|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 12, 2007
doi: 10.1242/10.1242/dev.008276


1 Genome Biology Laboratory, National Institute of Genetics, Mishima 411-8560,
Japan.
2 Genetics Unit, Department of Biochemistry, University of Oxford, South Parks
Road, Oxford OX1 3QU, UK.
3 Graduate School of Comprehensive Human Sciences, University of Tsukuba,
Tsukuba 305-8577, Japan.
4 Precursory Research and Embryonic Science and Technology (PRESTO), JST,
Okazaki 444-8585, Japan.
5 Department of Physiology, Tokyo Women's Medical University School of Medicine,
Tokyo 162-8666, Japan.
Author for correspondence (e-mail:
hkagoshi{at}lab.nig.ac.jp;
alison.woollard{at}bioch.ox.ac.uk)
Accepted 20 August 2007
| SUMMARY |
|---|
|
|
|---|
Key words: C. elegans, CBFß, Stem cell, Proliferation, Self-renewal, Runx
| INTRODUCTION |
|---|
|
|
|---|
subunit (CBF
/PEBP2
, now known as Runx) and a ß
subunit (CBFß/PEBP2ß). CBFß has been shown to enhance the DNA
binding affinity and stability of Runx proteins and is required for many of
their in vivo functions (Adya et al.,
2000
RNT-1 (the single C. elegans Runx orthologue), is required for the
correct division pattern in the stem cell-like, lateral hypodermal seam cell
lineages (Nimmo et al., 2005
;
Kagoshima et al., 2005
)
(reviewed by Kagoshima et al.,
2007
). Seam cells have stem-like properties as they undergo
self-renewal and expansion whilst producing differentiated cells. They divide
asymmetrically at the beginning of each larval stage (larval stages L1 through
L4 - distinct developmental stages separated by a molt), producing another
seam cell that will continue to proliferate and a hypodermal nucleus that
differentiates and fuses with the main hypodermal syncytium
(Sulston and Horvitz, 1977
).
In addition, at the start of L2 and in a male-specific developmental programme
in L3, seam cells undergo expansion via symmetrical division
(Sulston et al., 1980
). In
males, these extra seam cells eventually give rise to ray precursor cells from
which the sensory rays are derived
(Sulston et al., 1980
). Seam
stem cells can therefore be regarded as pluripotent as they contribute a
number of cell types during postembryonic development. rnt-1 mutant
males lack the correct number of sensory rays as a result of variable seam
cell division failures during larval development
(Nimmo et al., 2005
). By
contrast, ectopic expression of rnt-1 results in seam cell
hyperplasia (Nimmo et al.,
2005
).
In this report, we show, in contrast to previous suggestions
(Adya et al., 2000
), that
C. elegans does indeed contain a functional CBFß homologue,
BRO-1. bro-1 was originally identified as a likely CBFß
orthologue by Lee and colleagues (Lee et
al., 2004
). We find that bro-1 deletion mutants have a
very similar male tail phenotype to rnt-1, suggesting the two genes
interact, although we also observe unprecedented RNT-1-independent BRO-1
functions. We find that BRO-1 acts not only to increase the affinity of RNT-1
for DNA but also to dramatically increase the specificity of RNT-1-DNA
interactions. Overexpression of bro-1 increases the number of seam
cells by causing supernumerary seam cell divisions, as well as preventing
asymmetric daughters from adopting the hypodermal fate. Furthermore, when
bro-1 and rnt-1 are co-overexpressed, massive seam cell
hyperplasia results. This work complements and extends analyses of
Runx/CBFß function in other systems, making C. elegans a premier
model system for the further study of these important cancer-associated genes,
especially in the context of stem cell lineages.
| MATERIALS AND METHODS |
|---|
|
|
|---|
bro-1 alleles
bro-1 deletion alleles tm1183, tm1229 and tm658
were isolated from trimethylpsoralen/ultraviolet (TMP/UV) mutagenesis screens
(Gengyo-Ando and Mitani, 2000
)
by the Japanese deletion consortium (National Bioresource Project for the
Experimental Animal `Nematode C. elegans',
http://shigen.lab.nig.ac.jp/c.elegans/index.jsp).
Deletion strains were backcrossed to WT ten times before analysis.
Lineage analysis
Worms were mounted for lineage analysis and observed as previously
described (Nimmo et al.,
2005
). Hypodermal nuclei were distinguished from neuronal nuclei
on the basis of their appearance: hypodermal nuclei look like `fried eggs'
with a large nucleolus, whereas neuronal nuclei are smaller and more granular,
with a less distinct nucleolus.
