|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 October 2007
doi: 10.1242/dev.005389
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
The ARC Special Research Centre for the Molecular Genetics of Development and Molecular Genetics and Evolution Group, Research School of Biological Sciences, The Australian National University, Canberra, ACT, 2601, Australia.
* Author for correspondence (e-mail: robert.saint{at}anu.edu.au)
Accepted 18 August 2007
| SUMMARY |
|---|
|
|
|---|
-Tubulin (PAGFP-Tub). By photoactivating
presumptive mesodermal cells before gastrulation, we could observe their
migration over non-fluorescent ectodermal cells. We show that the outermost
(outer) cells, which are in contact with the ectoderm, migrate dorsolaterally
as a group but can be overtaken by more internal (inner) cells. Using
laser-photoactivation of individual cells, we then show that inner cells
adjacent to the centre of the furrow migrate dorsolaterally away from the
midline to reach dorsal positions, while cells at the centre of the furrow
disperse randomly across the mesoderm, before intercalating with outer cells.
These movements are dependent on the FGF receptor Heartless. The results
indicate that chemotactic movement and differential affinity are the primary
drivers of mesodermal cell spreading. These characterisations pave the way for
a more detailed analysis of gene function during early mesoderm
development.
Key words: Mesoderm, Cell migration, Drosophila, Photoactivatable GFP
| INTRODUCTION |
|---|
|
|
|---|
In Drosophila, although several genes required for spreading have
been identified, including the FGF receptor heartless (htl)
(Beiman et al., 1996
;
Gisselbrecht et al., 1996
), its
putative ligands thisbe (fgf8-like-1) and pyramus
(fgf8-like-2) (Gryzik and Muller,
2004
; Stathopoulos et al.,
2004
), sugarless and sulfateless
(Lin et al., 1999
),
downstream of FGF receptor (dof; also known as
stumps and heartbroken - FlyBase)
(Michelson et al., 1998
;
Vincent et al., 1998
;
Imam et al., 1999
), and the Rho
guanine nucleotide exchange factor pebble
(Schumacher et al., 2004
;
Smallhorn et al., 2004
), the
manner in which the monolayer is achieved is unknown. Several mechanisms have
been proposed (Wilson and Leptin,
2000
) (Fig. 1). In
the chemotaxis model, expression of a chemoattractant in the dorsal part of
the ectoderm induces mesodermal cells to migrate dorsally. In support of this
model, mesodermal cells express Htl, while the ectodermal cells express Thisbe
and Pyramus (Gryzik and Muller,
2004
; Stathopoulos et al.,
2004
). In the differential affinity model, mesodermal cells have
more affinity for the ectoderm than for each other and seek to maximise their
contact with the ectoderm. In this model, activation of Htl would simply
impart a degree of motility to cells, allowing inner cells to move over and in
between existing outer cells until they were able to find contact with the
ectoderm. In the convergent extension model, inner and outer cells move
towards each other and intercalate, resulting in a net, lateral spreading of
the tissue.
To better understand mesodermal cell behaviour during spreading, and to
test the predictions of these models we wished to visualise mesodermal cells
in living embryos using a fluorescent protein such as GFP. Regulatory
sequences of genes specific to the mesoderm, such as twist, have been
used previously to express cell shape markers to characterise mesoderm cell
morphology (Schumacher et al.,
2004
; Smallhorn et al.,
2004
). However, due to the maturation time for GFP and the high
levels of expression required to clearly image internal tissues, we found this
approach to be impractical for live imaging of early mesodermal events (data
not shown). In this paper we have utilised an alternative approach using
photoactivatable GFP (PAGFP) (Patterson
and Lippincott-Schwartz, 2002
), a variant of wild-type GFP which,
when activated by short wavelength light, exhibits a 100-fold increase in
absorption at 488 nm.
Here we have expressed PAGFP ubiquitously in early embryos, allowing us to photoactivate presumptive mesodermal cells before they internalise, and subsequently view them migrating over non-photoactivated ectodermal cells. Taking advantage of the versatility of PAGFP, we have been able to photoactivate and visualise the movements of an entire section of mesoderm, as well as track the fate of small numbers of cells using region-of-interest laser photoactivation. We show that mesodermal cells initially in contact with the ectoderm migrate dorsolaterally in concert with their neighbours, while more internal cells are able to move over these outer cells to arrive at the ectoderm in more dorsal positions. The results broaden our understanding of mesoderm migration in general and provide a basis on which to further understand the genetic regulation of early mesoderm development in Drosophila.
