBPs facilitate the secretion of latent TGF-ß, direct its localization
in the extracellular matrix (ECM) and regulate the activation of the cytokine.
Ablation of the Ltbp3 gene and attenuation of Ltbp4
expression (Dabovic et al.,
2002; Sterner-Kock et al.,
2002) both result in developmental defects associated with reduced
Tgf-ß activity, further demonstrating that Ltbp3 and Ltbp4 modulate
extracellular Tgf-ß levels in a specific and non-redundant manner.
Multiple in vitro studies have indicated that LTBP1 also plays an important
role in the regulation of TGF-ß bioavailability. For example, addition of
an antibody to LTBP1 blocked latent TGF-ß activation in co-cultures of
endothelial and smooth muscle cells (SMCs)
(Flaumenhaft et al., 1993).
Similarly, antibodies to LTBP1 blocked epithelio-mesenchymal transition (EMT)
in atrio-ventricular (AV) cushion explants
(Nakajima et al., 1997) and
prevented embryonic stem cell differentiation into endothelial cells
(Gualandris et al., 2000).
Mouse embryonic fibroblasts (MEFs) lacking dioxin receptor (AhR) display
increased apoptosis correlated with a higher production of Ltbp1L and
augmented TGF-ß1 activity
(Gomez-Duran et al., 2006). A
decrease in Ltbp1L restored the normal levels of Tgf-ß1 in
AhR-/- MEFs, suggesting that Ltbp1L contributes to
maintaining active Tgf-ß1 levels
(Gomez-Duran et al., 2006).
Thus, all the aforementioned reports indicate a role for LTBP1 in latent
TGF-ß activation. Indeed, we have shown that LTBP1 is essential for
vß6-mediated TGF-ß1 activation and that other LTBPs cannot
substitute for LTBP1 (Annes et al.,
2004).
LTBP1 exists in two major forms - short (S) and long (L)
(Fig. 1A) - which are
transcribed from independent promoters
(Koski et al., 1999). Ltbp1L
is the only form expressed during embryonic development, whereas the S form
first appears in the late fetal period to become the prevalent form in the
adult (Weiskirchen et al.,
2003). Both forms of LTBP1 bind latent TGF-ß; however, the L
form interacts with the ECM more efficiently
(Olofsson et al., 1995).
Perinatal lethality in mice lacking Tgf-ß2 and Tgf-ß3 suggests an indispensable role for these isoforms in organogenesis. Given that Ltbp1L, but not Ltbp1S, is expressed in mouse embryos, we were interested in exploring the in vivo function of Ltbp1L. We have targeted the murine Ltbp1L gene, generating mice with congenital heart defects consisting of improper septation of the cardiac outflow tract (OFT) and aberrant maturation of the associated vasculature. These cardiac abnormalities manifest as persistent truncus arteriosus (PTA) and interrupted aortic arch (IAA), both of which have been previously associated with malfunction of a specific embryonic cell population, termed cardiac neural crest cells (CNCCs).
CNCCs originate from the dorsal neural tube between the mid-otic placode
and the third somite (Jiang et al.,
2000). At embryonic day (E)9.5 in mice, CNCCs delaminate from the
rhombencephalon and migrate latero-ventrally along pharyngeal arch arteries
(PAAs) 3, 4 and 6, towards the cardiac tissue. A subset of CNCCs remains
within the pharyngeal arches 3, 4 and 6, in which they participate in
supporting and remodeling of PAAs. Other CNCCs invade the cardiac OFT, where
they proliferate, condense and form the aortico-pulmonary (AP) septum, a
structure crucial for division of the OFT into aortic and pulmonary vessels
(Jiang et al., 2000;
Kirby and Waldo, 1995).
Numerous reports have emphasized the role of TGF-ß in the proper
function of CNCCs. TGF-ß proteins signal through a heteromeric complex of
type I and type II receptors (Massague et
al., 2000). Deletion of either Tgf-ß type I or type II
receptor specifically from the neural crest results in PTA and IAA
(Choudhary et al., 2006;
Wang et al., 2006;
Wurdak et al., 2005),
demonstrating that functional Tgf-ß signaling in CNCCs is essential for
normal OFT septation and remodeling.
Here, we describe Ltbp1L-/- animals with congenital heart defects, comprising PTA and IAA. The absence of Ltbp1L in the OFT and pharyngeal ECM resulted in decreased Tgf-ß activity, affected the gene expression of CNCCs and caused their malfunction. Our results emphasize the importance of Ltbp1L and its potential ECM interactions as a crucial extracellular regulator of Tgf-ß bioavailability during heart development.
|
MATERIALS AND METHODS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) to modify a bacterial artificial chromosome (BAC) clone
carrying the mouse Ltbp1L gene by replacement of the deleted sequence
with the expression-selection cassette by homologous recombination
(Muyrers et al., 1999). The
targeting vectors for each allele were made by linearization of the modified
BAC, producing homology arms of 
150 kb and 30 kb flanking the deletion.
After electroporation of the targeting vectors into SvEv129/C57Bl6/F1-derived
hybrid embryonic stem (ES) cells
(Valenzuela et al., 2003),
clones that scored for loss of one of the Ltbp1L alleles were
identified by LONA assay.
Northern blot analysis
Total RNA was isolated from wild-type and Ltbp1L knockout (KO)
E14.5 embryos and E17.5 immortalized MEFs, using Trizol Reagent (Invitrogen)
and following the manufacturer's protocol. RNA (20 µg) of each genotype was
loaded on 1% agarose gel. The gel was stained with ethidium bromide and the
amount of 18S RNA used for internal standardization. Northern blotting was
performed as described at
http://www.fhcrc.org/science/labs/breeden/Methods/Northern_Blot.html.