Transgenic worms
Injections were performed (using 20-100 ng/µl DNA) as previously
described (Mello and Fire,
1995
), using transformation markers rol-6(su1006) or
dpy-20+ (pMH86). Where appropriate, transgenic arrays were
integrated using UV irradiation (Mitani,
1995
). Integrated strains were backcrossed twice with WT before
use.
GFP/RFP reporter constructs
The bro-1::GFP rescuing reporter construct, pHK196, was made by
amplifying a 2.5 kb fragment of cosmid F56A3 (15071-17586 nt) with primers
beta-1 (ggaaagGGATCCctcatcgagaaatcagtccaattt cg) and beta-3
(gaatctGGTACCcaaatgggaagaccatcgcgtcgaagg) and cloning into the
KpnI-BamHI fragment of GFP reporter vector pPD95.79
(http://www.addgene.org/Fire_Lab).
The bro-1::RFP rescuing construct pHK328 (bro-1::mRFP) was
made by substituting monomeric RFP for GFP in pHK196. In addition, a
bro-1::DsRed rescuing construct, pAW303 was also made, by the
PCR-fusion based method (Hobert,
2002
), amplifying dsRed from plasmid pHC183 (a kind gift
from Neline Kriek) using primers NS45 (atggcctcctccgagaacgtcatc) and NS46
(aagggcccgtacggccactagtagg) and bro-1from plasmid pAW272 using
primers NS19 (ctcgtaaatcgacacaaatgc) and NS17 (gatgacgttctcggaggaggccat AATG
GGAAGACCATCGCG). The sewing reaction was performed using nested primers NS20
(tcaaatatgttgcgctgtacg) and NS47 (ggaaacagtt atgtttggtatattggg) and the PCR
product cloned into the TOPO-2.1 vector (Invitrogen) to make pAW303. The
rnt-1::GFP constructs used in this work, pAW260 and pHK192 have been
previously described (Kagoshima et al.,
2005
; Nimmo et al.,
2005
). The seam cell-specific marker, SCM::GFP (strain
JR667) was used to assay seam cell number (unc-119 (e2498::Tc1III);
wIs51[SCM::GFP + unc-119]. A dpy-7::GFP reporter strain
(ijIs12) (a kind gift from Iain Johnstone) was used as a hypodermal
marker.
RNAi
PCR of cki-1 for dsRNA synthesis was performed as previously
described (Nimmo et al.,
2005
). dsRNA was synthesised from gel-purified PCR product and
injected as previously described (Fire et
al., 1998
).
RT-PCR
Total RNA was extracted from a 100 µl pellet of synchronised L1 larvae
using the hot phenol method (Furger et
al., 2001
). RT-PCR was then performed as previously described
(Pocock et al., 2004
) using
gene-specific primers. rnt-1: RN70 (ctaacgcctgttccagataatac) and RN81
(ggagatgataggcatgtagacg). bro-1:RN104 (aaagaacgacaacggaccag) and
RN105 (atttcagcatccgtcagtcc). ama-1: RN102 (tgtctcacgcgttcagtttg) and
RN103 (aatttccagcactcgaggag).
RUBY assay
The Runt domain of RNT-1 and BRO-1 were fused to the C terminus of DsRed1
with linker amino acid sequences (GSTSGSGKPGSGEGSTKPG) in an EBV-based vector,
pEB6CAG-MCS (Tanaka et al.,
1999
). HEp-2 cells in 24-well dishes were transfected with 0.5
µg of the plasmid DNAs using TransFectin (Bio-Rad) and cultured in the
presence of 1 mg/ml G418 (RUBY-RNT-1RD) or 100 µg/ml Zeocin (RUBY-BRO-1) or
both (co-transfection) Cells were used 4 days later for flow cytometry and
fluorescent microscopic observation. For the positive and negative control
data shown in the supplementary figure (see Fig. S1 in the supplementary
material), DNA fragments encoding the Runt domain of Runx2, the mutated
version G151R, and CBFß, were subcloned into pEB6CAG-WR1-SRZ to yield
vectors expressing RUBY-wtRunx2-RD, RUBY-G151RRunx2-RD and RUBY-CBFß.
