|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 3 October 2007
doi: 10.1242/dev.008441
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early skeletogenesis
1 Department of Molecular Genetics, Weizmann Institute of Science, PO Box 26,
Rehovot 76100, Israel.
2 Molecular Biology Section, Division of Biology, University of California, San
Diego, CA, USA.
* Author for correspondence (e-mail: eli.zelzer{at}weizmann.ac.il)
Accepted 21 August 2007
| SUMMARY |
|---|
|
|
|---|
(HIF1
) in mouse
limb bud mesenchyme. Developmental analysis of Hif1
-depleted
limbs revealed abnormal cartilage and joint formation in the autopod,
suggesting that HIF1
is part of a mechanism that regulates the
differentiation of hypoxic prechondrogenic cells. Dramatically reduced
cartilage formation in Hif1
-depleted micromass culture cells
under hypoxia provided further support for the regulatory role of HIF1
in chondrogenesis. Reduced expression of Sox9, a key regulator of
chondrocyte differentiation, followed by reduction of Sox6, collagen
type II and aggrecan in Hif1
-depleted limbs raised the
possibility that HIF1
regulation of Sox9 is necessary under
hypoxic conditions for differentiation of prechondrogenic cells to
chondrocytes. To study this possibility, we targeted Hif1
expression in micromass cultures. Under hypoxic conditions, Sox9
expression was increased twofold relative to its expression in normoxic
condition; this increment was lost in the Hif1
-depleted cells.
Chromatin immunoprecipitation demonstrated direct binding of HIF1
to
the Sox9 promoter, thus supporting direct regulation of HIF1
on Sox9 expression. This work establishes for the first time
HIF1
as a key component in the genetic program that regulates
chondrogenesis by regulating Sox9 expression in hypoxic
prechondrogenic cells.
Key words: Hypoxia, HIF1, HIF1
, Mesenchymal condensation, Chondrocyte differentiation, Chondrogenesis, SOX9, Joint formation, Bone development, VEGF, GDF5, BMP, SOX5, SOX6
| INTRODUCTION |
|---|
|
|
|---|
During the initial stages of this process, the limb vasculature undergoes a
remodeling process that renders the condensing mesenchyme avascularized
(Feinberg et al., 1986
;
Hallmann et al., 1987
). As the
condensations increase in size, cells differentiate into chondrocytes, forming
a cartilaginous template of the future bones. The cartilaginous elements of
the autopod develop last, as each digit originates from a single condensation
known as the digital ray (Oster,
1988
). As the digital ray increases in size, it undergoes
segmentation, giving rise to the carpal, tarsal and the phalangeal elements.
The ensuing formation of joints between the separating segments begins with
the appearance of a higher cell density domain, called the interzone, at the
site of the future joint. Cells in this region lose typical chondrocyte
characteristics, as they reduce the expression of collagen type II (also known
as procollagen, type II alpha 1 - Mouse Genome Informatics) and instead
express markers such as Wnt9a, Gdf5, Bmp2 and noggin
(Hartmann and Tabin, 2001
;
Seemann et al., 2005
). Next,
the joint cavitates within the interzone, separating the two skeletal elements
(Archer et al., 2003
;
Mitrovic, 1977
;
Pacifici et al., 2005
).
As development proceeds, the avascularized cartilaginous template is eroded
and replaced by vascularized bone in a process termed endochondral
ossification (Karsenty and Wagner,
2002
; Kronenberg,
2003
; Olsen et al.,
2000
).
Mesenchymal condensation is the initial step in cartilage formation, and
the transcription factor SOX9 is an essential regulator of this process
(Bi et al., 1999
). Inactivation
of Sox9 in limb mesenchymal and neural crest cells results in
complete absence of mesenchymal condensation and subsequent failure in
cartilage formation (Akiyama et al.,
2002
; Mori-Akiyama et al.,
2003
). Furthermore, SOX9 is needed during the sequential steps
that follow mesenchymal condensation. Inactivation of Sox9 after the
condensation step results in chondrodysplasia with severe reduction in
cartilage-specific extracellular matrix protein and attenuation in chondrocyte
proliferation (Akiyama et al.,
2002
).
Two other members of the Sox family, namely L-SOX5 and SOX6, are necessary
to maintain the chondrocyte differentiation process. Whereas targeting the
expression of either Sox5 or Sox6 resulted in limited
skeletal abnormalities, mutant embryos that lacked both genes showed severe
aberrations in cartilage formation (Smits
et al., 2001
). The precise mechanism that regulates the expression
of Sox9, Sox5 and Sox6 is unknown; nevertheless, normal
expression of Sox9 observed in Sox5- and Sox6-null
mice and the loss of Sox5 and Sox6 expression in
Sox9-deficient mesenchymal cells position Sox9 upstream from
its two family members (Akiyama et al.,
2002
; Smits et al.,
2001
).
The regression of blood vessels from sites where mesenchyme condense is likely to induce a localized reduction in oxygen tension at those vessel-free domains, thus forming hypoxic niches. Numerous studies on a variety of cell types have reported that hypoxia has an inhibitory effect on cell differentiation. In view of that, the expected consequence of hypoxic niche formation at the condensation sites would be differentiation arrest. The implication of mesenchymal differentiation into chondrocytes is the existence of a unique mechanism that enables this process to take place under hypoxic conditions.
The transcription factor complex hypoxia-inducible factor 1 (HIF1) is a key
mediator of adaptive responses to changes in cellular oxygen level
(Semenza, 1998
). HIF1 is a
heterodimer that consists of HIF1
, the oxygen sensitive subunit, and
the constitutively expressed HIF1ß (also referred to as ARNT). Under
normoxia, HIF1
is hydroxylated by prolyl hydroxylases that act as
oxygen sensors (Semenza,
2004
). The hydroxylation of proline residues is followed by rapid
proteasomal degradation (Jaakkola et al.,
2001
). Conversely, when under hypoxic conditions HIF1
is
stabilized, as a result of reduced proteasome-mediated degradation. It then
binds to HIF1ß and enhances the transcription of genes that are involved
in glucose metabolism, angiogenesis, and cell survival
(Schofield and Ratcliffe,
2004
; Semenza,
2003
).
A previous study identified HIF1
as a critical factor in chondrocyte
survival (Schipani et al.,
2001
). In that study, Hif1
expression was
abolished in collagen type II-expressing chondrocytes. Finding that at initial
stages of chondrogenesis cells of the forming condensations are hypoxic led us
to hypothesize that HIF1
has an additional and yet unidentified role in
earlier stages of skeletogenesis.
This study describes a novel role for HIF1
as a regulator of
Sox9 expression in hypoxic prechondrogenic condensations.
Hif1
deletion in mouse limb mesenchyme led to differentiation
arrest of prechondrogenic condensation and resulted in severe skeletal
malformations. Moreover, the dramatic reduction in Sox9 expression in
the prechondrogenic condensation, accompanied by misexpression of
Gdf5 and noggin in Hif1
-depleted limb,
provides a molecular mechanism to explain the joint abnormalities observed in
Hif1
- depleted limbs. Micromass cultures experiments
further supported the role of HIF1
in chondrogenesis: under hypoxic
conditions Sox9 expression increased in control cells; this increment
was lost in Hif1
- depleted cells. Furthermore, under
normoxic conditions Hif1
overexpression induced an increase in
Sox9 expression.