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
-Tubulin84B was PCR
amplified from fly genomic DNA using primers CGTGCTGTACAAGTACCGTGAATGTAT CTC
and GAATGCGGCCGCTTAGTACTCCTCAGC, digested with BsrGI and
NotI and cloned into pENT-PAGFP to make pENT-PAGFP-
Tub84B. The
insert was then transferred into a UASp destination vector (cloning details
available on request), and transformed into flies by standard methods.
Fly stocks
Fly stocks used in this study were twist::CD2 (Bloomington),
pCOG-Gal4VP16; NGT40; nanos-Gal4VP16
(Grieder et al., 2000
),
htlAB42/TM3,ftz-lacZ (Bloomington),
UASp-PAGFP-
Tub84B (this study) and
htlAB42,UASp-PAGFP-
Tub84B/TM3,ftz-lacZ. To
obtain early embryos expressing high levels of PAGFP-Tub, we crossed females
of genotype
COG-Gal4VP16/+;NGT40/+;nanos-Gal4VP16/UASp-PAGFP-
Tub84B
to UASp-PAGFP-
Tub84B homozygous males. For analysis
of htl mutants, we crossed females of genotype
COG-Gal4VP16/+;NGT40/+;nanos-Gal4VP16/htlAB42,UASp-PAGFP-
Tub84B
to htlAB42,UASp-PAGFP-
Tub84B/TM3,ftz-lacZ
males, and identified htl mutants by their failure to form a
monolayer. Tests using the htlAB42/TM3,ftz-lacZ stock
demonstrated a clear qualitative difference between
htlAB42/htlAB42 embryos and control
embryos (i.e. htlAB42/+ and +/+) in their ability to
achieve a clear monolayer by 90 minutes post-gastrulation (data not
shown).
Photoactivation protocols
For whole-mesoderm observations, embryos were dechorionated and
approximately eight to ten pre-gastrulation embryos were transferred to a
coverslip coated with rubber cement (Chiaro), and immediately covered with
liquid paraffin. Embryos were then visualised under a 40x objective and
exposed for 1 second with the 405/20 nm light. They were then monitored with 1
second exposures using a FITC filter set, until the onset of furrowing was
detected, at which point a 100x objective was used to expose a small
patch of presumptive mesoderm (approximately 10-12 cells in diameter) to
405/20 nm critical illumination light for 60 seconds. During this period the
focal plane was gradually changed to ensure all parts of the cells received
strong focussed light.
To ensure that photoactivated cells remained on the ventral side while germ band extension was proceeding, we restricted photoactivation to cells in the anterior half of the embryo, but posterior to the cephalic furrow.
To label small groups of cells we utilised region-of-interest activation on a confocal microscope. Embryos were monitored using periodic scanning with a 488 nm laser at 1-minute intervals until the onset of gastrulation was detected. We then zoomed in by a factor of approximately 16, drew a polygon around one or two cells of interest and scanned with UV 351 and 364 nm laser lines at 200 Hz two to four times. Typically this resulted in strong photoactivation of the outlined cell(s) and weaker activation of adjacent cells.
Imaging protocols
Time-lapse sequences were collected on an inverted Leica confocal system,
with room temperature maintained at approximately 25°C. The images are a
compromise between the conflicting requirements of good image quality, high
temporal resolution and low photobleaching. As image quality increases (e.g.
via high spatial resolution 1024x1024, high z resolution, and high laser
intensity) so too does the degree of photobleaching of the specimen. In
addition, higher image resolution and Kalman averaging scans, require a longer
time to capture the z-series and therefore lowers temporal resolution. The
best compromise was a 3 µm z-series of 512x512 images with three
Kalman averages, and an interframe interval of 2 minutes. The range of
z-sections was also limited to encompass only the mesoderm to minimize
photobleaching and allow for more rapid sampling. The number of z-slices was
between 5 and 15 at the start of time-lapse sequences but could increase to 21
by the end of the sequences as the mesoderm reached increasingly dorsal
positions and the mesoderm encompassed a greater three-dimensional range.
