|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online 17 October 2007
doi: 10.1242/dev.007823
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 GIGA-Research-Unité de Biologie Moléculaire et Génie
Génétique, Tour B34, Université de Liège, B-4000
Sart Tilman, Belgium.
2 Laboratoire de Biologie Cellulaire Végétale, Cellule d'Appui
Technologique en Microscopie, Université de Liège, Institut de
Botanique, Bâtiment B22, B-4000 Sart-Tilman, Belgium.
3 European Molecular Biology Laboratory (EMBL), Meyerhofstrasse 1, D-69117
Heidelberg, Germany.
* Author for correspondence (e-mail: isabelle.manfroid{at}ulg.ac.be)
Accepted 22 August 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Zebrafish, Pancreas, FGF, Signaling, Endoderm, Mesoderm, ptf1a
| INTRODUCTION |
|---|
|
|
|---|
After induction of the ventral and dorsal pancreatic territories, a portion
of the LPM will generate the pancreatic mesenchyme that interacts with the
pancreatic endoderm and induces the budding, the growth and the branching of
the pancreatic epithelium (Golosow and
Grobstein, 1962
; Spooner et
al., 1970
; Pictet et al.,
1972
; Ahlgren et al.,
1996
; Bhushan et al.,
2001
; Ye et al.,
2005
). The mesenchymal cells surrounding the dorsal pancreatic
epithelium are characterized by the expression of the LIM homeodomain gene
Isl1 and of Fgf10, which encodes a member of the fibroblast
growth factor (FGF) family, and both genes are required for accurate pancreas
organogenesis. In Isl1-/- embryos, which display agenesis
of the dorsal pancreas, the mesenchyme fails to condense around the dorsal
pancreatic epithelium (Ahlgren et al.,
1997
). In Fgf10-/- embryos, the specification
of the pancreatic epithelium occurs normally, but it subsequently fails to
undergo normal growth and branching owing to reduced proliferation of the
epithelial progenitors (Bhushan et al.,
2001
). In addition, Fgf10 was shown to be essential in
maintaining Ptf1a expression in the dorsal pancreatic bud
(Jacquemin et al., 2006
). To
date, the determinants that specifically pattern the LPM into the pancreatic
mesenchyme are unknown.
In zebrafish, the pancreas also derives from two endodermal anlagen
(Field et al., 2003
).
Formation of the first pancreatic anlagen, present by 24 hours post
fertilization (hpf) on the dorsal side of the developing gut, requires
interactions with the notochord (Biemar et
al., 2001
). In contrast to the amniotes, this dorsal bud expresses
pdx1 but not ptf1a and generates only endocrine cells. The
second pancreatic bud appears by 32 hpf from the ventral aspect of the
developing gut in a position slightly anterior to the dorsal bud and on the
left part of the zebrafish embryo (Field
et al., 2003
). The ventral pancreatic bud expresses pdx1,
ptf1a and mnr2a and will generate the whole pancreatic exocrine
tissue and a small number of endocrine cells
(Lin et al., 2004
;
Wendik et al., 2004
;
Zecchin et al., 2004
). The
ventral bud will grow and by 54 hpf eventually envelops the single islet
derived from the dorsal pancreatic bud.
The role of the LPM for the specification or the growth of the pancreatic
buds has not been investigated yet in zebrafish. The LPM has been implicated
in the leftward bend of the developing intestine, known as `gut looping'
(Horne-Badovinac et al.,
2003
). In this process, taking place between 26 and 30 hpf, the
left and right LPM migrate asymmetrically toward the midline pushing the gut
on the left side of the embryo. The LPM has also been shown to play a crucial
function in the specification of the liver, which is formed just anteriorly to
the ventral pancreatic bud. This induction is mediated by expression of
wnt2bb in the LPM adjacent to the pre-hepatic endoderm
(Ober et al., 2006
).