[-32P]-dCTP-labeled mouse Ltbp1L cDNA
(Noguera et al., 2003) was
used as a probe.
Immunoblotting
Protein extracts from E14.5 wild-type and KO hearts were made by
homogenizing each frozen heart in 40 µl of ice-cold RIPA buffer (1%
Na-deoxycolate; 50 mM Tris pH 7.5; 150 mM NaCl; 1% Nonidet P40) with protease
inhibitors (Roche). The protein extracts were separated on 4-12% non-reducing
SDS gels and blotted with Ab39 (Annes et
al., 2004).
X-gal staining
E9.5-E12.5 embryos were stained with X-gal as described
(Deckelbaum et al., 2006).
Stained embryos were post-fixed in 4% PFA in PBS ON/+4°C and processed for
paraffin embedding.
In situ hybridization and probes
Anti-sense ribo-probes for Crabp1 (construct from A. Baldini,
Baylor College of Medicine, TX), plexin A2 (construct from J. Epstein, UPenn,
PA), FoxC1 (construct from B. Hogan, Duke University, NC) and
Ctgf (construct from H. Heuer, Leibniz-Institut, Germany) were
digoxigenin labeled using adequate primers and RNA polymerase (Roche). In situ
hybridization on paraffin sections was performed as described at
http://www.med.upenn.edu/mcrc/histology_core/nrinsitu.shtml.
Whole-mount in situ hybridization was performed as described
(Deckelbaum et al., 2006).
Quantification of mesenchymal cells in the OFT
The number of mesenchymal cells in the OFT of control and mutant E11.5
littermates was determined in transverse sections every 40 µm. Three pairs
of control and mutant E11.5 littermates were used and the average numbers of
this quantification were plotted. Quantification of phospho-histone 3-positive
cells was performed identically.
Immunohistochemistry
Antigen retrieval from paraffin sections was performed in DakoCytomation
Target Retrieval Solution for 20 minutes at 95°C; or in Na-citrate pH 6,
heated for 2 minutes in a microwave oven (phospho-Smad2). The following
primary antibodies were used: rabbit polyclonal phospho-histone 3, Cell
Signaling; monoclonal -smooth muscle actin 1A4, Sigma; rabbit
monoclonal cleaved caspase 3, Cell Signaling; rabbit polyclonal phospho-Smad2,
Chemicon; and TGF-ß2, Santa Cruz.
India ink injections
Injections of India ink in E10.5-E11.5 embryonic hearts were performed as
described (Kaartinen et al.,
2004).
Detecting CNCCs distribution in the OFT of Ltbp1L KO mice
To detect the distribution of neural crest-derived cells in the OFT of
Ltbp1L-/- mice, the EYFP-Cre reporter strain
(Srinivas et al., 2001)
(provided by F. Costantini, Columbia University, NY) was crossed with
Wnt1-Cre transgenic line (Jiang
et al., 2000) (obtained from H. Sucov, USC, CA). Control and
Ltbp1L-/- embryos expressing the EYFP reporter construct
and the Wnt1-Cre transgene were sectioned, counter-stained with
propidium-iodide and imaged by fluorescence microscopy at E10.5-E11.5.
Semi-quantitative and quantitative real-time RT-PCR analysis
RNA was extracted from three pairs of E11.5 control and KO hearts using the
RNeasy Protect Mini kit (Qiagen) with DNase treatment included. Reverse
transcription (RT) was performed using 50 ng of RNA and the Sensiscript
Reverse Transcriptase (Qiagen). The resulting cDNA was used for
semi-quantitative and quantitative real-time RT-PCR (Q-RT-PCR) analysis.
Primers used in semi-quantitative PCRs (all shown 5'-3'):
ß-actinF, ATCTGGCACCACACCTTCTACAATGAGCTGCG; ß-actinR,
CGTCATACTCCTGCTTGCTGATCCACATCTGC; CtgfF, AAGACACATT TGGCCCAGAC; CtgfR,
TTACGCCATGTCTCCGTACA. PCR conditions: ß-actin, (94°C/1';
58°C/45''; 72°C/1')x25; Ctgf, (94°C/1';
60°C/45''; 72°C/1')x35. Q-RT-PCRs were performed
using specific primers in the presence of SYBR Green dye (Molecular Probes,
Eugene, OR) on an iCycler Thermal Cycler (Bio-Rad). Each target transcript
expression was quantified by comparing the threshold cycle (CT)
with that of hypoxanthine guanine phosphoribosyl transferase by using the
comparative CT method. Primers used: HPRT sense
CTGGTGAAAAGGACCTCTCG, antisense CAAGGGCATATCCAACAACA; Tgf-ß1 sense
ACCCTGCCCCTATATTTGGA, antisense TGGTTGTAGAGGGCAAGGAC; Tgf-ß2 sense
GAACCCAAAGGGTACAATGC,antisenseTGGTGTTGTACAGGCTGAGG; Tgf-ß3 sense
TATGCCAACTTCTGCTCAGG, antisense CTCTGGGTTCAG GGTGTTGT; Ltbp3 sense
GGTATGCGAGTGTC CTGGAG, antisense CAGTTCTCGGCACTCATCAA; c-Myc (Myc) sense
GCTGGAGA TGATGACCGAGT, antisense AACCGCTCCACATAC AGTCC.
|
RESULTS |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) to
create two Ltbp1L deletion alleles, designated as A and B
(Fig. 1B). For the A allele, we
made a 666 bp deletion including 457 bp of the 3' portion of exon 1 and
209 bp of the downstream intron; whereas, for the B allele, we made a 7.8 kb
deletion from the 165th codon of the Ltbp1L coding sequence in exon 2
through the remainder of exon 2 and into the downstream intron. The deleted
sequences were replaced with an expression cassette comprising a
ß-galactosidase coding sequence (lacZ) fused in-frame with the
upstream coding sequence of Ltbp1L, followed by a polyadenylation
signal and an antibiotic selection cassette flanked by loxP sites.