Data analysis
The whole mesoderm analyses presented here are based on 13 time-lapse
sequences that clearly showed the developmental events under analysis. We
excluded sequences in which: (1) the image quality was too poor; (2) the
embryo rolled; (3) the embryo desiccated; (4) there was a clear mitotic delay.
In this last category (n=4) the first mitotic wave, which normally
occurs within 5-15 minutes of the EMT, was delayed, occurring 30-40 minutes
after the EMT when the mesoderm was already migrating. In control embryos
staged to be midway through the migration period, 30-45 minutes after
gastrulation (n=12), we never observed more than a few cells
undergoing mitosis. We therefore excluded these sequences from analysis in
spite of the fact that the mesodermal cells appeared otherwise healthy and
spread into a monolayer.
To determine the normal sequence and timing of mesodermal events we dechorionated twist::CD2 embryos and monitored them in a 25°C room on a dissecting microscope until gastrulation was detected, and then aged them for a given period of time. Embryos were then fixed (4% formaldehyde in PBS) for 20-30 minutes and stained for CD2 and DNA, using Mouse-anti-RAT-CD2 (Serotec) at 1:100, goat anti-mouse Alexa 488 (1:200; Molecular Probes) and Hoechst 33258 (1:200; Molecular Probes).
|
40 minutes was similar to control embryos. This
initial delay is most likely due to the relatively cool temperature
(
21-22°C) in the room in which whole mesoderm photoactivation took
place. Once embryos had been transferred to the 25°C confocal room for
time-lapse acquisition, developmental rates became comparable to control
rates.
Immunostaining of photoactivated embryos
Following photoactivation, embryos were removed from the liquid paraffin
with a paintbrush, placed on an apple-juice agar plate and then gently moved
around on the agar to reduce the amount of oil and glue remaining on the
embryo. In the case of the IM/IL cell migration experiments
(Fig. 8), embryos were aged to
90 minutes post-gastrulation at 25°C, or in the case of the embryos in
Figs 6 and
7 processed immediately.
Embryos were then fixed and cracked, rinsed once in methanol, three times in
PBS+0.1% Triton X-100, immunostained over a period of two hours with
Rb-anti-Twist (1:200) (a gift from M. Leptin, Institute of Genetics,
University of Cologne, Germany) or BP106 (anti-Neurotactin, Developmental
Studies Hybridoma Bank) and goat anti-rat Cy5 (Jackson ImmunoResearch),
cleared and immediately imaged using confocal microscopy. The position of
IM/IL cell clones within the mesoderm was quantified by measuring the distance
from the midline to each cell along a path that followed the contours of the
monolayer. Distances were normalised as a fraction of the total extent of the
mesoderm in that section of the embryo containing the clone.
| RESULTS |
|---|
|
|
|---|
-Tubulin as an in vivo marker for cell shape and division
-Tubulin84B (PAGFP-Tub), so that we could
visualise the two rounds of division that occur during spreading, and
expressed it in early embryos (see Materials and methods). These embryos
developed normally and produced viable and fertile adults. PAGFP-Tub was
faintly fluorescent with FITC/488 nm filter sets before photoactivation and
was easily photoactivated to strong fluorescence using either Hg lamp light
passed through a 405/20 nm excitation filter
(Fig. 2A), or UV laser
illumination on a confocal microscope (Fig.
2B,C). In interphase cells, photoactivated PAGFP-Tub localised to the cytoplasm and was excluded from the nucleus, allowing overall cell morphology to be visualised (Fig. 2D). As cells progressed through mitosis, PAGFP-Tub first localised strongly at the spindle poles, then moved into the region of the nucleus, presumably as nuclear envelope breakdown occurred. It then localised to the mitotic spindle, central spindle and was eventually excluded from the nucleus as the daughter cells again entered interphase (Fig. 2D). Thus PAGFP-Tub localises as expected for a functional Tubulin molecule and provides a marker for cell shape and the progression of division.
Photoactivation of PAGFP-Tub during gastrulation permits visualisation of the development of the mesoderm
To robustly label the entire mesoderm over several segments, we exposed a
patch of the presumptive mesoderm to 405/20 nm Hg light for 60 seconds during
gastrulation (Fig. 2E), and
then transferred the embryo to a confocal microscope, where the fluorescently
labelled mesoderm was clearly distinguishable from the unlabelled ectoderm
(Fig. 2F,G). To capture the
three-dimensional movements of the mesoderm, a z-series of 3 µm slices was
collected at 2-minute intervals (see Materials and methods for details). These
parameters provided sufficient spatial and temporal resolution to track
individual cells for 2-3 hours, without significant photobleaching.