Chromatin immunoprecipitation (ChIP) assay provided evidence for direct
interaction of HIF1
with the Sox9 promoter, thus supporting
direct regulation of HIF1
on Sox9 expression. Our findings
establish HIF1
as a key component in the mechanism that regulates
chondrogenesis by regulating Sox9 expression in the hypoxic
prechondrogenic condensations.
| MATERIALS AND METHODS |
|---|
|
|
|---|
(Ryan et al., 2000
Skeletal preparations
Cartilage and bones in whole mouse embryos were visualized after staining
with Alcian Blue and Alizarin Red S (Sigma) and clarification of soft tissue
with potassium hydroxide (McLeod,
1980
).
Micro-CT analysis
Three-dimensional high-resolution images were obtained from the left limb
of Prx1-Hif1
and control embryos using microcomputed
tomography (GE Healthcare, London, Ontario, Canada). Scans were taken at 8
µm isotropic resolution. Images were reconstructed and thresholded to
distinguish bone voxels with MicroView software version 5.2.2 (GE Healthcare).
One threshold was chosen for all specimens.
Histology, immunofluorescence and in situ hybridization
For histology and section in situ hybridization, embryos were fixed
overnight in 4% PFA-PBS, dehydrated to 100% ethanol, embedded in paraffin and
sectioned at 7 µm. Section and whole-mount in situ hybridizations were
performed as described previously
(Murtaugh et al., 1999
;
Riddle et al., 1993
). All
probes are available on request. Hematoxylin and Eosin (H&E) staining was
performed following standard protocols.
For immunofluorescence, embryos were embedded in OCT (Tissue-Tek) and 7
µm cryostat sections were made. Cryosections were fixed for 20 minutes in
4% PFA-PBS, permeabilized with 0.1% Triton X-100 and incubated with anti-CD31
(BD PharMingen), monoclonal anti-HIF1
(Novus Biologicals, Littleton,
CO, USA), anti-collagen type II (Developmental Studies Hybridoma Bank, The
University of Iowa, IA, USA). Secondary antibodies were purchased from Jackson
Laboratories. All experiments were performed with at least three different
wild-type (WT) and knockout (KO) limbs from different litters.
Hypoxia detection
Animals were injected with 60 mg/kg hypoxyprobe-1 (Chemicon) and sacrificed
30 minutes after injection. Paraffin sections (7 µm) were stained with
FITC-conjugated Hypoxyprobe-1 Mab-1 according to the manufacturer's
protocols.
BrdU assay
Female mice were injected with 100 mg/kg BrdU (Sigma) and sacrificed 2
hours later. Embryo limbs were collected, fixed with 4% PFA-PBS, embedded in
paraffin and 7 µm sections were made. Further processing was performed with
a BrdU staining kit (Zymed). To quantify the rate of cell proliferation,
serial images of the same digits were collected and BrdU-positive cells (red)
and negative cells (gray) in the phalangeal region were counted in four
control and four Prx1-Hif1
limbs from two different litters.
Statistical significance was determined by Student's t-test.
Primary cell culture preparations and viral transfer
For micromass cultures, limbs of E11.0-E11.5 floxed-Hif1
embryos were collected, digested with 0.1% collagenase IV, 0.1% trypsin
(Sigma) and 2% FCS for 15 minutes. The cell suspension was placed in DMEM-F12,
10% FCS. Cells were plated as 10 µl droplets at 2x107
cells/ml. Cells were allowed to attach for 75 minutes and were then overlaid
with 300 µl of DMEM-F12, 10% FCS containing 6.5x107 viral
particles/µl of Adeno-Gfp, Adeno-Cre, Ad-ßgal (Gene Transfer Vector
Core, University of Iowa) or Adeno-Sox9 (kindly provided by Dr H. Akiyama,
Kyoto University, Japan). Medium was changed daily. Cells were cultured either
with 20% oxygen (normoxia) or 1% oxygen (hypoxia) balanced with N2
in a 3-Gas incubator (Heraeus) in a humidified atmosphere. Cells were moved to
hypoxia 24 hours after the initial plating, and after 96 hours the cultures
were either stained with Alcian Blue (pH 1) to visualize chondrogenic nodule
formation or harvested to extract RNA. For lentivirus production, cDNA
encoding stabilized human HIF1
was digested from PEF-HIF1
P564A/N803A plasmid (kindly provided by Dr M. Whitelaw, University of Adelaid,
South Australia) and subcloned into lentiviral transfer vector (kindly
provided by Dr Inder M. Verma, Salk Institute, California). Lentivirus
production and purification was carried out according to the method of
Tiscornia et al. (Tiscornia et al.,
2006
).
Immunohistochemistry
For immunohistochemical staining of micromass cultures, cells were fixed
for 15 minutes at room temperature with 4% paraformaldehyde in PBS and then
washed twice with PBS. Endogenous peroxidase activity was inactivated by
incubating the cells for 30 minutes in 1% H2O2 in PBS.
Cells were subsequently washed three times with PBS, blocked for 30 minutes
with PBS, 10% FCS and 0.1% Triton X-100, and incubated with the primary
antibodies against collagen type II (II-II6B3 supernatant, 1:30) from the
Developmental Hybridoma Bank (Iowa). The signal was detected using a
biotinylated anti-mouse secondary antibody (dilution 1:250; Vector
Laboratories) in combination with the ABC Kit (Vector Laboratories) and DAB
(Vector Laboratories) as a substrate.
|
Western blot analysis
For western blot analysis, protein was extracted from micromass cultures.
Protein concentration was determined using the BCA assay (Pierce). SOX9
(1:1000; Santa Cruz Biotechnology) and
-tubulin (1:1000; Sigma)
antibodies were used, followed by the appropriate HRP-conjugated secondary
antibodies (1:10,000; Jackson ImmunoResearch) and luminol detection.
Chromatin immunoprecipitation
Micromass lysates were prepared as follows: 20 drops, each 10 µl at
2x107 cells/ml were plated and either cultured under 1%
oxygen (hypoxia) or 20% oxygen (normoxia) for 12 hours. Cells were
cross-linked in vivo with 1.5% formaldehyde for 10 minutes in the incubator
chamber. The cells were washed once with PBS and incubated with 0.25%
trypsin-EDTA for 20 minutes. Cells were washed with 2.5 ml of cold PBS and
homogenized in 1 ml of buffer I [10 mM Hepes (pH 6.5), 10 mM EDTA, 0.5 mM
EGTA, 0.25% Triton X-100]; lysates were washed once with buffer II [10 mM
Hepes (pH 6.5), 1 mM EDTA, 0.5 mM EGTA, 200 mM NaCl]. Cell extracts were
prepared for ChIP as described previously
(Ainbinder et al., 2004
). For
immunoprecipitation, 5 µl of either polyclonal anti-HIF1
(Abcam) or
control IgG were added to 0.5 ml of the soluble chromatin (corresponding to
5x105 cells) and the mixture was incubated overnight at
4°C. Purified DNA from immunoprecipitates, as well as of the input
material, was analyzed by real-time PCR using the Roche Sybr green
quantification method. Results were normalized and presented as percentage of
input DNA. The primers sequences used for amplification of potential HIF1
binding sites in Sox9 and Pgk1 (phosphoglycerate kinase 1)
promoters are the following [relative to transcription start site (+1)]:
Sox9 amplicon A forward (-1949) GCCTTTGTGCCAGAATACGTGA, reverse
(-1695) ACCCTGTAGCCTGTTTACGAGT; amplicon B forward (-917)
TGTGACTCAGTCAGGAGGCAAGAA, reverse (-723) TGAAAACCAAAGCCGAGCACCA; amplicon C
forward (-495) CATTGCTGTAAACGCCAGCGAA, reverse (-312)
GTTTTGGAACGGTCTCCGTGTGAA; amplicon D forward (-102) TCAGCGACTTGCCAACACTGAT,
reverse (+46) CCCACAGAAGTTTCCAGGCAGTT; Pgk1 forward (-302)
CCTCGCACACATTCCACATCCA, reverse TCAGCGACTTGCCAACACTGAT.