Protein purification
The wild-type and mutant Runt domains of C. elegans RNT-1 were
produced as fusions with N-terminal glutathione S-transferase (GST) and
hexahistidine (6xHis) tags. The wild-type Runt domain (amino acids 10-137) was
amplified by PCR using the cDNA template yk309f5 and the primers, 5'RD
(cgcggtaccCCATGGcatatgagaggatcgcatcaccatcaccatcacggatccatgaccaacgtcttccatcacgttcgg),
3'RD (cgcgaattcTGTACAtcattgtggttttggtattctcgcatccc). The mutant Runt
domain, containing a missense mutation (I112K) corresponding to
rnt-1(e1241), was generated by PCR using the primers, 5'RD,
3'RD and e1241-5 (cgccgaatgtTtaacgattgtcaaatggaattttcg), e1241-3
(gacaatcgtta Aacattcggcgccgatgatggtgg). PCR products were cloned into the
NcoI-BsrGI site of the vector pDEST15 (Clontech). BRO-1 was
produced as a C-terminal 6xHis-tagged protein. The entire BRO-1 coding
sequence was amplified by PCR using the cDNA clone yk211f2 and the primers,
N-BRO-1 (cttggtgcatgcCTGCAGacatgaaaagaacgacaacggaccagc) and C-BRO-1
(taaaagggatcccCTCGAGaatgggaagaccatcg cgt cgaagg), and was cloned into the
PstI-XhoI site of a T7-expression vector derived from pHIT12
(Keefe et al., 2001
) (H.
Tabara, personal communication). All 6xHis-tagged proteins were expressed in
the BL21 strain of Escherichia coli.
Since the Runt domain fusion proteins were expressed as inclusion bodies, the harvested cells were incubated in solubilization buffer (0.1 M sodium phosphate, 10 mM Tris, 6 M guanidine-HCl, 1 mM phenylmethylsulfonyl fluoride, 10 mM ß-mercaptoethanol and 0.1% Nonidet P-40, pH 8.0) and purified on a Ni-NTA resin (Qiagen). Purified proteins were renatured by stepwise dialysis at 4°C against 100 volumes of dialysis buffers (0.1 M sodium phosphate, 10 mM Tris, 50 mM glycine, 2 mM ß-ME, 0.1% NP-40 and 20% glycerol, pH 8.0) containing 4 M, 2 M and 0 M guanidine-HCl, respectively, for 4 hours or overnight. BRO-1-6xHis was purified as a soluble protein on the Ni-NTA resin.
Electrophoretic mobility shift assay (EMSA)
For the preparation of the probe and competitors, synthetic
oligonucleotides [WT: RUNX-WT-1 (catgactgctAACCGCAgatgac) and RUNX-WT-2
(gtacgtcatcTGCGGTTagcagt), and Mut: RUNX-Mut-1
(catgactgctAATCGAAgatgac) and RUNX-Mut-2
(gtacgtcatcTTCGATTagcagt)] were annealed and extended by
a standard Klenow fragment reaction with [
-32P]dATP, without
radioisotope for competitors. The DNA binding reaction (final volume, 10
µl) was carried out at 25°C for 30 minutes in EMSA buffer (20 mM
HEPES-KOH, 4% Ficoll, 2 mM EDTA, 1 mM DTT, 100 mM KCl, 6% glycerol, 0.2 mg/ml
bovine serum albumin, 0.04% Bromphenol Blue and 10 fmol of labelled probe, pH
7.4). The reaction mixture was loaded on a 10% nondenaturing polyacrylamide
gel in 0.25xTBE and electrophoresed at 4°C.
| RESULTS |
|---|
|
|
|---|
|
The phenotype of bro-1 rnt-1 double mutant animals is shown in Fig. 3. These animals have a very similar male tail phenotype to either single mutant (Fig. 3B,E), suggesting that the two genes act in a common pathway. Given their sequence homologies, it is likely that RNT-1 and BRO-1 form a DNA binding complex. However, the L2-L3 V lineage trace shown in Fig. 3C indicates that the penetrance of division defects is slightly higher in double mutant animals than is the case for either single mutant. In addition, double mutants also have a slightly lower number of seam cells on average. This suggests that there may be aspects of the functions of RNT-1 and BRO-1 that are distinguishable from one another, even though the major functions of RNT-1 and BRO-1 in controlling seam cell lineage development are co-dependent.
|
|
bro-1 is co-expressed with rnt-1 in seam and muscle cells, and additionally expressed in the uterine seam
The expression pattern of bro-1 in transgenic animals containing a
full-length rescuing bro-1::GFP reporter (pHK193) is shown in
Fig. 4. Similar expression
patterns were observed for a variety of different transgenic alleles, carrying
both extrachromosomal and integrated arrays (data not shown). In all larval
stages, BRO-1::GFP is expressed in H0-2, V1-6 and T seam progeny. BRO-1::GFP
is localised to both the cytoplasm and nucleus, similar to the expression
pattern reported for CBFß in mammalian cells
(Tanaka et al., 1997
). It
seems probable, therefore, that the sub-cellular localisation of CBFß is
conserved. We cannot exclude the possibility, however, that cytoplasmic
localisation results from the presence of a GFP fusion, or from
overexpression. Faint expression is also observed in hypodermal nuclei, some
of which are embryonically derived and which are not therefore simply anterior
daughters of the L1 stem cell division containing a perdurance of GFP
expression. We also observed expression of BRO-1::GFP in the uterine seam
(utse) during late L4 in hermaphrodites
(Fig. 4B). This expression is
likely to be due to diffusion of cytoplasmic BRO-1::GFP as a result of fusion
of the utse with the seam in L4, but also raises the possibility that BRO-1
has a functional role in this tissue.