The present study was designed (1) to determine whether a tissue equivalent to the pancreatic mesenchyme described in the amniotes is also present in zebrafish embryos; (2) to investigate how this tissue is established; and (3) to explore its function in pancreatic development. We found that, in zebrafish embryos, the LPM adjacent to the ventral pancreatic bud, that we named pancreatic LPM, expresses isl1, meis3 and fgf10 and plays a role in ventral pancreas induction and growth. In addition, we uncover a novel, earlier and pivotal function of the FGF signaling in the specification of the pancreatic LPM. Indeed, transient endodermal fgf24 expression is critical for the patterning of the pancreatic LPM, which is required for the subsequent induction of the ventral pancreatic bud. Our study also reveals that fgf10 and fgf24 display a redundant activity in patterning the pancreatic LPM.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Morpholino design and injection
Morpholino oligonucleotides (MO) were synthesized by Gene Tools (Corvalis,
OR). Each MO was resuspended in Danieau's solution at the stock concentration
of 8 µg/µl. For injections, they were diluted in Danieau's solution at
the given concentration. Rhodamine dextran was added at 0.5% to the samples to
check injection efficiency. For isl1 and meis3 MO, optimal
doses, 1.5 ng per injection, defined as the highest dose that did not
significantly increase mortality or cause overt non-specific necrosis, were
determined empirically. For fgf24 and fgf10 MO injections,
the lower dose resulting in the absence of pectoral fin buds was determined to
2 ng/injection for each MO and was the condition used in our experiments
(Fischer et al., 2003
;
Norton et al., 2005
). Double
knockdown experiments were achieved by injecting 1 ng of MO fgf10 and
MO fgf24 each. MO sequences are: splice inhibition MO isl1,
ATGCAATGCCTACCTGCCATTTGTA (E3I3); translation inhibition MO meis3,
AGCTCACACACTCACTGACGGAGGA; fgf10 and fgf24 MO were described
previously: splice fgf10, MO GAAAATGATGCTCACCGCCCCGTAG (E2I2 MO)
(Norton et al., 2005
);
fgf24 MO, AGGAGACTCCCGTACCGTACTTGCC (E3I3 MO)
(Draper et al., 2003
).
Presented MO data were collected from at least three reproducible and
independent experiments.
Whole-mount in situ hybridization
Single- and double-labeled in situ hybridization (ISH) were performed as
described (Hauptmann and Gerster,
1994
). Digoxigenin or DNP incorporated in the riboprobes were
localized immunohistochemically with an antibody conjugated to alkaline
phosphatase [anti-DIG-AP (Roche) or anti-DNP-AP (Vector Laboratories)] and
with NBT/BCIP or Fast Red (Invitrogen) as substrate.
Fluorescent labeling was performed as described
(Mavropoulos et al., 2005
).
The DIG- and DNP-labeled probes were either revealed by Tyramide-Cy3 or
Tyramide-FITC using the Perkin Elmer TSA kit and peroxidase linked to the
first revealed probe was inactivated by a 90-minute incubation with 2%
H2O2.
The riboprobes used were isl1
(Korzh et al., 1993
),
meis3 [accession number AF222995
(Sagerstrom et al., 2001
)],
fgf10 (EST fd11d03.x1, clone MPMGp609F0649Q, RZPD), fgf24
(Fischer et al., 2003
),
neurod (Korzh et al.,
1998
), pdx1 (Milewski
et al., 1998
), foxa1
(Odenthal and Nusslein-Volhard,
1998
), ceruloplasmin
(Korzh et al., 2001
),
trypsin (Biemar et al.,
2001
) and ptf1a
(Zecchin et al., 2004
).
For vibratome sections, embryos were embedded in 4% SeaPlaque agarose (Tebu) for fluorescent-labeled in situ hybridization on thick (150 µm) sections. The nuclei were stained on the sections by TO-PRO-3 iodide (642/661 nm, Invitrogen). Sections were mounted in ProLong Gold Antifade Reagent (Invitrogen).