The targeting of embryonic stem (ES) cells and the germline transmission were
confirmed by a quantitative reverse transcription PCR (Q-RT-PCR) assay that
scored for the loss of one of the native Ltbp1L alleles (data not
shown). The neoR cassette was removed by crossing line A
and B mice with mice expressing Cre recombinase in the germ cell lineage. A
and B lines, with or without the neoR cassette, showed the
same phenotype; hence, both lines were used interchangeably with no
differences observed.
|
). We
did not detect any Ltbp1-specific mRNA in our knockout (KO) sample
(Fig. 1C, left). However, we
could detect Ltbp1S mRNA in immortalized wild-type and KO E17.5
fibroblasts (Fig. 1C, right),
indicating that only Ltbp1L but not Ltbp1S expression is
attenuated in Ltbp1L-/- mice. Western blot analysis of
protein extracts from E14.5 wild-type and KO hearts revealed bands at the
expected positions of the full-length (240 kDa) and truncated (170
kDa) forms of Ltbp1L in wild-type but not KO samples
(Fig. 1D), confirming the
ablation of the Ltbp1L gene.
|
Pathological evaluation of newborn Ltbp1L-/- mice revealed cardiac OFT and aortic arch abnormalities (Fig. 2). Every Ltbp1L mutant exhibited defects in septation of the OFT resulting in a single outflow vessel exiting the heart (PTA) (Fig. 2B-E, asterisk in 2G). PTA results from failure of the truncus arteriosus, a vascular structure present in the developing embryo, to divide into the aorta and pulmonary artery.
|
Histological analysis of the mutant hearts revealed ventricular and atrial septum defects (vsd and asd, respectively) (vsd, arrow in Fig. 2G; asd, arrowhead in Fig. 2I). Ventricular communication is a mechanistic prerequisite for PTA, because the conotruncus must receive the blood from both ventricles. In all Ltbp1L mutants, the most basal portion of the ventricular septum, termed membranous septum, was missing (Fig. 2G).
Ltbp1L expression during OFT septation and remodeling of the associated vasculature
To understand the etiology of cardiac malformations in Ltbp1L
mutants, we studied the expression of Ltbp1L at E9.5-E12.5, when
crucial events in OFT septation and remodeling occur
(Jiang et al., 2000). A
promotorless lacZ cassette was inserted into the Ltbp1L
locus during targeting, enabling us to follow reporter gene expression driven
by the Ltbp1L promoter.
Ltbp1L expression in the heart was first detected in a few myocardial cells (Fig. 3A) underlying the OFT (Fig. 3B) and AV (Fig. 3C) cushions at E9.5 (Fig. 3A-C). As EMT advanced and CNCCs initiated invasion of the OFT, Ltbp1L expression broadened (Fig. 3D,E). At E11.5, Ltbp1L expression in the heart was at its highest: all of the myocardium underlying endocardial cushions (Fig. 3E, My), mesenchymal cells (Fig. 3E,M) and some endocardial cells (Fig. 3E,E) express Ltbp1L in the OFT and AV canal. Mesenchymal cells in the OFT at E11.5 (Fig. 3E, Fig. 4E,F) were of dual origin - endocardial and CNCCs - and they all expressed Ltbp1L. By contrast, pharyngeal mesenchyme, composed primarily of neural crest, did not express Ltbp1L (Fig. 3F, Ms; Fig. 4E,F, Ms). Ltbp1L expression in the pharynx was confined to the endoderm of pharyngeal pouches (Fig. 3F, arrows). We refer to CNCCs relocating from the dorsal neural tube to the OFT as `migrating CNCC', whereas CNCCs in the OFT are defined as `post-migratory'. The Ltbp1L expression pattern implies that post-migratory but not migrating CNCCs express Ltbp1L. Ltbp1L was also expressed by atrial myocardium and by cells surrounding dorsal aortae (SMCs) from E11.5 onwards [Fig. 4E,F, red arrowheads indicate SMCs surrounding dorsal aorta (dAo)]. However, at E12.5, Ltbp1L expression was detected in the subendothelial cells surrounding all PAAs and nascent pulmonary and aortic vessels (Fig. 3G-I, arrows indicate SMCs). Ltbp1L was also expressed by condensed mesenchymal cells in the OFT (Fig. 3G-I) and AV canal, myocardium of the right ventricle (in a patchy manner) and both atria (data not shown).
In summary, the Ltbp1L expression pattern within the E9.5-E12.5 window suggests possible Ltbp1L involvement in CNCC function and cardiac EMT.
Cardiac neural crest function in Ltbp1L nulls
Failure in OFT septation has been attributed to defects in CNCC function
(Creazzo et al., 1998). To
determine whether lack of Ltbp1L affected CNCC functions, we analyzed the fate
of migrating and post-migratory CNCCs visualized by virtue of their production
of specific molecular markers.
|
We next examined the fate of cells of the CNC lineage permanently marked by
yellow fluorescent protein (YFP) expression
(Liu et al., 2006). The
YFP-labeled CNCCs in E10.5 (data not shown) and E11.5
Ltbp1L-/- embryos migrated properly to pharyngeal arches,
surrounded the PAAs and populated the endocardial cushions of the OFT in
numbers comparable to controls (Fig.