In the only published Drosophila PAGFP study
(Post et al., 2005
), it was
reported that illumination with a 408 nm diode laser could prevent cells from
dividing, independent of the presence of PAGFP proteins. In another study, in
which PAGFP was used to track migrating cells in chick embryos,
photoactivation with a 405 nm laser did not appear to affect cell viability or
behaviour (Stark and Kulesa,
2005
). In the movies analysed here, neither photoactivation with
Hg 405/20 nm or UV laser light, nor the subsequent 488 nm laser scanning,
appeared to adversely affect development, based on the following observations:
(1) gastrulating embryos photoactivated with 60 seconds Hg 405/20 nm light and
then transferred to apple-juice agar plates (to prevent desiccation) hatched
in all cases (n=19), indicating that the photoactivation protocol
itself did not compromise embryo viability; (2) cells showed no evidence of
undergoing cell death/fragmentation, underwent the expected rounds of cell
division (Fig. 3B,D), adopted
the expected morphologies during migration, correctly spread into a monolayer
(Fig. 3G) and developed the
expected patterns of segmentation (Fig.
3E); (3) embryos from time-lapse sequences (e.g. Figs
3,
4), that were allowed to
continue development on apple-juice agar plates routinely hatched
(n=6).
|
At this stage there were three to four rows of outer cells on either side of the midline and a pool of inner cells. The outer cells clearly moved laterally over the ectoderm. For example, in Fig. 4B two cells were tracked over a period of 12 minutes, during which time they moved apart by 26 µm, a migration rate of approximately 1 µm/minute. As the cells migrated, other cells from more medial positions came to occupy the ectodermal positions that were thereby vacated (Fig. 4C,D, arrowheads). During this phase, the outer migrating cells moved in concert with their immediate neighbours. For example, in Fig. 4E, as the marked cell (white dot) migrates, the adjacent cells (arrowheads) move with it.
Inner cells can move over outer cells
Another behaviour that was commonly observed during this migration phase
was that outer cells that were initially the most laterally placed were
overtaken by inner cells. In Fig.
5, for example, cells marked by arrowheads migrated past the
marked outer cell (white dot) that was initially the most laterally
placed.
Second mitosis and remodelling phase
The period of overtaking behaviour was shortly followed by a second round
of division, which occurred at 70±12 minutes (s.d., n=11)
post-gastrulation (Fig. 3D).
This period of division was associated with a rapid lateral spreading of the
mesoderm. The return to interphase was accompanied by some
retraction/compaction of the mesoderm, suggesting that cells were re-adhering
following mitosis. At this stage the mesoderm exhibited a segmentally repeated
three-dimensional undulation, as seen in control embryos
(Fig. 3E,F).
Tracking inner cell migration using laser photoactivation
Our whole mesoderm observations indicated that some inner cells moved past
outer cells to occupy more dorsolateral positions. Due to the inability of
confocal microscopy to image more than a few cell diameters into the embryo,
we were only able to detect these cells when they moved onto the ectoderm. To
determine from where, in the invaginated epithelial tube, these cells
originated, we used region-of-interest confocal UV laser scanning to
photoactivate small subsets of mesodermal cells as the ventral furrow was
forming and followed their subsequent migration.
Pre-gastrulation embryos were monitored using 488 nm laser light to illuminate the faint, pre-activation levels of fluorescence (e.g. Fig. 6D). At the onset of furrowing, small groups of cells were photoactivated (see Materials and methods for details) either at the centre of the furrow [hereafter referred to as inner medial (IM) cells] (Fig. 6A), or immediately adjacent to the medial cells [hereafter: inner lateral (IL) cells] (Fig. 7A). The progress of IM and IL cells was then tracked by capturing z-series at 5-minute intervals. The cells were able to undergo their expected programmed divisions and remained motile, suggesting that UV irradiation did not compromise cell viability.
|
10 minutes)
(Fig. 6H-J). The number of
cells was consistent with the original labelled cells having undergone two
divisions. In Fig. 6, for
example, the two cells that were strongly labelled result in about eight cells
appearing later. The IM cell progeny were typically dispersed, distributed on
either side of the midline, and could be scattered over the full extent of the
mesoderm (Fig. 6J). Based on the clarity of the cells and their z-depth into the embryo, these cells were judged to have reached the outer layer of the mesoderm, suggesting that the IM cell progeny had intercalated between existing outer cells. The timing of this event, around the time of the second mitosis, suggested that the ability of IM cells to find contact with the ectoderm increased during mitosis. Consistent with this idea, in fixed control embryos just before the second division (45 minutes post-gastrulation), isolated inner cells were often seen sitting on an outer monolayer (Fig. 6K).