Fluorescent imaging
Confocal imaging was performed using a Leica TCS SP2 inverted confocal
laser microscope (Leica Microsystems, Germany). Digitized images were acquired
using a 63x (NA 1.2) Plan-Apo water-immersion objective at
1024x1024 pixel resolution. For multicolor imaging, FITC was visualized
by using an excitation wavelength of 488 nm and the emission light was
dispersed and recorded at 500-535 nm. Cy3 was detected by using an excitation
wavelength of 543 nm and the fluorescence emission was dispersed and recorded
at 555-620 nm. TO-PRO-3 iodide was detected by using an excitation wavelength
of 633 nm and the fluorescence emission was dispersed and recorded at 650-750
nm. The acquisition was set up to avoid any cross-talk of the three
fluorescence emissions. Series of optical sections were carried out to analyze
the spatial distribution of fluorescence, and for each embryo, they were
recorded with a Z-step ranging between 1 and 2 µm. Image
processing, including background subtraction, was performed with Leica
software (version 2.5). Captured images were exported as TIFF and further
processed using Adobe Photoshop and Illustrator CS2 for figure mounting.
| RESULTS |
|---|
|
|
|---|
To refine the identification of these expression domains, transverse
sections through the pancreatic region were performed slightly anterior to the
dorsal pancreatic bud. By 30-32 hpf, meis3 was expressed in a broad
region contiguous to the gut that included the domain labeled by isl1
(Fig. 2A,B). At this
antero-posterior level, the gut undergoes a looping to the left caused by the
right LPM that pushes the gut toward the left side of the embryo, whereas the
left LPM migrates dorsally to the endoderm
(Horne-Badovinac et al.,
2003
). isl1 and meis3 were expressed in the left
and right LPM, with meis3 expression greater than isl1, the
former being limited to the region of the LPM abutting the right and dorsal
sides of the gut. We never detected meis3 expression in the endoderm
(see Fig. S1 in the supplementary material). At 32 hpf, the first cells of the
ventral pancreatic bud, detected by low expression of ptf1a and
mnr2a genes (Wendik et al.,
2004
), originated ventrolaterally from the gut
(Fig. 2C). At 35 hpf, the
expression of these two markers increased within these pancreatic cells which
then migrated ventrally to the gut toward the endocrine islet situated more
posteriorly (Fig. 2D,E,F). At
32 hpf, a few meis3 or isl1-expressing cells of the left LPM
contacted the dorsal-most mnr2a-labeled cells
(Fig. 2B,C). At 35 hpf,
cell-cell contacts were also observed ventrally between migrating cells of the
ventral bud and cells expressing meis3 and isl1 in the right
LPM (Fig. 2E,F). Similarly,
fgf10 was found in the LPM (Fig.
2D). Like meis3, fgf10 in the LPM was more broadly
expressed than isl1. These findings are consistent with our working
hypothesis that the LPM adjacent to the ventral bud, expressing isl1,
fgf10 and meis3, could be the functional equivalent of the
mesenchyme surrounding the murine dorsal pancreatic bud. This tissue, which we
named the pancreatic LPM, could release regulatory signals controlling the
specification and/or growth of the zebrafish ventral pancreatic bud and hence,
the formation of the exocrine pancreas.
|
FGF signaling, but not Fgf10, is essential for induction of the ventral pancreatic bud and for differentiation of pancreatic LPM
We described above the expression of fgf10 in the pancreatic LPM.
Since Fgf10 secreted by the pancreatic mesenchyme is crucial for the growth of
the associated pancreatic bud in mouse embryos, we next determined whether, in
zebrafish embryos, the effect of the pancreatic LPM on the growth of the
ventral pancreatic bud is driven by Fgf10. To this purpose, we analyzed the
pancreatic exocrine tissue in fgf10 morphants and in
fgf10-/- daedalus (dae) mutant embryos
(Norton et al., 2005
). In
contrast to results with meis3 and isl1, knockdown or
mutation of fgf10 did not disturb the development of the pancreatic
exocrine tissue (Fig. 3A and
data not shown).