4C,D, green cells). This result agreed with our histological
analysis of control and mutant E10.5-E11.5 OFT endocardial cushions
(Fig. 4E,F). The morphology and
cellularity of mutant OFT endocardial cushions at E10.5 was indistinguishable
from the controls (data not shown). However, although the cellularity of E11.5
OFT endocardial cushions in Ltbp1L mutants appeared normal, the
morphology of the aortic sac was not. We observed normal onset of aortic sac
septation in control embryos, marked by the formation of the AP septum
(Fig. 4C,E, arrowheads). In
mutant embryos, the AP septum was absent
(Fig. 4D,F, arrowheads).
Failure in AP septum formation and/or elongation was a consequence either of
an insufficient number of CNCCs invading the OFT or a functional inadequacy of
CNCCs residing in the OFT. The comparable cellularity of mutant and control
OFT cushions indicated that the number of mutant CNCCs invading the OFT was
normal. We quantified the number of mesenchymal cells in E11.5 OFTs in three
pairs of age-matched control and mutant embryos to validate this assumption.
Our quantification confirmed that mesenchymal cell number throughout the OFT
endocardial cushions in control and mutant embryos was comparable
(Fig. 4G, left). Furthermore,
we determined the number of proliferating Ltbp1L mutant and control
mesenchymal cells, stained by antibody to phospho-histone 3, in the E11.5 OFT.
This analysis also yielded equivalent values for mutant and control embryos
(Fig. 4G, right). The lack of
the AP septum in Ltbp1L-null embryos could be a consequence of
localized apoptosis of the forming AP septum rather than a failure of AP
septum formation. Therefore, we stained transverse E11.0-E11.5 sections at the
OFT level with antibody to active caspase 3, which visualizes apoptotic cells.
We observed no apoptosis in the KO OFT at the site of AP septum formation
(data not shown). Thus, although the CNCCs migrated, invaded and proliferated
normally within the OFT of Ltbp1L mutants, they did not form the AP
septum, suggesting a functional defect of post-migratory CNCCs.
|
), in
E10.5-E12.5 embryos by both whole-mount and slide in situ hybridization
(Fig. 4H-K; see Fig. S1A-H in
the supplementary material). Plexin A2 and FoxC1 ribo-probes
visualized two prongs of CNCCs in the OFT of control embryos
(Fig. 4H,J, arrows; see Fig.
S1A,C,E,G in the supplementary material). By contrast, very few mesenchymal
cells in the Ltbp1L mutant OFT expressed plexin A2 or FoxC1
(Fig. 4I,K; see Fig. S1B,D,F,H
in the supplementary material). Our analyses consistently indicated that
sufficient numbers of mesenchymal cells that were derived from neural crest
populated the cushions. Intriguingly, Ltbp1L-mutant post-migratory
CNCCs did not express two CNC molecular markers, plexin A2 and FoxC1,
suggesting a defect in the post-migratory CNC gene expression pattern in
mutant embryos.
Differentiation of Ltbp1L-/- CNCCs into SMCs is normal
Several studies have suggested an important role for TGF-ß signaling
in CNCC differentiation into SMCs (Chen and
Lechleider, 2004; Wurdak et
al., 2005). To investigate whether Ltbp1L deficiency might hamper
CNCC differentiation into SMCs, we visualized SMCs surrounding the PAAs and
within the OFT in E11.5-E12.5 tissue sections from mutant and control embryos
by immunohistochemistry using an antibody against -smooth muscle actin
(SMA; Acta2) (Fig.
5C-F,I,J). Despite the morphological abnormalities of the OFT and
defective plexin A2 and FoxC1 expression, the SMC specification of
CNCCs in the OFT and surrounding vasculature in Ltbp1L mutants
appeared normal.
Ltbp1L nulls display abnormal remodeling of PAAs
At E11.5, the third, fourth and sixth PAAs and dorsal aortae undergo a
radical remodeling that ultimately results in an asymmetrical arterial system.
Because Ltbp1L-/- mice develop IAA (type B, IAA-B), we
examined the anatomy and patency of PAAs at E10.5-E11.5 using intracardiac
India ink injections. Visualization of the third, fourth and sixth pairs of
PAAs in 10.5-11.5 days post coitum (dpc) embryos showed no anatomical
difference between the controls and mutants
(Fig. 5A,B). Also, the
SMA staining of the mesenchyme surrounding the three pairs of PAAs
showed normal recruitment of SMCs for the support of PAAs in
Ltbp1L-/- embryos (Fig.
5C-F). However, soon after E11.5, the left fourth PAA regressed in
mutant Ltbp1L embryos, causing the interruption of the aortic arch.
The cause of this aberrant regression appeared to be enhanced apoptosis of the
SMCs surrounding the left fourth PAA, as indicated by cleaved caspase-3
staining (Fig. 5G-J, arrowheads
in 5H indicate apoptotic SMCs).
Decreased TGF-ß signaling in the septating OFT of Ltbp1L nulls
Lack of canonical Tgf-ß signaling in murine neural crest yields PTA
associated with IAA-B (Choudhary et al.,
2006; Wang et al.,
2006; Wurdak et al.,
2005). Given the similarity of cardiac defects in Ltbp1L
nulls and TgfbR1 and/or TgfbR2 neural crest conditional
mutants, and the fact that Ltbp1L interacts with all three isoforms of latent
Tgf-ß, we predicted that lack of Ltbp1L during murine development would
result in decreased Tgf-ß activity in the septating heart and associated
vasculature.
|
We next examined Tgf-ß activity in Ltbp1L-/- hearts during OFT septation by following the distribution of phosphorylated Smad2 (pSmad2) and the expression of two TGF-ß early-response genes, connective tissue growth factor (Ctgf) and c-Myc (Myc).