Intriguingly, we noticed that bro-1::GFP animals contain extra seam cells. For example, an L3 bro-1::GFP-expressing animal is shown in which V1-derived seam cells have over-proliferated (Fig. 4C). In this animal, the anterior progeny of the V1.pa and V1.pp L2 stem cell divisions have not fused with the hypodermal syncytium but instead have remained as seam and undergone further division in L3, giving rise to eight nuclei instead of the expected four.
The expression pattern of BRO-1 in seam cells is very similar to that of
RNT-1 (except that RNT-1::GFP is always nuclear), and co-localisation is shown
using rescuing bro-1::DsRed (pAW303) and rnt-1::GFP (pAW260)
constructs (Fig. 4D).
Co-localisation is consistent with the hypothesis that BRO-1 acts together
with RNT-1 to control seam cell divisions. Faint BRO-1::RFP and RNT-1::GFP
co-localisation is also observed in certain body wall muscle cells
(Fig. 4E). Muscle expression of
RNT-1 has been previously reported although no functional role has been
described (Kagoshima et al.,
2005
; Nimmo et al.,
2005
). Finally, we also observed BRO-1::RFP, but not RNT-1::GFP,
in certain pharyngeal neurons. In short, BRO-1 and RNT-1 are co-expressed in
seam and muscle cells, and BRO-1 is additionally expressed in hypodermal
nuclei, certain pharyngeal neurons and the utse.
bro-1-specific phenotypes
Closer examination of bro-1 mutant hermaphrodites revealed
rupturing at the vulva and eversion of the gonad at the L4 molt in around 20%
of hermaphrodites (Fig. 4G,H),
suggesting a possible defect in either the uterine-vulval or
uterine-hypodermal connection. The penetrance of this phenotype is almost
doubled in bro-1(tm1183) rnt-1(tm388) double mutants, but is observed
only occasionally in rnt-1 single mutants
(Fig. 4H). The origin of the
vulval defect is not clear at present. We could see no obvious defects in
bro-1rnt-1 double mutants using a variety of markers, including
egl-13::GFP and cdh-3::GFP reporters to observe the
arrangement of the utse, and utse-seam cell fusion, respectively
(Cinar et al., 2003
;
Pettitt et al., 1996
) (data
not shown). It is possible that the reduced number of nuclei in the seam
and/or hypodermal syncytium in the vicinity of the vulva in bro-1 and
bro-1 rnt-1 mutants, somehow acts to weaken the uterine-hypodermal
connection. However, the observed expression of BRO-1 in the utse together
with the much higher penetrance of vulval and/or uterine defects in
bro-1 compared with rnt-1 animals, suggests that BRO-1 may
have a specific role in vulval and/or uterine morphogenesis that is, at least
in part, independent of RNT-1.
|
|
|
|
Overexpression of bro-1 causes seam cell hyperplasia
Previously we reported that overexpression of rnt-1 cDNA from the
heat shock promoter at particular stages of development causes an increase in
the number of seam cells (Nimmo et al.,
2005
). We have repeated these experiments using constitutive
overexpression of rnt-1 from the integrated rnt-1::GFP
rescuing transgenic strain msIs114 and find that this strain also
contains extra seam cells (Fig.
7A) due to overexpression of rnt-1 from multiple copies
of the gene in transgenic arrays (data not shown). Extra seam cells were
observable in a variety of different rnt-1 transgenic strains,
containing independent arrays and constructs (data not shown). We therefore
also tested constitutive bro-1 overexpression using the integrated
rescuing bro-1::GFP strain msIs344 (expressing high levels
of bro-1 mRNA as shown in Fig.
7C) and found that this too causes seam cell hyperplasia
(Fig. 7B, also discussed
earlier, see Fig. 4C).
Likewise, extra seam cells could be seen in a variety of different
bro-1 multicopy transgenics (data not shown).