|
|
|
The role of fgf24 in pancreas development was next determined by
knockdown using an fgf24 antisense MO and by analyzing the
fgf24-/- ikarus (ika) mutant embryos
(Fischer et al., 2003
). In
both cases, fgf24 loss of function was assessed by the absence of
pectoral fin buds (Fig. 5A),
whereas the overall morphology of the fgf24 morphants at 3 days post
fertilization (dpf), like the ika mutants, was not altered. Similar
results were obtained with fgf24 ika mutants and with the
fgf24 morphants. Inactivation of fgf24 function resulted in
a significant reduction of the pancreatic exocrine compartment at 3 dpf in
most fgf24 morphant or mutant embryos
(Fig. 5B), whereas expression
of ceruloplasmin (cp) in the liver was normal. Moreover,
ptf1a expression was not detected at 36 hpf in about one third of
fgf24 morphant or ika mutant embryos
(Fig. 5C) and was reduced in
the remaining mutant/morphant embryos. Since differentiation of
trypsin-expressing cells, albeit diminished, still occurs in all
fgf24 mutant embryos at 3 dpf, one hypothesis was that the onset of
the ventral bud specification might be delayed in ika embryos. We
thus examined the expression of ptf1a at later stages of development.
ptf1a was indeed expressed at 50 hpf in all the fgf24 mutant
and morphant embryos, although the level of expression was significantly
reduced (Fig. 5E). In support
of the delay of the ventral bud specification, ptf1a expression was
not activated at 33 hpf in 92% of fgf24 mutant embryos compared with
the normal ptf1a expression in 91% of the heterozygotes or wild-type
siblings (not shown). Taken together, these results demonstrate that the
specification of the ventral pancreatic bud is postponed rather than prevented
in the absence of fgf24.
|
Thus, it can be inferred from all these data that fgf24 plays a role in the patterning of the pancreatic LPM and in the proper specification of the pancreatic ventral bud. However, given that the defects displayed by fgf24 mutants/morphants result from a delay of the ventral bud specification whereas a complete and persistent absence of ventral bud was caused by the pharmacological inhibition of FGF signaling, these findings suggest the involvement of another FGF factor.
The pancreatic LPM is a direct target tissue of fgf24 expressed within the endoderm
Because the loss of fgf24 function affects both the ventral
pancreatic bud and the adjacent LPM, we next asked which of these tissues is a
direct target of fgf24. To that end, the expression of pea3
and erm genes - two well-known direct targets of the FGF signaling
pathway - has been analyzed in detail (Fig.
6). pea3 expression started by 28 hpf in the pancreatic
region and was clearly detected within the pancreatic LPM at 36 hpf, as
revealed by double labeling with ptf1a probes
(Fig. 6A). erm onset
of expression started earlier, from 26 hpf, within the pancreatic LPM (at
26-28 hpf, the right and left LPM have not yet joined up)
(Fig. 6B and see Fig. S3 in the
supplementary material). erm and pea3 expression in the
pancreatic LPM was strongly reduced in the fgf24 morphant embryos
(Fig. 6A and data not shown)
thereby establishing that erm and pea3 are activated by the
FGF24 signaling in this tissue. These results clearly indicate that the
pancreatic LPM is a direct target of FGF24 signaling.
|
fgf24 and fgf10 cooperate for the specification of the ventral pancreatic bud
The fact that the defects caused by fgf24 loss of function are
less penetrant and less severe than those caused by SU5402 suggests a
compensation effect from other FGF factors. FGF10 could be such a factor.
Indeed, while mutation of fgf10 causes no obvious defect in exocrine
pancreas development (Fig. 3A),
fgf10 is expressed in the pancreatic LPM after 28 hpf
(Fig. 1B and
Fig. 2D) and its function could
be masked by fgf24 also expressed in this tissue. However, our
present results reveal that fgf10 alone is not mandatory for exocrine
pancreas development, which derives from the ventral pancreatic bud.