Upon TGF-ß binding to its receptor complex, Smad2 and/or Smad3 are phosphorylated and chaperoned to the nucleus by Smad4, where the pSmad2/3/4 complex influences the transcription of a myriad of genes. At E11.5, pSmad2 is localized in many myocardial, mesenchymal and endothelial nuclei of the control OFT (Fig. 6B). However, in the OFT of Ltbp1L nulls, pSmad2 is distributed in endothelial and myocardial but not mesenchymal nuclei (Fig. 6B), suggesting attenuation of Tgf-ß signaling specifically in post-migratory CNCCs.
TGF-ß increases Ctgf mRNA and protein synthesis in various
cell types (Holmes et al.,
2001; Moussad and Brigstock,
2000), whereas the expression of c-Myc is rapidly and
profoundly down-regulated by TGF-ß signaling
(Warner et al., 1999). We
followed the expression of Ctgf in E10.5-E12.5 embryos by in situ
hybridization (E11.5 shown in Fig.
6C) and found a marked reduction in Ctgf mRNA synthesis
in Ltbp1L-/- hearts, including in the mesenchymal cells of
the OFT. This difference indicates a significant decrease of Tgf-ß
signaling in the developing hearts and pharyngeal apparatus of
Ltbp1L-null embryos. Semi-quantitative RT-PCR analysis of RNA
isolated from E11.5 mutant and control hearts confirmed reduced expression of
Ctgf in Ltbp1L-/- versus control embryos
(Fig. 6D). On the contrary,
Q-RT-PCR analysis of c-Myc expression in E11.5 control and
Ltbp1L-/- hearts showed a threefold increase in the
Ltbp1L-null cDNA pool (Fig.
6A), again indicating a decrease in Tgf-ß signaling.
Thus, although different Tgf-ß isoforms are expressed at normal or moderately increased levels in developing Ltbp1L-/- hearts, the distribution of pSmad2 and expression of the Tgf-ß response genes Ctgf and c-Myc in Ltbp1L-/- hearts suggest attenuation of Tgf-ß signaling during the period crucial for OFT septation.
|
DISCUSSION |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
), in
which the primary anomaly is a double-outlet right ventricle, associated with
ventricular and atrial septum defects. Structural abnormalities of the aorta
and its branches were detected with partial penetrance, whereas PTA was
sporadic (1/24) (Bartram et al.,
2001). By contrast, PTA associated with IAA is the consistent
outcome of complete attenuation of Tgf-ß signaling in mouse CNCCs
(Choudhary et al., 2006;
Wang et al., 2006;
Wurdak et al., 2005). Complete
penetrance of PTA in Ltbp1L-/- mice with a high incidence
of IAA-B (81%) suggests a crucial role for Ltbp1L in Tgf-ß presentation
during the genesis of great vessels and their branches.
Mechanistically, PTA and IAA are two different conditions, but they often
coincide with altered neural crest biology. The role of neural crest in PAA
remodeling and OFT septation is obscure. PTA can arise from an insufficient
number of CNCCs invading the OFT or a faulty function of the CNCCs that
relocate to the OFT. Extensive analysis of CNCC fate in Ltbp1L
mutants showed that CNCC specification, delamination and migration towards the
cardiac tissue is normal. Also, CNCCs invade the OFT of Ltbp1L nulls
in normal numbers, continue to divide properly within the OFT endocardial
cushions and show no excessive apoptosis. However,
Ltbp1L-/- CNCCs failed to septate the OFT. Choudhary et
al. showed that Tgf-ß represents a crucial cue for AP septum formation
and that failure in AP septum formation results in PTA
(Choudhary et al., 2006).
Similarly, CNCCs in the OFT of Ltbp1L mutants did not properly
regroup to form the AP protrusion, which ultimately hampered OFT septation. In
addition, CNCCs that have relocated to the OFT of Ltbp1L mutants did
not express FoxC1 or plexin A2, markers of proper CNCC function.
FoxC1 is a member of the forkhead/winged-helix transcription factor family.
Although post-migratory CNC and endothelial cells lining the endocardial
cushions expressed FoxC1, its deficiency did not yield OFT septation defects.
However, lack of FoxC1 expression yielded improper PAA remodeling,
resulting in interruption or coarctation of the aortic arch
(Winnier et al., 1999).
TGF-ß upregulates FOXC1 transcription in several human cancer
cell lines and ectopic expression of FOXC1 cDNA in HeLa cells, which
lack both copies of the FOXC1 allele, restores the potential of
TGF-ß1 to inhibit cell growth (Zhou
et al., 2002). Therefore, FOXC1 is a
TGF-ß-responsive gene, and failure of CNCCs in the OFT of Ltbp1L
mutants to express FoxC1 might be a consequence of decreased
Tgf-ß signaling. Plexin A2 is suggested to act as a co-receptor for
semaphorin 3C (Sema3C) in its guidance of migratory CNCCs towards and within
the cardiac OFT (Brown et al.,
2001). The decreased number of plexin A2-expressing cells in
E10.5-E12.5 OFTs of Ltbp1L-/- embryos is not attributable
to a decreased number of post-migratory CNCCs, but it rather reflects plexin
A2 downregulation, indicating that the role of plexin A2 in CNCC guidance
within the OFT might be redundant. The role of Sema3C in CNCC guidance is
highly dependent on the mouse strain; 129 and C57Bl/6 backgrounds
(Ltbp1L mutants are of 129/C57Bl/6 background) have genes that can
substitute for Sema3C in CNCC guidance
(Brown et al., 2001).