Inner lateral cell progeny move laterally as a group and reach a dorsolateral position
In contrast to IM cells, it was possible to track IL cell clusters,
although initially appearing quite blurred because of their depth within the
embryo. Following gastrulation, the cell clusters first translocated
posteriorly through germ-band extension, and then, in all cases (n=9)
moved laterally away from the midline as a group. At approximately 45 minutes
post-gastrulation the progeny of the photoactivated IL cells became more
distinct, consistent with them having contacted the ectoderm, and were
positioned at the most dorsal region of the mesoderm
(Fig. 7H). The cells were
motile, and in some sequences were observed to divide at approximately 60
minutes.
In two cases, in addition to photoactivating IL cells we photoactivated cells adjacent and lateral to IL cells. Based on the typical number of cells in the invaginated epithelial tubes, we would expect these cells to be situated on the lateral side of the epithelial tube before the EMT, and hence likely to find themselves in contact with the ectoderm following the EMT and first division. We refer to these cells as outer lateral (OL) cells. In both cases the IL cell progeny ended up in a more dorsolateral position than the OL cell progeny (see Fig. S1 in the supplementary material). This again supports the idea that inner lateral cells migrate past outer cells.
|
|
|
IM and IL cell cluster migration depends on the FGF Receptor Heartless
To see if these movements were dependent on FGF signalling, we
photoactivated IM and IL cells in htlAB42 mutant embryos.
IM cell progeny tended to remain in single clusters, as opposed to two pairs
of cells, and in most cases (n=7/8) remained in the more medial half
of the mesoderm. Similarly, in most cases (67%, n=12) IL cell progeny
failed to migrate into the dorsalmost region of the mesoderm, but instead
remained close to their initial position.
| DISCUSSION |
|---|
|
|
|---|
A complication in the simple chemoattraction model is that the two likely
chemoattractants, Pyr and Ths, are initially expressed in quite broad lateral
domains (Gryzik and Muller,
2004
; Stathopoulos et al.,
2004
). During mesoderm migration, however, pyr expression
does become restricted to the more dorsal parts of the ectoderm, whereas
ths is expressed in a complementary fashion in the ventral regions of
the neurogenic ectoderm (Stathopoulos and
Levine, 2004
). It has been suggested that the two ligands may have
different binding affinities, and that the refinement of Pyr expression to
more dorsal positions could guide mesodermal cells dorsally
(Stathopoulos and Levine,
2004
). An alternative is that those regions of the ectoderm that
are not yet covered with mesodermal cells, such as the dorsal ectoderm, are
highly attractive to mesodermal cells simply because the FGF ligands that they
are producing are not being bound and internalised by outer cells already in
contact with the ectoderm.
An alternative to chemoattraction that has been suggested is that FGFR
activation is permissive rather than instructive and simply imparts a degree
of motility to cells, allowing them to disperse until they are able to contact
the ectoderm (Wilson and Leptin,
2000
). This motility, combined with a steric hindrance effect, in
which cells tended to move into unoccupied territory, could theoretically
achieve a monolayer in the absence of directional cues. We would expect,
however, that if IL cell progeny were simply made motile and moved randomly,
that cells adjacent to the midline would sometimes cross the midline to
contact the ectoderm on the opposing side. This was never observed.
The movement of inner cells past the lateralmost outer cells is also
consistent with the differential affinity model
(Fig. 1C), according to which
mesodermal cells form strong adhesions with the ectoderm. Cells not already in
contact with the ectoderm would either intercalate between existing outer
cells, or, as seen here, move past them. The fact that we do not observe
intercalation suggests either that outer cells adhere strongly to the ectoderm
and do not easily move apart, or, again, that outer cells are masking FGF
produced in the ectoderm. If a differential affinity model is active, the most
likely candidate adhesion molecules would be integrins, which are expressed at
the interface of the mesoderm and ectoderm
(Roote and Zusman, 1995
) (data
not shown), although there is, as yet, no published evidence for a functional
role for integrins in this process.