Formaldehyde cross-linked plasmid immunoprecipitation (plasmid IP)
pGL3-basic vector containing 2.8 kb of mouse Sox9 proximal
promoter was kindly provided by Dr C. Hartmann (Research Institute for
Molecular Pathology, Vienna, Austria). Mutant constructs encoding a 4-nt
substitution (CGTG to AAAA) were prepared in the context of the full-length
Sox9 promoter by PCR using the following primers: forward
5'-ATAGGTACCACGGAGACAGCATCGAAAAGTGGGGGTGGGGGGTTGTGGAGGGTCCTAGTCTAGACACGCTCGAAAACACGCGCACACACACAC-3',
reverse 5'-TCTCTCGAGCGACTTCCAGCTCAGGGTCTCTA-3'.
PCR was performed under the following conditions: 2 minutes at 94°C; 0.3 minutes at 94°C; 0.5 minutes at 55°C; 0.5 minutes at 72°C for 33 cycles and 5 minutes at 72°C. The PCR product was then digested with ACC65I and XhoI and ligated into pGL3-basic promoter. A 2.3 kb ACC65I-ACC65I was digested from the WT mouse Sox9 promoter and ligated into ACC65I to construct a 2.8 kb Sox9 promoter with mutated HRE.
At 70% confluence, 293A cells in a 100-mm dish were transfected with 1
µg of either WT or mutated pGL3 Sox9 promoter and 3 µg of
PEF-HIF1
P564A/N803A. At 30 hours after transfection, cells were fixed
in normal culture medium with formaldehyde at a final concentration of 1% for
10 minutes at 37°C. Plasmid IP was perform as described previously
(Ainbinder et al., 2004
).
| RESULTS |
|---|
|
|
|---|

|
and Pgk1, a bona fide Hif1
target gene, in these cells. Immunofluorescence analysis detected
Hif1
expression in differentiating chondrocytes in the E13.5
autopod (Fig. 1F).
Pgk1 expression followed the pattern we observed using the
hypoxyprobe, as it was detected in proximal elements of the limb and in the
forming joints (Fig. 1G,I).
Interestingly, Pgk1 expression was observed in cells located at the
center of the digits, whereas in the periphery the expression was reduced
dramatically. Pgk1 expression was lost in the autopod and the
zeugopod upon inactivation of Hif1
in the limbs, indicating
that the expression of Pgk1 in the skeletal elements is HIF1
dependent (Fig. 1H,J). These
results demonstrate that differentiating prechondrogenic cells in the limb are
hypoxic and express Hif1
.
Lack of HIF1
in limb mesenchyme leads to impaired embryonic skeletal development
Finding that mesenchymal cell differentiation into chondrocytes and joint
formation did take place under oxygen deprivation led us to study whether
HIF1
is involved in the mechanism that supports differentiation under
these conditions.
Using the Prx1 promoter to drive the expression of Cre
recombinase (Logan et al.,
2002
), we analyzed mice with a conditional deletion of
Hif1
in limb bud mesenchyme. Embryos homozygous for
floxed-Hif1
and heterozygous for Prx1-Cre
alleles (Prx1-Hif1
) were compared with embryos heterozygous
for floxed-Hif1
and Prx1-Cre alleles
(control). Skeletal preparations of E18.5 Prx1-Hif1
embryos
demonstrated a significant retardation in skeleton development relative to
control: long bones were shorter, severely deformed and less mineralized, with
joint fusion in elbow, knee and phalangeal joints
(Fig. 2A-C). Examination of the
autopod revealed severe defects in carpal and tarsal and digit formation.
Cartilage formation was mostly identified in the periphery of the forming
digits (Fig. 2C).
Histological examination of the Prx1-Hif1
limb confirmed
the previously described role of HIF1
in chondrocyte survival
(Schipani et al., 2001
). Cell
death in the proximal part of the skeleton was initiated at the joint region
by E12.5 and was clearly visible at E13.5
(Fig. 2D and see Fig. S1 in the
supplementary material). By E18.5 cell death at the joint region was extensive
in most of the cartilaginous elements of the limb with the exception of the
autopod (data not shown). In the autopod we observed only minor cell death,
starting at E15.5 (see Fig. S1 in the supplementary material). At that stage
we observed cells at the center of the digits that failed to differentiate, as
they did not stain with Alcian Blue (see Fig. S2 in the supplementary
material).
|
in limb mesenchyme led to
severe abnormalities in all skeletal elements
(Fig. 2). However, the
extensive chondrocyte cell death in the proximal skeletal elements prevented
sufficient analysis of the direct roles of HIF1
in chondrogenesis. Our
observation that cartilage formation in the autopod of the
Prx1-Hif1
mouse occurred without noticeable cell death enabled
us to study the possible roles of HIF1
in skeleton development
regardless of its role in chondrocyte survival.
Further histological examination of the Prx1-Hif1
autopod
revealed loss of phalanges in some of the digits
(Fig. 2F). Some phalangeal
joints were missing or only partially cavitated, whereas some of the joints
that were cavitated lacked articular cartilage
(Fig. 2E and see Fig. S1 in the
supplementary material).
To evaluate the developmental abnormalities in the
Prx1-Hif1
ossified skeleton we examined skeletons of
post-natal day 21 mice by micro-CT. As can be seen in
Fig. 2, the
Prx1-Hif1
autopod digit five (D5) is missing one phalanx
(Fig. 2G,H). In D3, the joint
between the distal and the intermediate phalanges is partially fused
(Fig. 2I). In addition, the
metacarpophalangeal joints are severely deformed
(Fig. 2G). In D1, the distal
and the intermediate phalanges are fused and the joint is deformed
(Fig. 2G). The sesamoid bones,
which are located adjacent to the metacarpophalangeal joint, are fully or
partially fused with the contiguous elements in the Prx1-Hif1
skeleton (Fig. 2G-I).
The severe abnormalities of Prx1-Hif1
skeleton strongly
suggest that HIF1
plays a key role in the mechanism that regulates
cartilage and joint formation.
HIF1
regulates the expression of Sox9 in prechondrogenic cells
Histological examination of E13.5 Prx1-Hif1
sections of the
autopod revealed cells that appeared as undifferentiated mesenchyme in the
center of the forming digits. Furthermore, while the interzone, which marks
the forming joint, had emerged in the control digits, it failed to appear in
the Prx1-Hif1
digits (Fig.
3A,B).