Therefore, a putative redundancy between fgf24 and fgf10
could mask a role of fgf10 in the development of the ventral bud. To
address this possibility, double knockdowns were performed by injecting a
combination of MO fgf10 and MO fgf24
(Fig. 7). The single and double
morphant embryos were characterized by a loss of pectoral fins as expected,
although their overall morphology was not drastically affected
(Fig. 7A). Strikingly,
trypsin expression at 3 dpf was dramatically repressed in the
majority of the double fgf10/fgf24 morphant embryos
(Fig. 7B), as observed upon
SU5402 treatment (Fig. 3C),
whereas only a weak reduction of trypsin was observed in the
fgf24 morphants and mutants. None of the double fgf10/fgf24
morphant embryos exhibited ptf1a expression at 36 hpf
(Fig. 7C). The delayed
ptf1a expression observed at 50 hpf in the fgf24
mutants/morphants (Fig. 5E) was
severely impaired after fgf10/fgf24 double knockdown
(Fig. 7C). To determine whether
these defects correlate with changes in the pancreatic LPM next to the ventral
bud, we analyzed isl1 expression at 36 hpf. Within the pancreatic
LPM, isl1 was almost undetectable in most double morphants whereas it
was unaffected in the pancreatic dorsal bud at this stage
(Fig. 7C). Similar observations
were made when we examined meis3 and fgf24 expression (data
not shown). The pancreatic phenotype of the double fgf24/fgf10
morphants was similar to the defects presented by SU5402-treated embryos
(Fig. 3B). Thus, all these data
reveal a redundant function of fgf10 and fgf24 in the
development of the pancreatic ventral bud.
|
| DISCUSSION |
|---|
|
|
|---|
The endoderm patterns the pancreatic LPM via FGF signaling
A major finding from the present work is that the endoderm specifies the
pancreatic LPM (Fig. 8A). This
has been confirmed by multiple approaches. Indeed, casanova mutant
embryos, which lack endoderm, display defects in the patterning of the
pancreatic LPM: isl1 and fgf24 genes are not activated and
meis3 expression is not maintained in the pancreatic LPM of these
mutants. The loss of gene expression is the result of failed specification
rather than of the absence of LPM since the LPM is present in zebrafish
mutants devoid of endoderm
(Horne-Badovinac et al.,
2003
). Furthermore, we showed that the patterning of the
pancreatic LPM relies on FGF signaling. Indeed, blocking the FGF signaling by
the FGFR inhibitor SU5402 suppressed the expression of the pancreatic LPM
markers isl1 and meis3. To be efficient, this blocking has
to be performed in a very restricted time window, that is, between 24 and 29
hpf or even 26 and 29 hpf; later exposures having no effect. Finally, we show
that FGF24 released by the endoderm during this period is involved in this
patterning. Indeed, fgf24 expression is restricted to the endoderm at
these stages (<30 hpf) and fgf24 morphant/mutant embryos display
significantly reduced expression of isl1, meis3 and fgf24 in
the pancreatic LPM and these results were confirmed using the fgf24
mutants. By contrast, fgf10 expression appears to be independent from
fgf24 function.
Another important finding of our study is that fgf24-mediated signaling from the endoderm triggered the expression of FGF signaling targets erm and pea3 in the adjacent pancreatic LPM. Indeed, erm expression can be detected in the pancreatic LPM at 26 hpf, but not within the pancreatic endoderm. This stage coincides with the appearance of isl1 expression and precedes the strengthening of meis3 expression in this tissue - the LPM patterning process. Moreover, the expression of erm and pea3 was lost in casanova mutant embryos (not shown) as well as in fgf24 morphants suggesting that FGF24 released by the endoderm initiates an FGF cascade in the adjacent tissue via transcription factors such as Erm and Pea3 that will in turn control isl1 and meis3 transcription, either directly or indirectly.