BRO-1-induced hyperplasia is RNT-1 independent
We found that overexpression of RNT-1 in bro-1 mutants does not
compensate for the reduction in seam cell number
(Fig. 7A). In fact, the number
of seam cells is slightly lower in rnt-1::GFP bro-1(tm1183) animals
compared with bro-1 mutant animals alone. Perhaps RNT-1 has a
dominant-negative effect in the absence of BRO-1, possibly by binding to
non-specific sites in DNA (as suggested by our EMSA data) and recruiting, and
therefore titrating, other transcriptional co-factors away from RNT-1 target
sites.
|
Cellular basis of seam cell hyperplasia
Seam cell hyperplasia could be caused either by an increased number of seam
cell divisions (increased self-renewal and proliferation) or by changes in
fate resulting from a loss of asymmetry. The lineage data shown in
Fig. 7C indicate that
transgenic animals overexpressing bro-1 do indeed go through extra,
unscheduled seam cell divisions but in addition, some of the L2 and L3
asymmetrical stem cell divisions are now transformed to symmetrical divisions
resulting in increased self-renewal. The anterior progeny of these stem cell
divisions are prevented from acquiring the hypodermal fate and fail to fuse
with the hypodermal syncytium. This is a fate change, although in this case
the `fate' is to retain the seam characteristic of continued proliferation,
giving rise to an extra stem cell division and thus an extra seam cell. In
this way BRO-1 (acting, at least partly, together with RNT-1) functions to
promote the stem-like (self-renewal) characteristics of seam cell divisions at
the expense of the acquisition of the differentiated, hypodermal fate.
Co-overexpression of bro-1 and rnt-1 causes seam cell `tumours'
We also counted seam cell number in a strain containing both rnt-1
and bro-1 integrated arrays. The co-overexpression of RNT-1 and BRO-1
produces massive seam cell hyperplasia, 49 cells on average per side (and up
to 70) instead of the 16 expected in WT
(Fig. 8A). This extreme seam
cell hyperplasia causes lateral expansion of the seam
(Fig. 8C,D) and animals
containing these seam cell `tumours' are fatter (although shorter) than WT
(Fig. 8E,F).
| DISCUSSION |
|---|
|
|
|---|
BRO-1 increases both the affinity and specificity of RNT-1-DNA interactions
BRO-1 and RNT-1 are both expressed in seam cells, consistent with the
hypothesis that they act in concert to regulate seam cell divisions. The RUBY
assay indicates a direct interaction between BRO-1 and RNT-1 and EMSA studies
demonstrate that BRO-1 is required for robust binding of RNT-1 to the Runx
consensus DNA binding site, consistent with other studies of CBFß
function (Bushweller, 2000
;
Li et al., 2003
;
Nagata and Werner, 2001
;
Tahirov et al., 2001
;
Yan et al., 2004
).
Furthermore, our experiments show that BRO-1 dramatically increases the
specificity of RNT-1-DNA binding, thereby extending previous studies of
CBFß/Runx interactions. It will be of interest to investigate whether
this finding can be extended to other systems.
BRO-1 displays some RNT-1-independent activity
BRO-1, as well as RNT-1, promotes extra seam cell divisions when
overexpressed, acting to promote self-renewal. Intriguingly, BRO-1 is capable
of promoting extra divisions in the absence of RNT-1, thus suggesting that
BRO-1 has Runx-independent functionality, an observation confirmed by the
enhanced vulval rupture of bro-1 mutants compared to rnt-1
mutants. The converse is not true: RNT-1 is only capable of promoting extra
divisions in the presence of functional BRO-1, perhaps because of the
importance of BRO-1 in influencing the specificity and robustness of RNT-1-DNA
interactions. Likewise, the late larval lethality of the rnt-1::GFP
transgene in a bro-1 mutant background (see legend to
Fig. 6) may be related to the
role we have demonstrated for BRO-1 in increasing the specificity of RNT-1-DNA
interactions. In the absence of BRO-1, RNT-1 (already overproduced in a
transgenic animal) may bind promiscuously to ectopic sites, thus misregulating
gene expression and impairing transcriptional networks.
Our finding that BRO-1 does not appear to be wholly reliant on RNT-1 in
order to promote seam cell proliferation is the first indication that
CBFß proteins in general may have Runx-independent functions. Perhaps
RNT-1 and BRO-1 regulate transcription as part of the core of a large
enhanceosome or repressosome complex, as proposed for the mammalian Runx
factors (Carey, 1998
), and
BRO-1 is able to interact, albeit less efficiently, with this complex even in
the absence of RNT-1. Alternatively it may have some other intrinsic activity
associated with the control of seam cell proliferation and/or
self-renewal.