Post-migratory CNCCs change their gene expression program in the absence of
Ltbp1L. However, Ltbp1L-/- CNCCs maintain their ability to
differentiate into SMCs supporting the outflow vessel and its branches,
although the alteration of CNCC function resulted in PTA and IAA. Our results,
and results of others (Choudhary et al.,
2006; Wang et al.,
2006), indicate that CNCC differentiation into SMCs might not be
the only function of CNCC invasion of the OFT and pharynx. Indeed, the
contribution of CNCCs to the valves of great arteries and SMCs supporting
fetal and adult ascending aorta, the aortic arch and pulmonary trunk is
moderate, considering the abundance of CNCCs during the septation of the OFT.
Perhaps the major role of CNCCs in the OFT is that of an orchestrator of OFT
septation, a process that relies on coordinated activities from the
myocardium, endocardium and mesenchymal cells. Thus, the TGF-ß pathway is
crucial for the instructive role of CNCCs in the OFT.
PAAs in Ltbp1L mutants are properly formed and their remodeling
unfolds normally until E12.5, when the left fourth PAA abruptly regresses.
This regression is a result of the apoptosis of the SMCs surrounding the left
fourth PAA. The same phenomenon has been described in mice with
TgfbR2 deficiency in the neural crest, and in some Tgfb2
nulls (Choudhary et al., 2006;
Molin et al., 2002).
Apparently, proper Tgf-ß signaling is crucial for correct remodeling of
the fourth pair of PAAs. Initiation of Ltbp1-L expression in the
subendothelial cells of PAAs at E12.5 coincides with the inappropriate
regression of the left fourth PAA, suggesting that Ltbp1L is a crucial player
in Tgf-ß presentation to the CNCCs during PAA remodeling.
CNCCs first encountered Ltbp1L as they relocated to the OFT. Ltbp3, which binds all three latent Tgf-ß isoforms, is also deposited in the OFT ECM (data not shown). The analysis of isoform-specific Tgf-ß synthesis in Ltbp1L-/- hearts showed normal levels of Tgf-ß1, but 2- and 1.5-fold increases in Tgf-ß2 and Tgf-ß3 synthesis, respectively. Augmented production of latent Tgf-ß2 and Tgf-ß3 was accompanied by a proportional increase in Ltbp3 synthesis, suggesting that the ECM of the mutant OFT contains sufficient amounts of latent Tgf-ß. However, in spite of the fact that latent Tgf-ß proteins are present in the heart ECM, the Tgf-ß activity in Ltbp1L-/- septating hearts is reduced, as judged by pSmad2 staining and expression of the Tgf-ß target genes FoxC1, Ctgf and c-Myc.
From the preceding data, we present the following summary
(Fig. 7A) and propose a model
(Fig. 7B) for Ltbp1L function
in the septating OFT and branching vessels. CNCCs display a dynamic gene
expression pattern as they delaminate, migrate and invade pharyngeal arches
and heart. The migrating CNCCs transcribe a specific battery of genes
(Crabp1, FoxC1, plexin A2, etc.). Cells with this gene expression
pattern are depicted as orange in Fig.
7. At E11.5, CNCCs penetrate the ECM of the OFT and their gene
expression program changes (Fig.
7, blue CNCCs), because they now cease expressing
Crabp-1, continue transcribing plexin A2 and FoxC1, and
start expressing other genes, including Ltbp1L, Ctgf and
Sma. These changes correlate with the morphological changes,
such as AP septum formation and SMC differentiation in the OFT, and PAA
remodeling and SMC differentiation in the pharyngeal apparatus. At E12.5,
CNCCs continue to express plexin A2, FoxC1, Ctgf, Ltbp1L and
Sma (Fig. 7,
blue CNCCs). As the AP septum elongates, PAA remodeling continues and CNCCs in
the OFT and those surrounding the PAAs differentiate into SMCs. In
Ltbp1L nulls, the trajectory and the gene expression pattern of
migratory CNCCs is similar to that of the wild-type cells. However, as the
mutant CNCCs invade the OFT, they attenuate the expression of certain genes,
including FoxC1, plexin A2 and Ctgf, but continue to express
Sma. This change in gene expression (illustrated by green
rather than blue cells in Fig.
7) is accompanied by the lack of AP septum formation. By 12.5 dpc,
the abnormal remodeling of the left fourth PAA is also apparent when the
mutant and control embryos are compared. At that moment, it is not clear
whether there are further differences in the CNCC gene expression profiles,
but this is probably the case.
Fig. 7B depicts the proposed biochemical interactions of CNCCs with LLCs within the ECM of the OFT. In wild-type embryos, CNCCs interact with Ltbp1L-LLC and activate the latent Tgf-ß. We propose that Tgf-ß signaling is essential to maintain CNCC gene expression changes and that the delivery of active Tgf-ß is dependent upon Tgf-ß bound to Ltbp1L. The CNCCs must recognize and activate the latent Tgf-ß specifically bound to Ltbp1L in the ECM, because Ltbp3-LLC cannot substitute for lost Ltbp1L-LLC. Therefore, CNCCs must display either a specific binding molecule for Ltbp1L or an activator of latent Tgf-ß that requires Ltbp1L. The localizer/activator does not respond to LLC containing Ltbp3, perhaps, due to different ECM localization or sequence specificity in Ltbp1L recognition. In the absence of Ltbp1L, CNCCs are unable to generate active Tgf-ß, resulting in the failure to effect proper gene expression and, ultimately, morphological changes. The model predicts specificity in terms of CNCC recognition and activation of Ltbp1L-LLC within the matrix. Characterization of this cell-matrix-interacting system is ongoing. We believe that identification of the molecules involved will enhance our understanding of the contribution of the ECM to the control of latent TGF-ß activation.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/20/3723/DC1
|
ACKNOWLEDGMENTS |
|---|
|
Footnotes |
|---|
Present address: Albert Einstein College of Medicine, Department of
Molecular Genetics, Bronx, NY 10461, USA 
|
REFERENCES |
|---|
|
TOPSUMMARYINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Annes, J. P., Chen, Y., Munger, J. S. and Rifkin, D. B.