To study the possibility that prechondrogenic cells in the
Prx1-Hif1
forming digits cease to differentiate, we examined
the expression of Sox9 in E11.5-E13.5 Prx1-Hif1
autopods by section in situ hybridization. To date, Sox9 is the
earliest known marker for condensing mesenchyme. Sox9 expression
pattern in E11.5 Prx1-Hif1
limbs was comparable with the
control limbs (Fig. 3C); by
contrast, Sox9 expression at E12.5 was noticeably altered: expression
was observed only in the periphery outlining the forming phalanges, whereas at
the center, where we observed undifferentiated mesenchymal cells,
Sox9 expression was dramatically reduced
(Fig. 3D). By E13.5 the effect
we had observed at E12.5 became much more noticeable
(Fig. 3E). Concomitantly with
the loss of Sox9 expression, the expression of additional markers for
chondrocyte differentiation, Sox6, collagen II and aggrecan, were
lost as well (Fig. 3F-H).
Interestingly, unlike in the control, when Sox9 and collagen II
expression was reduced at the sites where joints were forming, the
Prx1-Hif1
sections lacked the Sox9 and collagen II
segmentation profile. Sox6 expression at E13.5 seemed to increase in
the forming joints of the control, but was missing in the
Prx1-Hif1
sections, where digits also lacked the interzone
(Fig. 3F).
The loss of Sox9, followed by the loss of Sox6, collagen
II and aggrecan expression in the Prx1-Hif1
autopod strongly
suggest that under hypoxic conditions HIF1
is necessary to maintain the
differentiation program of prechondrogenic cells to chondrocytes.
Loss of Hif1
in limb mesenchyme affects chondrocyte proliferation
Previous experiments where Sox9 expression was abolished in
chondrocytes resulted in reduced chondrocyte proliferation
(Akiyama et al., 2002
). The
reduction in both Sox9 expression and the size of
Prx1-Hif1
skeletal elements prompted us to examine whether the
loss of HIF1
affected cell proliferation by assessing the incorporation
of BrdU into the cells of the forming digits at E14.5. Whereas cell
proliferation in the regions outside the forming digits was comparable in
Prx1-Hif1
and control autopods, we observed a 3.5-fold
reduction in the percentage of cell proliferation in Prx1-Hif1
digits, including the regions where joints were forming
(Fig. 4B).
|
prechondrogenic cells to chondrocytes is associated
with reduced cell proliferation.
Loss of Hif1
in limb mesenchyme results in abnormal interzone formation
Our observations of abnormal joint formation in the
Prx1-Hif1
limb (Figs
2,
3 and
4) led us to explore the
involvement of HIF1
during early events of joint formation by examining
the expression of Gdf5, a marker for joint formation
(Storm and Kingsley, 1999
). In
E12.5 control autopods, Gdf5 expression was mainly observed at joint
formation sites and in the interdigital zone surrounding the forming
condensation (Fig. 5A). By
E13.5-E15.5, Gdf5 expression was reduced outside the forming digits,
and it was mostly observed in the developing joints
(Fig. 5B-D,G). Gdf5
expression in E12.5 Prx1-Hif1
limb was missing from the
domains in which joints should have been developed, and was observed instead
on the distal side of the developing digits; in the interdigital zone
Gdf5 expression was higher than in the control
(Fig. 5A). By E13.5, the
differences became more obvious: Gdf5 expression in the interdigital
zone was still prominent. In the Prx1-Hif1
digits,
Gdf5 expression could be observed on the distal side of the
metacarpals, but instead of outlining the forming joint the expressing cells
were located in the center of the digits
(Fig. 5B,C). By E14.5-15.5, in
some of the digits we detected indications of aberrant interzone formation;
Gdf5 expression domains were broader relative to the control, with
indistinct borders (Fig. 5D,G).
However, unlike in the control, we could not detect at that stage the
expression of interzone markers such as Wnt9a or Bmp2 in the
Prx1-Hif1
joints (Fig.
5F-I).
Interestingly, the expression pattern of noggin, a GDF5 antagonist that is
known to regulate cartilage and joint formation
(Brunet et al., 1998
), was also
altered in Prx1-Hif1
limb. In E14.5 control autopod, noggin
expression could be observed in prehypertrophic chondrocytes, epiphyseal
chondrocytes and in the forming joints
(Fig. 5E). In the
Prx1-Hif1
limb, noggin expression was lost in the center of
the forming digits but was instead present in the cells that outlined the
digits (Fig. 5E). These results
raise the possibility that joint abnormalities in Prx1-Hif1
limb are a consequence of interference with the GDF5-noggin signaling.
Vegf expression in limb mesenchyme is partially regulated by Hif1
Vegf (vascular endothelial growth factor, also known as
Vegfa - Mouse Genome Informatics) is a well-documented
transcriptional target of HIF1
(Forsythe et al., 1996
;
Liu et al., 1995
). To examine
the possibility that HIF1
regulates Vegf expression in the
limb and, as a consequence, regulates limb vasculature, we analyzed
Vegf expression in E12.5 Prx1-Hif1
and control limbs
by quantitative RT-PCR analysis. Vegf expression in the in
Prx1-Hif1
limb was reduced by 30% relative to the control
(Fig. 6C). To evaluate whether
the reduction of Vegf in the Prx1-Hif1
limb caused
vasculature abnormalities we examined vasculature development and patterning
in the Prx1-Hif1
limb using sections double-stained with
antibodies for PECAM (CD31) and collagen II to identify endothelial cells and
chondrocytes, respectively. The vasculature in the Prx1-Hif1
autopod was comparable with that of the control
(Fig. 6A,B); however, we
observed a substantial decrease in collagen II expression that was well
correlated with the reduction we detected in the collagen II mRNA level
(Fig. 6B).
These results suggest that the regulation of Vegf and the
vasculature in the limb is only partially regulated by HIF1
.
HIF1
is necessary for differentiation of mesenchymal precursors cells cultured under hypoxic conditions
The reduction in the expression of Sox9, Sox6 and collagen II in
the Prx1-Hif1
autopod strongly implies that HIF1
is
required to maintain the differentiation of prechondrogenic cells to
chondrocytes.
To unambiguously demonstrate that HIF1
is cell-autonomously required
in mesenchymal precursors for their differentiation into chondrocytes we used
high-density micromass culture as an in vitro model
(DeLise et al., 2000
).
Micromass cultures derived from limb buds of
floxed-Hif1
embryos were infected by either adeno-Cre
virus (AdCre) to delete HIF1
, or adenovirus expressing GFP (AdGfp) as a
control. To assess the efficiency of HIF1
deletion by AdCre we measured
the expression of Hif1
and Pgk1, a defined
HIF1
target gene, using real-time PCR. Micromass cultures infected by
AdCre or AdGfp were cultured under hypoxic or normoxic conditions. Under
normoxic or hypoxic conditions the expression level of Hif1
in
AdCre-infected cells was 25% and 12%, respectively, relative to the control
(Fig. 7A). Pgk1
expression level in control cells under hypoxic conditions increased more than
twofold compared with normoxic levels, whereas in
Hif1
-depleted cells this elevation was lost, as the
level of expression was similar to normoxic values, suggesting an efficient
blockage of HIF1
activity (Fig.