BRO-1 and RNT-1 co-overexpression causes seam `tumours'
Co-overexpression of RNT-1 and BRO-1 causes massive hyperproliferation of
seam cells, supporting the view that the major function of RNT-1 and BRO-1 is
to co-operate as a complex in the transcriptional regulation of genes required
to control seam cell number. The resulting hyperplasia distorts the morphology
and integrity of the seam, causing it to expand dorsoventrally and invade the
surrounding syncytial hypodermis, resulting in fatter but shorter (Dumpy)
animals. C. elegans do not exhibit solid somatic tumours as such. The
germline is the one other well-established `tumour' system, where failure of
mitotic germ nuclei to enter meiosis, caused for example by gain of
glp-1 function (Berry et al.,
1997
; Crittenden et al.,
2003
), can result in massive mitotic over-proliferation and a
concomitant expansion of the gonad. We hypothesise that because of the
restriction on body volume exerted by the cuticle, expansion in one direction
probably leads to contraction in the other, hence, worms with much increased
numbers of seam nuclei resulting form the overexpression of both
bro-1 and rnt-1 are shorter and fatter because of lateral
expansion, whereas worms with increased syncytial hypodermal ploidy are known
to be longer than WT (Flemming et al.,
2000
), i.e. to expand longitudinally. Perhaps this extreme
hyperplasia is as close to a somatic `tumour' that this model organism can
get.
One way in which the levels of these genes may be controlled is via negative feedback, and indeed we have discovered that loss of bro-1 is associated with increased expression of rnt-1. BRO-1 may either be acting in a RNT-1-independent manner to repress rnt-1 expression, or as part of a rnt-1 autoregulatory feedback loop. It is presumably necessary to limit the amount of functional Runx/CBFß complexes in order to program the correct cell division pattern of the seam lineage.
Conservation of BRO-1-RNT-1 function
There are numerous reports in the literature of Runx genes and
CBFß acting either as proto-oncogenes or tumour suppressors, the
nature of which is highly context dependent
(Blyth et al., 2005
;
Cameron and Neil, 2004
). It is
not clear whether such roles in carcinogenesis arise as a result of defects in
cellular differentiation or cell proliferation. The analysis of cell
proliferation at the single cell level, which is the hallmark of C.
elegans studies, leads us to conclude that BRO-1 and RNT-1 act to promote
the self-renewal characteristics of seam stem cell divisions at the expense of
the differentiated, hypodermal fate. Thus, our studies would support the view
that Runx/CBFß factors have oncogenic potential.
Rationalising the, sometimes contradictory, effects of Runx/CBFß factors on cellular development, especially in carcinogenesis, is one of the toughest challenges in understanding the function of these important genes. We have now firmly established C. elegans as a prominent model organism for the study of Runx/CBFß function, as we can interpret phenotypes in individual cells rather than being forced to rely on analyses of cell populations and tissues, and can work without the interpretative difficulties caused by genetic redundancy that are inherent in other experimental systems where there are multiple Runx genes. One of the interesting ideas to emerge from these studies is that it may not be appropriate to regard BRO-1 simply as a partner subunit for high affinity RNT-1-DNA binding. Although a major role of BRO-1 is to cooperate with RNT-1 to promote seam cell proliferation and/or self-renewal (presumably by stabilising RNT-1-DNA interactions) BRO-1 also increases the specificity of RNT-1-DNA interactions, has a role in the transcriptional regulation of rnt-1, and furthermore appears to have functions in the worm that are, at least in part, independent of RNT-1. It will be of interest to see whether our findings can be extended to other systems.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/21/3905/DC1
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
| REFERENCES |
|---|
|
|
|---|
Adya, N., Stacy, T., Speck, N. A. and Liu, P. P.
(1998). The leukemic protein core binding factor beta
(CBFbeta)-smooth-muscle myosin heavy chain sequesters CBFalpha2 into
cytoskeletal filaments and aggregates. Mol. Cell.
Biol. 18,7432
-7443.
Adya, N., Castilla, L. H. and Liu, P. P.
(2000). Function of CBFbeta/Bro proteins. Semin. Cell
Dev. Biol. 11,361
-368.[CrossRef][Medline]
Berry, L. W., Westlund, B. and Schedl, T.
(1997). Germ-line tumor formation caused by activation of glp-1,
a Caenorhabditis elegans member of the Notch family of receptors.
Development 124,925
-936.[Abstract]
Blyth, K., Cameron, E. R. and Neil, J. C.
(2005). The RUNX genes: gain or loss of function in cancer.
Nat. Rev. Cancer 5,376
-387.[CrossRef][Medline]
Bushweller, J. H. (2000). CBF - a biophysical
perspective. Semin. Cell Dev. Biol.
11,377
-382.[CrossRef][Medline]
Cameron, E. R. and Neil, J. C. (2004). The Runx
genes: lineage-specific oncogenes and tumor suppressors.
Oncogene 23,4308
-4314.[CrossRef][Medline]
Canon, J. and Banerjee, U. (2003). In vivo
analysis of a developmental circuit for direct transcriptional activation and
repression in the same cell by a Runx protein. Genes
Dev. 17,838
-843.