In mouse, signaling factors involved in the specification of the pancreatic
mesenchyme have not yet been identified. As the fgf24 gene is not
present in mammals (Fischer et al.,
2003
; Draper et al.,
2003
; Itoh and Ornitz,
2004
), another member of the FGF family should fulfil this role in
the mouse. fgf24 belongs to the FGF8/17/18 subfamily. Although there
is no report of expression of these Fgf genes in the developing pancreas, it
would be interesting to closely examine their expression in this tissue and to
investigate a putative function in patterning the murine pancreatic
mesenchyme.
Previous mouse data shown the importance of another signaling molecule,
Shh, in endoderm-driven patterning of the mesoderm during the
development of the gastro-intestinal tract. Shh is expressed in the
whole gut endoderm, except at the level of the prepancreatic endoderm
(Kim et al., 1997
). It has
been shown that ectopic expression of Shh within the pancreatic
epithelium converts the pancreatic mesenchyme into duodenal mesoderm and
represses pancreas development from the endoderm
(Apelqvist et al., 1997
). As in
mouse, zebrafish shh expression in the endoderm is excluded from the
pancreas (Roy et al., 2001
). A
putative functional interaction between shh and fgf during
zebrafish pancreatic development remains to be determined.
|
However, at later stages (after specification of the ventral bud), Fgf24
and Fgf10 or a distinct FGF could have an effect on the endoderm to control
ventral pancreatic growth as SU5402 treatments of embryos at these stages
reduce the exocrine pancreatic tissue. Consistent with this model,
fgf10 expression in mesenchymal cells within the pancreatic region
has been reported at later stages (Dong et
al., 2007
). In addition, we observed the expression of
fgfr2, known to encode for the main receptor of FGF10 in other
species, in both the endoderm and mesoderm during ventral pancreas development
(see Fig. S4 in the supplementary material).
Another argument supporting the role of the pancreatic LPM in the
specification of the ventral pancreatic bud was provided by the analysis of
heart and soul (has) zebrafish mutant embryos. In these
mutants, two ventral pancreatic buds are specified on each side of the
embryonic gut (Field et al.,
2003
). Analysis of isl1, meis3 and fgf10
expression in has mutant embryos indicated that the left and right
pancreatic LPM do not migrate to the midline but stay in a lateral position
contacting the gut on each side (data not shown)
(Horne-Badovinac et al.,
2003
). Thus, this bilateral contact between endoderm and the
pancreatic LPM may explain the duplicated ventral pancreatic buds.
In mouse, the pancreatic mesenchyme is crucial for the growth of the
pancreatic tissue by stimulating the proliferation of pancreatic progenitor
cells. This mesenchyme expresses Isl1
(Ahlgren et al., 1997
),
Meis genes (Zhang et al.,
2006
) and Fgf10
(Bhushan et al., 2001
).
Isl1 expression is limited in the murine pancreatic mesenchyme
surrounding the dorsal pancreatic bud and mutation of Isl1
consistently affects formation of this bud
(Ahlgren et al., 1997
).
Fgf10, expressed in both the dorsal and ventral pancreatic
mesenchyme, is crucial for the growth of both dorsal and ventral pancreatic
epithelium (Bhushan et al.,
2001
; Ye et al.,
2005
). In the present study, we identified in zebrafish, the
pancreatic LPM, analogous to the dorsal pancreatic mesenchyme surrounding the
murine dorsal bud, on the basis of the expression of isl1, fgf10 and
meis3. However, this tissue is rather contiguous to the ventral
rather than the dorsal bud. Furthermore, our data clearly indicate that this
pancreatic LPM is crucial for the specification and the growth of the
pancreatic ventral bud. Our finding that meis3 is exclusively
expressed in the LPM contradicts a recent report of meis3 expression
in the endoderm (diIorio et al.,
2007
). However, neither transverse section nor double staining
with endodermal marker was analyzed in that study. In addition, our data are
consistent with the strong expression of meis genes in the mouse
dorsal bud mesenchyme (Zhang et al.,
2006
). Nevertheless, it is possible that meis3 is
expressed within the endoderm, albeit at a much lower level than in the LPM,
as it was not detectable by in situ hybridization or earlier during
gastrulation.