During the initial migration of outer cells over the ectoderm we found that
cells maintained their position relative to their immediate neighbours. This
result supports the argument against the convergent extension model
(Fig. 1C). If convergent
extension was a primary driving force behind lateral spreading, one would
expect to see widespread intercalation throughout the mesoderm as inner cells
pushed in between existing outer cells. This was not observed, although we
cannot rule out the possibility that some degree of intercalation does occur
during this migration phase. Intercalation does, however, appear to play a
part during the later stages of the formation of the monolayer, where we see
IM cell progeny appearing at the ectoderm. The timing of this event, at around
the time of the second mitosis, suggests that the sudden lateral spreading
that accompanies the second mitotic wave may be due to the intercalation of a
pool of inner cells. One possibility is that the adhesion between the
mesodermal cells and the surrounding cells, both mesodermal and ectodermal, is
decreased as they go through mitosis
(Maddox and Burridge, 2003
),
permitting the inner cells access to their preferred position in association
with the ectoderm. Thus, although a general convergent extension is not in
evidence, intercalation does appear to contribute to mesoderm spreading.
|
The combination of behaviours we observe may represent the most efficient way to rapidly spread one tissue over another. The tendency for cells to migrate dorsolaterally helps to constantly make space for those cells placed nearer the midline. If cells that contacted the ectoderm never moved away, it would mean that internal cells would have to travel further and further dorsally to find space on the ectoderm. In a similar manner, if chemotaxis towards a dorsally placed attractant was the only mechanism operating, one might expect that cells would continue moving dorsally, even if this resulted in an excess of cells in dorsal positions and a deficit closer to the midline. The tendency of mesodermal cells to develop and maintain a strong adhesive contact with the ectoderm would help ensure that all parts of the ectoderm remain covered. Finally, having a period of intercalation serves to give any remaining inner cells a chance to finally contact the ectoderm.
|
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/22/3975/DC1
| ACKNOWLEDGMENTS |
|---|
Tub84B
constructs and exploratory tests, Hazel Dalton for construction of the pUASp
destination vector, Nelida Contreras for cloning assistance, Joanne Milverton
for transgenic injections and Maria Leptin for the kind gift of anti-Twist
antibody. The PAGFP vectors were kindly provided by George Patterson. This
work was funded by an NHMRC project grant to M.J.M and R.S., The ARC Special
Research Centre for the Molecular Genetics of Development, and The Institute
of Advanced Studies at The Australian National University. | REFERENCES |
|---|
|
|
|---|
Beiman, M., Shilo, B. Z. and Volk, T. (1996).
Heartless, a Drosophila FGF receptor homolog, is essential for cell migration
and establishment of several mesodermal lineages. Genes
Dev. 10,2993
-3002.
Gisselbrecht, S., Skeath, J. B., Doe, C. Q. and Michelson, A.
M. (1996). heartless encodes a fibroblast growth factor
receptor (DFR1/DFGF-R2) involved in the directional migration of early
mesodermal cells in the Drosophila embryo. Genes Dev.
10,3003
-3017.
Grieder, N. C., de Cuevas, M. and Spradling, A. C.
(2000). The fusome organizes the microtubule network during
oocyte differentiation in Drosophila. Development
127,4253
-4264.[Abstract]
Gryzik, T. and Muller, H. A. (2004). FGF8-like1
and FGF8-like2 encode putative ligands of the FGF receptor Htl and are
required for mesoderm migration in the Drosophila gastrula. Curr.
Biol. 14,659
-667.[CrossRef][Medline]
Imam, F., Sutherland, D., Huang, W. and Krasnow, M. A.
(1999). stumps, a Drosophila gene required for
Fibroblast Growth Factor (FGF)-directed migrations of tracheal and mesodermal
cells. Genetics 152,307
-318.
Leptin, M. (2005). Gastrulation movements: the
logic and the nuts and bolts. Dev. Cell
8, 305-320.[CrossRef][Medline]
Lin, X., Buff, E. M., Perrimon, N. and Michelson, A. M.