7B).
|
-depleted mesenchymal
precursors to form cartilage nodules. Micromass cultures infected by AdCre or
AdGfp were cultured under hypoxic or normoxic conditions and stained with
Alcian Blue or tested by immunohistochemistry using collagen II antibody. As
can be seen in Fig. 7C, in
Hif1
-depleted cells under normoxia there was a mild
reduction in nodule formation relative to control cells, whereas under hypoxic
conditions, nodule formation by Hif1
-depleted cells
was dramatically reduced. Next we examined the expression of collagen II and
aggrecan, markers for chondrocyte differentiation, by quantitative RT-PCR.
Interestingly, their expression showed a similar pattern to that of
Pgk1. In control cells under hypoxic conditions their expression was
elevated 1.6- and 2.3-fold, respectively, compared with normoxic levels,
whereas in hypoxic Hif1
-depleted cells this increment was lost
(Fig. 7D,E).
HIF1 directly regulates Sox9 expression
The reduction in Sox9 expression in vivo along with the expression
pattern of Sox9 target genes collagen II and aggrecan in vitro, led
us to investigate whether HIF1 regulates Sox9 expression. First we
studied the ability of Hif1
overexpression to increase
Sox9 expression under normoxic conditions. Sox9 expression
in micromass cultures infected with either lentivirus (Lv)-HIF1
or
Lv-Gfp (control) was examined by quantitative RT-PCR. In cells infected with
Lv-HIF1
the expression of Sox9 was elevated twofold, similar
to Pgk1, a bona fide HIF1
target gene
(Fig. 8A).
To further establish the regulation of Sox9 by HIF1
, the
expression of Sox9 in Hif1
-depleted cells was
examined by quantitative RT-PCR and western blot analysis. Under normoxia, in
Hif1
-depleted cells there was a 29% reduction in the
expression of Sox9 relative to the control
(Fig. 8B). Under hypoxic
conditions there was a twofold increment in Sox9 expression in
control cells, whereas in Hif1
-depleted cells the
elevation was lost as the level of expression was similar to normoxic values
(Fig. 8B). Concomitantly with
the lack of Sox9 mRNA induction in
Hif1
-depleted cells, under hypoxic conditions SOX9
protein level was dramatically reduced
(Fig. 8C). Next we examined the
expression of Sox5 and Sox6; as can be seen in
Fig. 8D,E, their expression
profile followed Sox9 expression. Under normoxia, in
Hif1
-depleted cells there was a mild reduction in the
expression of Sox5 and Sox6 relative to the control. Under
hypoxic conditions there was a 2.3-fold increment in Sox5 expression
and 1.6-fold increment in Sox6 expression in control cells, whereas
in the Hif1
-depleted cells the level of expression
was similar to values measured under normoxic conditions.
In order to examine whether HIF1
directly regulated Sox9
expression we searched the mouse Sox9 promoter for HIF1 consensus
binding sites (also referred to as hypoxia response elements or HRE)
(Wenger et al., 2005
). We
identified four putative binding sites within 3.0 kb upstream to the
transcription initiation site (Fig.
8F). In order to examine whether HIF1
binds to one or more
of the putative sequences, chromatin immunoprecipitation (ChIP) was performed
using lysate from micromass cells cultured under either hypoxia or normoxia.
The lysate was incubated with either an anti-HIF1
antibody or anti
ß-galactosidase antibody (as control). As a positive control we
demonstrated binding of HIF1
to Pgk1, in chromatin from
hypoxic cells (see Fig. S2 in the supplementary material). Our analysis
revealed that HIF1
bound to an HRE sequence located 398 bp upstream of
the transcription initiation site (HRE 398). The other three HRE binding sites
did not reveal any significant binding
(Fig. 8G,H). Interestingly,
HIF1
bound to HRE 398 sequence under normoxia as well, although with
lower affinity. This result might explain the reduction in Sox9 mRNA
level that we observed in cells cultured under normoxia
(Fig. 8B).
|
consensus binding
site that we identified in the Sox9 promoter, we substituted four
nucleotides in the core consensus sequence of HRE 398 and examined HIF1
binding to the mutated Sox9 promoter using a plasmid IP experiment.
HIF1
binding was evaluated in 293A cells that were co-transfected with
an HIF1
-expressing plasmid and with plasmids that contained either the
WT Sox9 promoter or a Sox9 promoter with mutations in HRE
398. We detected HIF1
binding to the HRE 398 region in cells that were
transfected with the control Sox9 promoter; the binding was lost once
the HRE 398 site was mutated (Fig.
8I).
These results indicate that HIF1
directly regulates Sox9
expression. In addition, they show that HIF1
-dependent regulation of
Sox9 is necessary to maintain Sox5 and Sox6
expression under hypoxic conditions.
| DISCUSSION |
|---|
|
|
|---|
. Hif1
deletion in limb mesenchyme led
to dramatic reduction in Sox9 expression followed by differentiation
arrest that resulted in severe skeletal malformations. Using micromass
cultures as an in vitro model for chondrogenesis we found that HIF1
directly regulated Sox9 expression, thus providing a molecular
mechanism for the abnormalities observed in Prx1-Hif1
limbs.
These findings establish HIF1
as a key component in the mechanism that
regulates embryonic chondrogenesis.
Hypoxia and development
Until the establishment of a connection with maternal blood supply at E8.5,
the murine embryo experiences low oxygen tension within the hypoxic range. At
later stages of development, organ growth that precedes vascular development
leads to hypoxic micro-environments
(Maltepe and Simon, 1998
;
Mitchell and Yochim, 1968
;
Rodesch et al., 1992
). During
evolution, several organs have adapted to hypoxic developmental conditions and
integrated hypoxia into their intrinsic genetic program as an external
regulatory signal. Organs such as the neural tube
(Hogan et al., 2004
), placenta
(Cowden Dahl et al., 2005
;
Ambati et al., 2006
) and
skeleton develop in the absence of embedded vasculature. The hypoxic niches
that are formed directly affect the developmental process of each specific
organ. The most profound effect of hypoxia during organogenesis is the
regulation of differentiation and proliferation of progenitor cells. Hypoxia
may either promote or inhibit differentiation in a cell-type-specific manner.
For example, whereas hypoxia prevents the differentiation of hES cells
(Ezashi et al., 2005
) and
inhibits myogenesis (Gustafsson et al.,
2005
), osteogenesis (D'Ippolito
et al., 2006
; Salim et al.,
2004
) and adipogenesis (Yun et
al., 2002
), it promotes the differentiation of mesencephalic
precursors (Studer et al.,
2000
) and enhances hemangioblast specification
(Ramirez-Bergeron et al.,
2004
).
In order to sense oxygen tension and convert the information into a
cellular response, cells have developed a molecular signaling pathway in which
HIF1 is an essential component (Semenza,
2004
). Evidence for the significance of this pathway in embryonic
development came from genetic studies. Null mutations in Hif1
subunits led to early embryonic lethality due to placental failure, neural
tube and vascular defects (Maltepe et al.,
1997
; Semenza et al.,
1999
). More recent studies have provided molecular insight into
the role of HIF1 in the developmental response to hypoxia. Under hypoxia, HIF1
upregulates the expression of Vegf, Flk-1 (also known as Kdr
- Mouse Genome Informatics) and erythropoietin, as well as other genes
involved in vascular development (Maltepe
and Simon, 1998
). This molecular response is essential for the
proper differentiation and maintenance of the cardiovascular system.