In amniotes, the LPM gives rise to the dorsal pancreatic mesenchyme
expressing fgf10 and isl1 and surrounding the dorsal
pancreatic epithelium. In zebrafish, fgf10 and isl1 are
already expressed in the LPM. This tissue is just lying on the prospective
ventral anlagen instead of surrounding the epithelium as observed in mouse.
Later, cells expressing isl1 and fgf10 form a mesenchyme
contacting the hepatopancreatic ducts (Dong
et al., 2007
).
Our study shows that, after specification of the ventral pancreatic bud (32
hpf), the pancreatic LPM stimulates the growth of this bud. Indeed, knockdown
of isl1 or meis3 provoked a significant reduction of the
exocrine tissue at late stages, whereas the initial activation of
ptf1a was unaffected. This growth effect could be mediated by FGF
signaling (Fig. 8C). This
hypothesis is supported by two observations. First, treatment of zebrafish
embryos with the FGF inhibitor SU5402 after 32 hpf led to a significant
reduction in exocrine tissue (see Fig.
3D). Second, fgf24 mutation/knockdown, detected in the
pancreatic LPM after 32 hpf, also limits the expansion of the exocrine tissue
in most embryos at late stages. However, as the exocrine tissue is not
drastically affected in some fgf24 morphant/mutant embryos, it is
highly probable that, in addition to fgf24, other FGF genes (such as
fgf10) control exocrine growth. In contrast to data obtained in mice,
mutation of fgf10 alone does not affect the growth of the zebrafish
pancreatic buds. Our result is in agreement with a recent study describing the
role of zebrafish fgf10 in the establishment of the hepatopancreatic
duct system at late stages (60-80 hpf) and the lack of effect on
ptf1a expression was also noticed
(Dong et al., 2007
).
Nevertheless, the affect of fgf10 on pancreatic bud growth could be
masked by a redundant fgf24 activity.
In amniotes and amphibians, both the ventral and dorsal pancreatic buds
generate exocrine tissue. However, in zebrafish embryos, the dorsal pancreatic
bud seems to give rise only to endocrine cells and the whole exocrine tissue
appears to derive from the ventral pancreatic bud. Our present data could
explain such a difference. Indeed, previous studies performed in rodents,
using cultured pancreatic epithelium in absence or presence of mesenchyme,
showed that the pancreatic mesenchyme plays a specific pro-exocrine effect
(Ahlgren et al., 1997
;
Miralles et al., 1999
;
Li et al., 2004
;
Gittes et al., 1996
). In those
studies, cultures of pancreatic epithelium without any mesenchyme could lead
to the differentiation of endocrine cells but never of exocrine cells.
However, co-cultures of pancreatic epithelium with mesenchyme give rise to
large amount of exocrine cells. Since, in zebrafish embryos, the pancreatic
LPM, which seems to play an equivalent function of the murine pancreatic
mesenchyme, is located adjacent to the ventral pancreatic bud, this may
explain why pancreatic endocrine and exocrine tissues are generated by the
different buds in zebrafish. In mammals, both the ventral and dorsal buds are
in direct contact with mesenchymal cells derived from the LPM.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/cgi/content/full/134/22/4011/DC1
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahlgren, U., Jonsson, J. and Edlund, H. (1996). The morphogenesis of the pancreatic mesenchyme is uncoupled from that of the pancreatic epithelium in IPF1/PDX1-deficient mice. Development 122,1409 -1416.[Abstract]