(1999). Heparan sulfate proteoglycans are essential for FGF
receptor signaling during Drosophila embryonic development.
Development 126,3715
-3723.[Abstract]
Maddox, A. S. and Burridge, K. (2003). RhoA is
required for cortical retraction and rigidity during mitotic cell rounding.
J. Cell Biol. 160,255
-265.
Michelson, A. M., Gisselbrecht, S., Buff, E. and Skeath, J.
B. (1998). Heartbroken is a specific downstream mediator of
FGF receptor signalling in Drosophila. Development
125,4379
-4389.[Abstract]
Patterson, G. H. and Lippincott-Schwartz, J.
(2002). A photoactivatable GFP for selective photolabeling of
proteins and cells. Science
297,1873
-1877.
Post, J. N., Lidke, K. A., Rieger, B. and Arndt-Jovin, D. J.
(2005). One- and two-photon photoactivation of a paGFP-fusion
protein in live Drosophila embryos. FEBS Lett.
579,325
-330.[CrossRef][Medline]
Roote, C. E. and Zusman, S. (1995). Functions
for PS integrins in tissue adhesion, migration, and shape changes during early
embryonic development in Drosophila. Dev. Biol.
169,322
-336.[CrossRef][Medline]
Schumacher, S., Gryzik, T., Tannebaum, S. and Muller, H. A.
(2004). The RhoGEF Pebble is required for cell shape changes
during cell migration triggered by the Drosophila FGF receptor Heartless.
Development 131,2631
-2640.
Smallhorn, M., Murray, M. J. and Saint, R.
(2004). The epithelial-mesenchymal transition of the Drosophila
mesoderm requires the Rho GTP exchange factor Pebble.
Development 131,2641
-2651.
Stark, D. A. and Kulesa, P. M. (2005).
Photoactivatable green fluorescent protein as a single-cell marker in living
embryos. Dev. Dyn. 233,983
-992.[CrossRef][Medline]
Stathopoulos, A. and Levine, M. (2004).
Whole-genome analysis of Drosophila gastrulation. Curr. Opin.
Genet. Dev. 14,477
-484.[CrossRef][Medline]
Stathopoulos, A., Tam, B., Ronshaugen, M., Frasch, M. and
Levine, M. (2004). pyramus and thisbe: FGF genes that pattern
the mesoderm of Drosophila embryos. Genes Dev.
18,687
-699.
Tam, P. P. and Behringer, R. R. (1997). Mouse
gastrulation: the formation of a mammalian body plan. Mech.
Dev. 68,3
-25.[CrossRef][Medline]
Vincent, S., Wilson, R., Coelho, C., Affolter, M. and Leptin,
M. (1998). The Drosophila protein Dof is specifically
required for FGF signaling. Mol. Cell
2, 515-525.[CrossRef][Medline]
Wilson, R. and Leptin, M. (2000). Fibroblast
growth factor receptor-dependent morphogenesis of the Drosophila mesoderm.
Philos. Trans. R. Soc. Lond. B Biol. Sci.
355,891
-895.
Zacharias, D. A., Violin, J. D., Newton, A. C. and Tsien, R.
Y. (2002). Partitioning of lipid-modified monomeric GFPs into
membrane microdomains of live cells. Science
296,913
-916.
Related articles in Development:
This article has been cited by other articles:
![]() |
A. Klingseisen, I. B. N. Clark, T. Gryzik, and H.-A. J. Muller Differential and overlapping functions of two closely related Drosophila FGF8-like growth factors in mesoderm development Development, July 15, 2009; 136(14): 2393 - 2402. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. McMahon, W. Supatto, S. E. Fraser, and A. Stathopoulos Dynamic Analyses of Drosophila Gastrulation Provide Insights into Collective Cell Migration Science, December 5, 2008; 322(5907): 1546 - 1550. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Southall, D. A. Elliott, and A. H. Brand The GAL4 System: A Versatile Toolkit for Gene Expression in Drosophila CSH Protocols, July 1, 2008; 2008(8): pdb.top49 - pdb.top49. [Abstract] [Full Text] |
||||
![]() |
D. A. Stark, J. C. Kasemeier-Kulesa, and P. M. Kulesa Photoactivation Cell Labeling for Cell Tracing in Avian Development CSH Protocols, March 1, 2008; 2008(4): pdb.prot4975 - pdb.prot4975. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||