(2004). Integrin alphaVbeta6-mediated activation of latent
TGF-beta requires the latent TGF-beta binding protein-1. J. Cell
Biol. 165,723
-734.
Bartram, U., Molin, D. G., Wisse, L. J., Mohamad, A., Sanford,
L. P., Doetschman, T., Speer, C. P., Poelmann, R. E. and Gittenberger-de
Groot, A. C. (2001). Double-outlet right ventricle and
overriding tricuspid valve reflect disturbances of looping, myocardialization,
endocardial cushion differentiation, and apoptosis in TGF-beta(2)-knockout
mice. Circulation 103,2745
-2752.
Brown, C. B., Feiner, L., Lu, M. M., Li, J., Ma, X., Webber, A. L., Jia, L., Raper, J. A. and Epstein, J. A. (2001). PlexinA2 and semaphorin signaling during cardiac neural crest development. Development 128,3071 -3080.[Medline]
Chen, S. and Lechleider, R. J. (2004).
Transforming growth factor-beta-induced differentiation of smooth muscle from
a neural crest stem cell line. Circ. Res.
94,1195
-1202.
Choudhary, B., Ito, Y., Makita, T., Sasaki, T., Chai, Y. and Sucov, H. M. (2006). Cardiovascular malformations with normal smooth muscle differentiation in neural crest-specific type II TGFbeta receptor (Tgfbr2) mutant mice. Dev. Biol. 289,420 -429.[CrossRef][Medline]
Creazzo, T. L., Godt, R. E., Leatherbury, L., Conway, S. J. and Kirby, M. L. (1998). Role of cardiac neural crest cells in cardiovascular development. Annu. Rev. Physiol. 60,267 -286.[CrossRef][Medline]
Dabovic, B., Chen, Y., Colarossi, C., Obata, H., Zambuto, L.,
Perle, M. A. and Rifkin, D. B. (2002). Bone abnormalities in
latent TGF-[beta] binding protein (Ltbp)-3-null mice indicate a role for
Ltbp-3 in modulating TGF-[beta] bioavailability. J. Cell
Biol. 156,227
-232.
Deckelbaum, R. A., Majithia, A., Booker, T., Henderson, J. E.
and Loomis, C. A. (2006). The homeoprotein engrailed 1 has
pleiotropic functions in calvarial intramembranous bone formation and
remodeling. Development
133, 63-74.
Flaumenhaft, R., Abe, M., Sato, Y., Miyazono, K., Harpel, J.,
Heldin, C. H. and Rifkin, D. B. (1993). Role of the latent
TGF-beta binding protein in the activation of latent TGF-beta by co-cultures
of endothelial and smooth muscle cells. J. Cell Biol.
120,995
-1002.
Gitler, A. D., Lu, M. M. and Epstein, J. A. (2004). PlexinD1 and semaphorin signaling are required in endothelial cells for cardiovascular development. Dev. Cell 7,107 -116.[CrossRef][Medline]
Gomez-Duran, A., Mulero-Navarro, S., Chang, X. and Fernandez-Salguero, P. M. (2006). LTBP-1 blockade in dioxin receptor-null mouse embryo fibroblasts decreases TGF-beta activity: Role of extracellular proteases plasmin and elastase. J. Cell. Biochem. 97,380 -392.[CrossRef][Medline]
Gualandris, A., Annes, J. P., Arese, M., Noguera, I.,
Jurukovski, V. and Rifkin, D. B. (2000). The latent
transforming growth factor-beta-binding protein-1 promotes in vitro
differentiation of embryonic stem cells into endothelium. Mol.
Biol. Cell 11,4295
-4308.
Holmes, A., Abraham, D. J., Sa, S., Shiwen, X., Black, C. M. and
Leask, A. (2001). CTGF and SMADs, maintenance of scleroderma
phenotype is independent of SMAD signaling. J. Biol.
Chem. 276,10594
-10601.
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cardiac neural crest. Development 127,1607 -1616.[Abstract]
Kaartinen, V., Dudas, M., Nagy, A., Sridurongrit, S., Lu, M. M.
and Epstein, J. A. (2004). Cardiac outflow tract defects in
mice lacking ALK2 in neural crest cells. Development
131,3481
-3490.
Kirby, M. L. and Waldo, K. L. (1995). Neural
crest and cardiovascular patterning. Circ. Res.
77,211
-215.
Koski, C., Saharinen, J. and Keski-Oja, J.
(1999). Independent promoters regulate the expression of two
amino terminally distinct forms of latent transforming growth factor-beta
binding protein-1 (LTBP-1) in a cell type-specific manner. J. Biol.
Chem. 274,32619
-32630.
Liu, S., Liu, F., Schneider, A. E., St Amand, T., Epstein, J. A.
and Gutstein, D. E. (2006). Distinct cardiac malformations
caused by absence of connexin 43 in the neural crest and in the non-crest
neural tube. Development
133,2063
-2073.
Massague, J., Blain, S. W. and Lo, R. S. (2000). TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103,295 -309.[CrossRef][Medline]
Molin, D. G., DeRuiter, M. C., Wisse, L. J., Azhar, M.,
Doetschman, T., Poelmann, R. E. and Gittenberger-de Groot, A. C.