Carey, M. (1998). The enhanceosome and
transcriptional synergy. Cell
92, 5-8.[CrossRef][Medline]
Cinar, H. N., Richards, K. L., Oommen, K. S. and Newman, A.
P. (2003). The EGL-13 SOX domain transcription factor affects
the uterine pi cell lineages in Caenorhabditis elegans.
Genetics 165,1623
-1628.
Coffman, J. A. (2003). Runx transcription
factors and the developmental balance between cell proliferation and
differentiation. Cell Biol. Int.
27,315
-324.[CrossRef][Medline]
Crittenden, S. L., Eckmann, C. R., Wang, L., Bernstein, D. S.,
Wickens, M. and Kimble, J. (2003). Regulation of the
mitosis/meiosis decision in the Caenorhabditis elegans germline.
Philos. Trans. R. Soc. Lond. B Biol. Sci.
358,1359
-1362.
Fire, A., Xu, S., Montgomery, M. K., Kostas, S. A., Driver, S.
E. and Mello, C. C. (1998). Potent and specific genetic
interference by double-stranded RNA in Caenorhabditis elegans.
Nature 391,806
-812.[CrossRef][Medline]
Flemming, A. J., Shen, Z. Z., Cunha, A., Emmons, S. W. and
Leroi, A. M. (2000). Somatic polyploidisation and cellular
proliferation drive body size evolution in nematodes. Proc. Natl.
Acad. Sci. USA 97,5285
-5290.
Furger, A., Monks, J. and Proudfoot, N. J.
(2001). The retroviruses human immunodeficiency virus type 1 and
Moloney murine leukemia virus adopt radically different strategies to regulate
promoter-proximal polyadenylation. J. Virol.
75,11735
-11746.
Gengyo-Ando, K. and Mitani, S. (2000).
Characterization of mutations induced by ethyl methanesulfonate, UV, and
trimethylpsoralen in the nematode Caenorhabditis elegans. Biochem.
Biophys. Res. Commun. 269,64
-69.[CrossRef][Medline]
Hobert, O. (2002). PCR fusion-based approach to
create reporter gene constructs for expression analysis in transgenic C.
elegans. Biotechniques
32,728
-730.[Medline]
Huang, G., Shigesada, K., Ito, K., Wee, H. J., Yokomizo, T. and
Ito, Y. (2001). Dimerization with PEBP2beta protects
RUNX1/AML1 from ubiquitin-proteasome-mediated degradation. EMBO
J. 20,723
-733.[CrossRef][Medline]
Kagoshima, H., Sawa, H., Mitani, S., Burglin, T. R., Shigesada,
K. and Kohara, Y. (2005). The C. elegans RUNX transcription
factor RNT-1/MAB-2 is required for asymmetrical cell division of the T blast
cell. Dev. Biol. 287,262
-273.[Medline]
Kagoshima, H., Shigesada, K. and Kohara, Y.
(2007). RUNX regulates stem cell proliferation and
differentiation: Insights from studies of C. elegans. J.
Cell. Biochem. 100,1119
-1130.[CrossRef][Medline]
Keefe, A. D., Wilson, D. S., Seelig, B. and Szostak, J. W.
(2001). One-step purification of recombinant proteins using a
nanomolar-affinity streptavidin-binding peptide, the SBP-Tag.
Protein Expr. Purif. 23,440
-446.[CrossRef][Medline]
Lee, J., Ahnn, J. and Bae, S. C. (2004).
Homologs of RUNX and CBF beta/PEBP2 beta in C. elegans.
Oncogene 23,4346
-4352.[CrossRef][Medline]
Li, Z., Yan, J., Matheny, C. J., Corpora, T., Bravo, J., Warren,
A. J., Bushweller, J. H. and Speck, N. A. (2003). Energetic
contribution of residues in the Runx1 Runt domain to DNA binding.
J. Biol. Chem. 278,33088
-33096.
Lutterbach, B., Hou, Y., Durst, K. L. and Hiebert, S. W.
(1999). The inv(16) encodes an acute myeloid leukemia 1
transcriptional corepressor. Proc. Natl. Acad. Sci.
USA 96,12822
-12827.
Mello, C. and Fire, A. (1995). DNA
transformation. In Caenorhabditis elegans: Modern Biological
Analysis of an Organism. Vol. 48 (ed. D.
Shakes and H. Epstein), pp. 451-482. San Diego:
Academic Press.[CrossRef]
Mitani, S. (1995). Genetic regulation of
mec-3 gene expression implicated in the specification of the
mechanosensory neuron cell types in Caenorhabditis elegans.