HIF1
inhibits the differentiation of myogenic and neural precursor cell
lines by enhancing Notch signaling
(Gustafsson et al., 2005
) and
prevents adipocyte differentiation by inhibiting PPAR
2 expression
(Yun et al., 2002
).
During initial stages of skeletogenesis the prechondrogenic condensations
are avascularized and, as shown in our work, hypoxic. Our study provides
direct evidence for the key role of HIF1
in the mechanism that has been
developed by prechondrogenic cells to support their differentiation into
chondrocytes and joint-forming cells. More specifically, under hypoxic
conditions HIF1
is necessary to regulate the expression of the key
chondrogenic regulator Sox9, in order to maintain chondrogenesis.
However, one interesting question that still remains to be resolved is the
evolutionary explanation for the selection of a genetic program that dictates
and requires that the chondrogenic process should take place under hypoxic
conditions. Although we have no definite answer, we favor the possibility that
the driving force behind this selection is to enhance the robustness of the
genetic program that regulates chondrogenesis. Limb mesenchyme can
differentiate to various lineages including chondrocytes, osteoblasts and
tendon-forming cells. It is possible that whereas hypoxia inhibits
differentiation of limb mesenchymal cells as a whole
(D'Ippolito et al., 2006
;
Salim et al., 2004
), the
chondrogenic lineage escapes this inhibition because of the regulation of
Sox9 by Hif1
.
The involvement of HIF1
in joint formation
The emergence of the interzone is the first histological indication of
joint formation (Mitrovic,
1977
). Molecularly, the expression of the chondrogenic markers
Sox9, collagen II and aggrecan decreases in interzone cells, whereas
the expression of Gdf5, noggin, Wnt9A and Bmp2 is
elevated. In our study, both histological and molecular examinations of
Prx1-Hif1
autopods showed abnormal interzone formation
(Fig. 5).
|
limb may result
from the reduction in Sox9 and the consequent failure of
prechondrogenic cells to differentiate to chondrocytes. This suggests that the
ability of condensed mesenchymal cells to adopt interzone cell fate depends on
proper differentiation of the flanking cells into chondrocytes. Studies where
SOX9 was inactivated in prechondrocytes support this possibility: severe
reduction in cartilage formation was followed by fusion of the carpal elements
and low expression levels of noggin, Gdf5 and Wnt9a
(Akiyama et al., 2002
An alternative explanation may lie in our observation of abnormal
expression of Gdf5 and noggin
(Fig. 5A-E). It has been shown
that alterations in either the expression or activity of these two genes
resulted in multiple joint defects (Kjaer
et al., 2006
; Lehmann et al.,
2003
; Seemann et al.,
2005
). Gdf5 misexpression by implantation of beads into
the interdigital region of E12.5 embryos resulted in interference in
metacarpophalangeal joint development, with reduction in the expression of
joint markers and increase in the expression of chondrogenic markers
(Storm and Kingsley,
1999
).
Noggin haploinsufficiency was recently reported to lead to carpal and
tarsal joint fusions (Tylzanowski et al.,
2006
). Human genetic studies further support this hypothesis:
point mutations that altered the activity of GDF5 and its antagonist noggin
resulted in brachydactyly and symphalangism
(Gong et al., 1999
;
Marcelino et al., 2001
;
Seemann et al., 2005
). The
expression of Gdf5 in Prx1-Hif1
limbs in our study
rules out the possibility that HIF1
is necessary for its expression
(Fig. 5A-D). Nevertheless, the
alterations we observed in Gdf5 and noggin expression patterns in
Prx1-Hif1
limbs may indicate that in the absence of
HIF1
the fine balance between noggin and GDF5 is disturbed, causing
aberrations in joint formation.
HIF1
regulates chondrocyte differentiation
Mesenchymal condensation is the initial step in cartilage formation, and
SOX9 is an essential regulator of this process
(Akiyama et al., 2002
). Our
finding that Prx1-Hif1
limb mesenchymal cells did condense and
initially expressed Sox9 (Fig.
3C) suggests that HIF1
is not necessary for chondrocyte
cell fate determination. However, later in development Sox9
expression is further required to regulate the differentiation of
prechondrogenic cells into chondrocytes. Our histological observation of cells
that appeared as undifferentiated mesenchyme and lacked Sox9
expression in the Prx1-Hif1
autopod implies that HIF1
is necessary to sustain the chondrogenic program by maintaining Sox9
expression in these cells (Fig.
3D,E)
Micromass culture experiments further supported the role of HIF1
in
regulating the transition of prechondrogenic cells to chondrocytes by
regulating Sox9 expression. Under hypoxia, cartilage nodule formation
by Hif1
-deleted mesenchymal cells was dramatically
reduced relative to the control (Fig.
7C). Quantitative real-time PCR revealed an HIF1
-dependent
induction of Sox9 expression under hypoxic conditions
(Fig. 8B). Moreover, forced
expression of HIF1
in these cells resulted in a twofold increase in
Sox9 mRNA level. These results suggest that HIF1
is necessary
to maintain the Sox9 mRNA level under hypoxic conditions
(Fig. 8B,C).
|
-dependent manner, as this elevation failed to occur in
Hif1
-deleted cells.
A previous study demonstrated that hypoxia could increase the activity of
the Sox9 proximal promoter in ST2 cell line. The increment was lost
when the HIF1 consensus binding site in the promoter was mutated
(Robins et al., 2005
). Our
analysis revealed four putative HIF1 consensus binding sites in a genomic
region spanning 3.0 kb upstream to transcription start site. ChIP and plasmid
IP analyses provided evidence for direct interaction of HIF1
with one
out of the four sites identified (Fig.
8H,I). Interestingly, Robins et al. identified the same element as
a potential HIF1 binding site, thus providing additional and independent
support for the direct regulation of Sox9 expression by
HIF1
.
With the exception of the three members of the SOX transcription factors
family, namely: SOX9, SOX5 and SOX6, very little is known about the
transcriptional machinery that regulates the various differentiation steps
leading to the formation of a functional chondrocyte. Finding both in vitro
and in vivo that the differentiation of mesenchymal cells to chondrocytes
required Hif1
expression suggests that HIF1
is an
essential component in the transcriptional mechanism that regulates the
transition of prechondrogenic cells to chondrocytes.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/21/3917/DC1
| ACKNOWLEDGMENTS |
|---|
expression plasmids. We thank Ms S. Kerief for expert
technical support, Mr N. Konstantin for expert editorial assistance and
members of the Zelzer laboratory for advice and suggestions. This work was
supported by Israel Science Foundation grant 499/05, Minerva grant M941, The
Leo and Julia Forchheimer Center for Molecular Genetics, The Stanley Chais New
Scientist Fund and The Women's Health Research Center. E.Z. is the incumbent
of the Martha S. Sagon Career Development Chair. | REFERENCES |
|---|
|
|
|---|
Ainbinder, E., Amir-Zilberstein, L., Yamaguchi, Y., Handa, H.
and Dikstein, R. (2004). Elongation inhibition by DRB
sensitivity-inducing factor is regulated by the A20 promoter via a novel
negative element and NF-kappaB. Mol. Cell. Biol.
24,2444
-2454.
Akiyama, H., Chaboissier, M. C., Martin, J. F., Schedl, A. and
de Crombrugghe, B. (2002). The transcription factor Sox9 has
essential roles in successive steps of the chondrocyte differentiation pathway
and is required for expression of Sox5 and Sox6. Genes
Dev. 16,2813
-2828.