(2002). Altered apoptosis pattern during pharyngeal arch artery
remodelling is associated with aortic arch malformations in Tgfbeta2 knock-out
mice. Cardiovasc. Res.
56,312
-322.
Moussad, E. E. and Brigstock, D. R. (2000). Connective tissue growth factor: what's in a name? Mol. Genet. Metab. 71,276 -292.[CrossRef][Medline]
Muyrers, J. P., Zhang, Y., Testa, G. and Stewart, A. F.
(1999). Rapid modification of bacterial artificial chromosomes by
ET-recombination. Nucleic Acids Res.
27,1555
-1557.
Nakajima, Y., Miyazono, K., Kato, M., Takase, M., Yamagishi, T.
and Nakamura, H. (1997). Extracellular fibrillar structure of
latent TGF beta binding protein-1: role in TGF beta-dependent
endothelial-mesenchymal transformation during endocardial cushion tissue
formation in mouse embryonic heart. J. Cell Biol.
136,193
-204.
Noguera, I., Obata, H., Gualandris, A., Cowin, P. and Rifkin, D. B. (2003). Molecular cloning of the mouse Ltbp-1 gene reveals tissue specific expression of alternatively spliced forms. Gene 308,31 -41.[CrossRef][Medline]
Olofsson, A., Ichijo, H., Moren, A., ten Dijke, P., Miyazono, K.
and Heldin, C. H. (1995). Efficient association of an
amino-terminally extended form of human latent transforming growth factor-beta
binding protein with the extracellular matrix. J. Biol.
Chem. 270,31294
-31297.
Sanford, L. P., Ormsby, I., Gittenberger-de Groot, A. C., Sariola, H., Friedman, R., Boivin, G. P., Cardell, E. L. and Doetschman, T. (1997). TGFbeta2 knockout mice have multiple developmental defects that are non-overlapping with other TGFbeta knockout phenotypes. Development 124,2659 -2670.[Abstract]
Srinivas, S., Watanabe, T., Lin, C. S., William, C. M., Tanabe, Y., Jessell, T. M. and Costantini, F. (2001). Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev. Biol. 1,4 .[CrossRef][Medline]
Sterner-Kock, A., Thorey, I. S., Koli, K., Wempe, F., Otte, J.,
Bangsow, T., Kuhlmeier, K., Kirchner, T., Jin, S., Keski-Oja, J. et al.
(2002). Disruption of the gene encoding the latent transforming
growth factor-beta binding protein 4 (LTBP-4) causes abnormal lung
development, cardiomyopathy, and colorectal cancer. Genes
Dev. 16,2264
-2273.
Todorovic, V., Jurukovski, V., Chen, Y., Fontana, L., Dabovic, B. and Rifkin, D. B. (2005). Latent TGF-beta binding proteins. Int. J. Biochem. Cell Biol. 37, 38-41.[CrossRef][Medline]
Valenzuela, D. M., Murphy, A. J., Frendewey, D., Gale, N. W., Economides, A. N., Auerbach, W., Poueymirou, W. T., Adams, N. C., Rojas, J., Yasenchak, J. et al. (2003). High-throughput engineering of the mouse genome coupled with high-resolution expression analysis. Nat. Biotechnol. 21,652 -659.[CrossRef][Medline]
Wang, J., Nagy, A., Larsson, J., Dudas, M., Sucov, H. M. and Kaartinen, V. (2006). Defective ALK5 signaling in the neural crest leads to increased postmigratory neural crest cell apoptosis and severe outflow tract defects. BMC Dev. Biol. 6, 51.[CrossRef][Medline]
Warner, B. J., Blain, S. W., Seoane, J. and Massague, J.
(1999). Myc downregulation by transforming growth factor beta
required for activation of the p15(Ink4b) G(1) arrest pathway. Mol.
Cell. Biol. 19,5913
-5922.
Weiskirchen, R., Moser, M., Gunther, K., Weiskirchen, S. and Gressner, A. M. (2003). The murine latent transforming growth factor-beta binding protein (Ltbp-1) is alternatively spliced, and maps to a region syntenic to human chromosome 2p21-22. Gene 308, 43-52.[CrossRef][Medline]
Winnier, G. E., Kume, T., Deng, K., Rogers, R., Bundy, J., Raines, C., Walter, M. A., Hogan, B. L. and Conway, S. J. (1999). Roles for the winged helix transcription factors MF1 and MFH1 in cardiovascular development revealed by nonallelic noncomplementation of null alleles. Dev. Biol. 213,418 -431.[CrossRef][Medline]
Wurdak, H., Ittner, L. M., Lang, K. S., Leveen, P., Suter, U.,
Fischer, J. A., Karlsson, S., Born, W. and Sommer, L. (2005).
Inactivation of TGFbeta signaling in neural crest stem cells leads to multiple
defects reminiscent of DiGeorge syndrome. Genes Dev.
19,530
-535.
Zhou, Y., Kato, H., Asanoma, K., Kondo, H., Arima, T., Kato, K., Matsuda, T. and Wake, N. (2002). Identification of FOXC1 as a TGF-beta1 responsive gene and its involvement in negative regulation of cell growth. Genomics 80,465 -472.[CrossRef][Medline]
This article has been cited by other articles:
|
|
 |
|
  E. J. Park, Y. Watanabe, G. Smyth, S. Miyagawa-Tomita, E. Meyers, J. Klingensmith, T. Camenisch, M. Buckingham, and A. M. Moon An FGF autocrine loop initiated in second heart field mesoderm regulates morphogenesis at the arterial pole of the heart Development, November 1, 2008; 135(21): 3599 - 3610. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||