Dev. Growth Differ. 37,551
-557.[CrossRef]
Nagata, T. and Werner, M. H. (2001). Functional
mutagenesis of AML1/RUNX1 and PEBP2 beta/CBF beta define distinct,
non-overlapping sites for DNA recognition and heterodimerization by the Runt
domain. J. Mol. Biol.
308,191
-203.[CrossRef][Medline]
Nam, S., Jin, Y. H., Li, Q. L., Lee, K. Y., Jeong, G. B., Ito,
Y., Lee, J. and Bae, S. C. (2002). Expression pattern,
regulation, and biological role of runt domain transcription factor, run, in
Caenorhabditis elegans. Mol. Cell. Biol.
22,547
-554.
Nimmo, R., Antebi, A. and Woollard, A. (2005).
mab-2 encodes RNT-1, a C. elegans Runx homologue essential
for controlling cell proliferation in a stem cell-like developmental lineage.
Development 132,5043
-5054.
Pettitt, J., Wood, W. B. and Plasterk, R. H.
(1996). cdh-3, a gene encoding a member of the cadherin
superfamily, functions in epithelial cell morphogenesis in Caenorhabditis
elegans. Development
122,4149
-4157.[Abstract]
Pocock, R., Ahringer, J., Mitsch, M., Maxwell, S. and Woollard,
A. (2004). A regulatory network of T-box genes and the
even-skipped homologue vab-7 controls posterior patterning and
morphogenesis in C. elegans. Development
131,2373
-2385.
Stein, G. S., Lian, J. B., van Wijnen, A. J., Stein, J. L.,
Montecino, M., Javed, A., Zaidi, S. K., Young, D. W., Choi, J. Y. and
Pockwinse, S. M. (2004). Runx2 control of organization,
assembly and activity of the regulatory machinery for skeletal gene
expression. Oncogene 23,4315
-4329.[CrossRef][Medline]
Sulston, J. E. and Horvitz, H. R. (1977).
Post-embryonic cell lineages of the nematode, Caenorhabditis elegans.
Dev. Biol. 56,110
-156.[CrossRef][Medline]
Sulston, J. and Hodgkin, J. (1988). Methods. In
The Nematode Caenorhabditis elegans (ed. W. B. Wood),
pp. 587-606. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory Press.
Sulston, J. E., Albertson, D. G. and Thomson, J. N.
(1980). The Caenorhabditis elegans male: postembryonic
development of nongonadal structures. Dev. Biol.
78,542
-576.[CrossRef][Medline]
Tahirov, T. H., Inoue-Bungo, T., Morii, H., Fujikawa, A.,
Sasaki, M., Kimura, K., Shiina, M., Sato, K., Kumasaka, T., Yamamoto, M. et
al. (2001). Structural analyses of DNA recognition by the
AML1/Runx-1 Runt domain and its allosteric control by CBFbeta.
Cell 104,755
-767.[CrossRef][Medline]
Tanaka, J., Miwa, Y., Miyoshi, K., Ueno, A. and Inoue, H.
(1999). Construction of Epstein-Barr virus-based expression
vector containing mini-oriP. Biochem. Biophys. Res.
Commun. 264,938
-943.[CrossRef][Medline]
Tanaka, Y., Watanabe, T., Chiba, N., Niki, M., Kuroiwa, Y.,
Nishihira, T., Satomi, S., Ito, Y. and Satake, M. (1997). The
protooncogene product, PEBP2beta/CBFbeta, is mainly located in the cytoplasm
and has an affinity with cytoskeletal structures.
Oncogene 15,677
-683.[CrossRef][Medline]
Yan, J., Liu, Y., Lukasik, S. M., Speck, N. A. and Bushweller,
J. H. (2004). CBFbeta allosterically regulates the Runx1 Runt
domain via a dynamic conformational equilibrium. Nat. Struct. Mol.
Biol. 11,901
-906.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
M. Hajduskova, M. Jindra, M. A. Herman, and M. Asahina The nuclear receptor NHR-25 cooperates with the Wnt/{beta}-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans J. Cell Sci., September 1, 2009; 122(17): 3051 - 3060. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maekawa, T. Inoue, H. Kobuna, T. Nishimura, K. Gengyo-Ando, S. Mitani, and H. Arai Functional analysis of GS28, an intra-Golgi SNARE, in Caenorhabditis elegans Genes Cells, August 1, 2009; 14(8): 1003 - 1013. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Roudaia, M. D. Cheney, E. Manuylova, W. Chen, M. Morrow, S. Park, C.-T. Lee, P. Kaur, O. Williams, J. H. Bushweller, et al. CBF{beta} is critical for AML1-ETO and TEL-AML1 activity Blood, March 26, 2009; 113(13): 3070 - 3079. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||