Ambati, B. K., Nozaki, M., Singh, N., Takeda, A., Jani, P. D.,
Suthar, T., Albuquerque, R. J., Richter, E., Sakurai, E., Newcomb, M. T. et
al. (2006). Corneal avascularity is due to soluble VEGF
receptor-1. Nature 443,993
-997.[CrossRef][Medline]
Archer, C. W., Dowthwaite, G. P. and Francis-West, P.
(2003). Development of synovial joints. Birth Defects
Res. C Embryo Today 69,144
-155.[CrossRef][Medline]
Arteel, G. E., Thurman, R. G. and Raleigh, J. A.
(1998). Reductive metabolism of the hypoxia marker pimonidazole
is regulated by oxygen tension independent of the pyridine nucleotide redox
state. Eur. J. Biochem.
253,743
-750.[Medline]
Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. and de
Crombrugghe, B. (1999). Sox9 is required for cartilage
formation. Nat. Genet.
22, 85-89.[CrossRef][Medline]
Brunet, L. J., McMahon, J. A., McMahon, A. P. and Harland, R.
M. (1998). Noggin, cartilage morphogenesis, and joint
formation in the mammalian skeleton. Science
280,1455
-1457.
Cowden Dahl, K. D., Fryer, B. H., Mack, F. A., Compernolle, V.,
Maltepe, E., Adelman, D. M., Carmeliet, P. and Simon, M. C.
(2005). Hypoxia-inducible factors 1alpha and 2alpha regulate
trophoblast differentiation. Mol. Cell. Biol.
25,10479
-10491.
D'Ippolito, G., Diabira, S., Howard, G. A., Roos, B. A. and
Schiller, P. C. (2006). Low oxygen tension inhibits
osteogenic differentiation and enhances stemness of human MIAMI cells.
Bone 39,513
-522.[Medline]
DeLise, A. M., Stringa, E., Woodward, W. A., Mello, M. A. and
Tuan, R. S. (2000). Embryonic limb mesenchyme micromass
culture as an in vitro model for chondrogenesis and cartilage maturation.
Methods Mol. Biol. 137,359
-375.[Medline]
Ezashi, T., Das, P. and Roberts, R. M. (2005).
Low O2 tensions and the prevention of differentiation of hES cells.
Proc. Natl. Acad. Sci. USA
102,4783
-4788.
Feinberg, R. N., Latker, C. H. and Beebe, D. C.
(1986). Localized vascular regression during limb morphogenesis
in the chicken embryo. I. Spatial and temporal changes in the vascular
pattern. Anat. Rec. 214,405
-409.[CrossRef][Medline]
Forsythe, J. A., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S.
W., Koos, R. D. and Semenza, G. L. (1996). Activation of
vascular endothelial growth factor gene transcription by hypoxia-inducible
factor 1. Mol. Cell. Biol.
16,4604
-4613.[Abstract]
Gong, Y., Krakow, D., Marcelino, J., Wilkin, D., Chitayat, D.,
Babul-Hirji, R., Hudgins, L., Cremers, C. W., Cremers, F. P., Brunner, H. G.
et al. (1999). Heterozygous mutations in the gene encoding
noggin affect human joint morphogenesis. Nat. Genet.
21,302
-304.[CrossRef][Medline]
Gustafsson, M. V., Zheng, X., Pereira, T., Gradin, K., Jin, S.,
Lundkvist, J., Ruas, J. L., Poellinger, L., Lendahl, U. and Bondesson, M.
(2005). Hypoxia requires notch signaling to maintain the
undifferentiated cell state. Dev. Cell
9, 617-628.[CrossRef][Medline]
Hallmann, R., Feinberg, R. N., Latker, C. H., Sasse, J. and
Risau, W. (1987). Regression of blood vessels precedes
cartilage differentiation during chick limb development.
Differentiation 34,98
-105.[CrossRef][Medline]
Hartmann, C. and Tabin, C. J. (2001). Wnt-14
plays a pivotal role in inducing synovial joint formation in the developing
appendicular skeleton. Cell
104,341
-351.[CrossRef][Medline]
Hogan, K. A., Ambler, C. A., Chapman, D. L. and Bautch, V.
L. (2004). The neural tube patterns vessels developmentally
using the VEGF signaling pathway. Development
131,1503
-1513.
Jaakkola, P., Mole, D. R., Tian, Y. M., Wilson, M. I., Gielbert,
J., Gaskell, S. J., Kriegsheim, A., Hebestreit, H. F., Mukherji, M.,
Schofield, C. J. et al. (2001). Targeting of HIF-alpha to the
von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl
hydroxylation. Science
292,468
-472.
Karsenty, G. and Wagner, E. F. (2002). Reaching
a genetic and molecular understanding of skeletal development. Dev.
Cell 2,389
-406.[CrossRef][Medline]
Kjaer, K. W., Eiberg, H., Hansen, L., van der Hagen, C. B.,
Rosendahl, K., Tommerup, N. and Mundlos, S. (2006). A
mutation in the receptor binding site of GDF5 causes Mohr-Wriedt brachydactyly
type A2. J. Med. Genet.
43,225
-231.
Kronenberg, H. M. (2003). Developmental
regulation of the growth plate. Nature
423,332
-336.[CrossRef][Medline]
Lehmann, K., Seemann, P., Stricker, S., Sammar, M., Meyer, B.,
Suring, K., Majewski, F., Tinschert, S., Grzeschik, K. H., Muller, D. et
al. (2003). Mutations in bone morphogenetic protein receptor
1B cause brachydactyly type A2. Proc. Natl. Acad. Sci.
USA 100,12277
-12282.
Liu, Y., Cox, S. R., Morita, T. and Kourembanas, S.
(1995). Hypoxia regulates vascular endothelial growth factor gene
expression in endothelial cells. Identification of a 5' enhancer.
Circ. Res. 77,638
-643.
Logan, M., Martin, J. F., Nagy, A., Lobe, C., Olson, E. N. and
Tabin, C. J. (2002). Expression of Cre recombinase in the
developing mouse limb bud driven by a Prxl enhancer.
Genesis 33,77
-80.[CrossRef][Medline]
Maltepe, E. and Simon, M. C. (1998). Oxygen,
genes, and development: an analysis of the role of hypoxic gene regulation
during murine vascular development. J. Mol. Med.
76,391
-401.[CrossRef][Medline]
Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A. and
Simon, M. C. (1997). Abnormal angiogenesis and responses to
glucose and oxygen deprivation in mice lacking the protein ARNT.
Nature 386,403
-407.[CrossRef][Medline]
Marcelino, J., Sciortino, C. M., Romero, M. F., Ulatowski, L.
M., Ballock, R. T., Economides, A. N., Eimon, P. M., Harland, R. M. and
Warman, M. L. (2001). Human disease-causing NOG missense
mutations: effects on noggin secretion, dimer formation, and bone
morphogenetic protein binding. Proc. Natl. Acad. Sci.
USA 98,11353
-11358.
McLeod, M. J. (1980). Differential staining of
cartilage and bone in whole mouse fetuses by alcian blue and alizarin red S.
Teratology 22,299
-301.[CrossRef][Medline]
Mitchell, J. A. and Yochim, J. M. (1968).
Measurement of intrauterine oxygen tension in the rat and its regulation by
ovarian steroid hormones. Endocrinology
83,691
-700.
Mitrovic, D. R. (1977). Development of the
metatarsophalangeal joint of the chick embryo: morphological, ultrastructural
and histochemical studies. Am. J. Anat.
150,333
-347.[CrossRef][Medline]
Mori-Akiyama, Y., Akiyama, H., Rowitch, D. H. and de
Crombrugghe, B. (2003). Sox9 is required for determination of
the chondrogenic cell lineage in the cranial neural crest. Proc.
Natl. Acad. Sci. USA 100,9360
-9365.
Murtaugh, L. C., Chyung, J. H. and Lassar, A. B.
(1999). Sonic hedgehog promotes somitic chondrogenesis by
altering the cellular response to BMP signaling. Genes
Dev. 13,225
-237.
Olsen, B. R., Reginato, A. M. and Wang, W.
(2000). Bone development. Annu. Rev. Cell Dev.
Biol. 16,191
-220.[CrossRef][Medline]
Oster, G. F., Shubin, N., Murray, J. D. and Alberch, P.
(1988). Evolution and morphogenetic rules: the shape of the
vertebrate limb in ontogeny and phylogeny. Evolution
42,862
-884.[CrossRef]
Pacifici, M., Koyama, E. and Iwamoto, M.
(2005). Mechanisms of synovial joint and articular cartilage
formation: recent advances, but many lingering mysteries. Birth
Defects Res. C Embryo Today 75,237
-248.[CrossRef][Medline]
Ramirez-Bergeron, D. L., Runge, A., Dahl, K. D., Fehling, H. J.,
Keller, G. and Simon, M. C. (2004). Hypoxia affects mesoderm
and enhances hemangioblast specification during early development.
Development 131,4623
-4634.
Riddle, R. D., Johnson, R. L., Laufer, E. and Tabin, C.
(1993). Sonic hedgehog mediates the polarizing activity of the
ZPA. Cell 75,1401
-1416.[CrossRef][Medline]
Robins, J. C., Akeno, N., Mukherjee, A., Dalal, R. R., Aronow,
B. J., Koopman, P. and Clemens, T. L. (2005). Hypoxia induces
chondrocyte-specific gene expression in mesenchymal cells in association with
transcriptional activation of Sox9. Bone
37,313
-322.[Medline]
Rodesch, F., Simon, P., Donner, C. and Jauniaux, E.
(1992). Oxygen measurements in endometrial and trophoblastic
tissues during early pregnancy. Obstet. Gynecol.
80,283
-285.[Medline]
Ryan, H. E., Poloni, M., McNulty, W., Elson, D., Gassmann, M.,
Arbeit, J. M. and Johnson, R. S. (2000). Hypoxia-inducible
factor-1alpha is a positive factor in solid tumor growth. Cancer
Res. 60,4010
-4015.
Salim, A., Nacamuli, R. P., Morgan, E. F., Giaccia, A. J. and
Longaker, M. T. (2004). Transient changes in oxygen tension
inhibit osteogenic differentiation and Runx2 expression in osteoblasts.
J. Biol. Chem. 279,40007
-40016.
Schipani, E., Ryan, H. E., Didrickson, S., Kobayashi, T.,
Knight, M. and Johnson, R. S. (2001). Hypoxia in cartilage:
HIF-1alpha is essential for chondrocyte growth arrest and survival.
Genes Dev. 15,2865
-2876.
Schofield, C. J. and Ratcliffe, P. J. (2004).
Oxygen sensing by HIF hydroxylases. Nat. Rev. Mol. Cell
Biol. 5,343
-354.[CrossRef][Medline]
Seemann, P., Schwappacher, R., Kjaer, K. W., Krakow, D.,
Lehmann, K., Dawson, K., Stricker, S., Pohl, J., Ploger, F., Staub, E. et
al. (2005). Activating and deactivating mutations in the
receptor interaction site of GDF5 cause symphalangism or brachydactyly type
A2. J. Clin. Invest.
115,2373
-2381.[CrossRef][Medline]
Semenza, G. L. (1998). Hypoxia-inducible factor
1, master regulator of O2 homeostasis. Curr. Opin.
Genet. Dev. 8,588
-594.[CrossRef][Medline]
Semenza, G. L. (2003). Targeting HIF-1 for
cancer therapy. Nat. Rev. Cancer
3, 721-732.[CrossRef][Medline]
Semenza, G. L. (2004). Hydroxylation of HIF-1:
oxygen sensing at the molecular level. Physiology
Bethesda 19,176
-182.[CrossRef][Medline]
Semenza, G. L., Agani, F., Iyer, N., Kotch, L., Laughner, E.,
Leung, S. and Yu, A. (1999). Regulation of cardiovascular
development and physiology by hypoxia-inducible factor 1. Ann. N.
Y. Acad. Sci. 874,262
-268.[CrossRef][Medline]
Smits, P., Li, P., Mandel, J., Zhang, Z., Deng, J. M.,
Behringer, R. R., de Crombrugghe, B. and Lefebvre, V. (2001).
The transcription factors L-Sox5 and Sox6 are essential for cartilage
formation. Dev. Cell 1,277
-290.[CrossRef][Medline]
Storm, E. E. and Kingsley, D. M. (1999). GDF5
coordinates bone and joint formation during digit development. Dev.
Biol. 209,11
-27.[CrossRef][Medline]
Studer, L., Csete, M., Lee, S. H., Kabbani, N., Walikonis, J.,
Wold, B. and McKay, R. (2000). Enhanced proliferation,
survival, and dopaminergic differentiation of CNS precursors in lowered
oxygen. J. Neurosci. 20,7377
-7383.
Tiscornia, G., Singer, O. and Verma, I. M.
(2006). Production and purification of lentiviral vectors.
Nat. Protoc. 1,241
-245.[CrossRef][Medline]
Tylzanowski, P., Mebis, L. and Luyten, F. P.
(2006). The Noggin null mouse phenotype is strain dependent and
haploinsufficiency leads to skeletal defects. Dev.
Dyn. 235,1599
-1607.[CrossRef][Medline]
Wenger, R. H., Stiehl, D. P. and Camenisch, G.
(2005). Integration of oxygen signaling at the consensus HRE.
Sci. STKE 306,re12
.
Yun, Z., Maecker, H. L., Johnson, R. S. and Giaccia, A. J.
(2002). Inhibition of PPAR gamma 2 gene expression by the
HIF-1-regulated gene DEC1/Stra13: a mechanism for regulation of adipogenesis
by hypoxia. Dev. Cell 2,331
-341.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
I. Eshkar-Oren, S. V. Viukov, S. Salameh, S. Krief, C.-d. Oh, H. Akiyama, H.-P. Gerber, N. Ferrara, and E. Zelzer The forming limb skeleton serves as a signaling center for limb vasculature patterning via regulation of Vegf Development, April 15, 2009; 136(8): 1263 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Schipani and T. L. Clemens Hypoxia and the Hypoxia-Inducible Factors in the Skeleton IBMS BoneKEy, August 1, 2008; 5(8): 275 - 284. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Sohaskey, J. Yu, M. A. Diaz, A. H. Plaas, and R. M. Harland JAWS coordinates chondrogenesis and synovial joint positioning Development, July 1, 2008; 135(13): 2215 - 2220. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||