Ahlgren, U., Pfaff, S. L., Jessell, T. M., Edlund, T. and Edlund, H. (1997). Independent requirement for ISL1 in formation of pancreatic mesenchyme and islet cells. Nature 385,257 -260.[CrossRef][Medline]
Alexander, J., Rothenberg, M., Henry, G. L. and Stainier, D. Y. (1999). casanova plays an early and essential role in endoderm formation in zebrafish. Dev. Biol. 215,343 -357.[CrossRef][Medline]
Apelqvist, A., Ahlgren, U. and Edlund, H. (1997). Sonic hedgehog directs specialised mesoderm differentiation in the intestine and pancreas. Curr. Biol. 7,801 -804.[CrossRef][Medline]
Bhushan, A., Itoh, N., Kato, S., Thiery, J. P., Czernichow, P., Bellusci, S. and Scharfmann, R. (2001). Fgf10 is essential for maintaining the proliferative capacity of epithelial progenitor cells during early pancreatic organogenesis. Development 128,5109 -5117.[Medline]
Biemar, F., Argenton, F., Schmidtke, R., Epperlein, S., Peers, B. and Driever, W. (2001). Pancreas development in zebrafish: early dispersed appearance of endocrine hormone expressing cells and their convergence to form the definitive islet. Dev. Biol. 230,189 -203.[CrossRef][Medline]
diIorio, P., Alexa, K., Choe, S. K., Etheridge, L. and Sagerstrom, C. G. (2007). TALE-family homeodomain proteins regulate endodermal sonic hedgehog expression and pattern the anterior endoderm. Dev. Biol. 304,221 -231.[CrossRef][Medline]
Dong, P. D., Munson, C. A., Norton, W., Crosnier, C., Pan, X., Gong, Z., Neumann, C. J. and Stainier, D. Y. (2007). Fgf10 regulates hepatopancreatic ductal system patterning and differentiation. Nat. Genet. 39,397 -402.[CrossRef][Medline]
Draper, B. W., Stock, D. W. and Kimmel, C. B.
(2003). Zebrafish fgf24 functions with fgf8 to promote posterior
mesodermal development. Development
130,4639
-4654.
Field, H. A., Dong, P. D., Beis, D. and Stainier, D. Y. (2003). Formation of the digestive system in zebrafish. II. Pancreas morphogenesis. Dev. Biol. 261,197 -208.[CrossRef][Medline]
Fischer, S., Draper, B. W. and Neumann, C. J.
(2003). The zebrafish fgf24 mutant identifies an additional level
of Fgf signaling involved in vertebrate forelimb initiation.
Development 130,3515
-3524.
Gittes, G. K., Galante, P. E., Hanahan, D., Rutter, W. J. and Debase, H. T. (1996). Lineage-specific morphogenesis in the developing pancreas: role of mesenchymal factors. Development 122,439 -447.[Abstract]
Golosow, N. and Grobstein, C. (1962). Epitheliomesenchymal interaction in pancreatic morphogenesis. Dev. Biol. 4,242 -255.[CrossRef][Medline]
Hauptmann, G. and Gerster, T. (1994). Two-color whole-mount in situ hybridization to vertebrate and Drosophila embryos. Trends Genet. 10,266 .[CrossRef][Medline]
Hebrok, M., Kim, S. K. and Melton, D. A.
(1998). Notochord repression of endodermal Sonic hedgehog permits
pancreas development. Genes Dev.
12,1705
-1713.
Horne-Badovinac, S., Rebagliati, M. and Stainier, D. Y.
(2003). A cellular framework for gut-looping morphogenesis in
zebrafish. Science 302,662
-665.
Itoh, N. and Ornitz, D. M. (2004). Evolution of the Fgf and Fgfr gene families. Trends Genet. 20,563 -569.[CrossRef][Medline]
Jacquemin, P., Lemaigre, F. P. and Rousseau, G. G. (2003). The Onecut transcription factor HNF-6 (OC-1) is required for timely specification of the pancreas and acts upstream of Pdx-1 in the specification cascade. Dev. Biol. 258,105 -116.[CrossRef][Medline]
Jacquemin, P., Yoshitomi, H., Kashima, Y., Rousseau, G. G., Lemaigre, F. P. and Zaret, K. S. (2006). An endothelial-mesenchymal relay pathway regulates early phases of pancreas development. Dev. Biol. 290,189 -199.[CrossRef][Medline]
Jonsson, J., Carlsson, L., Edlund, T. and Edlund, H. (1994). Insulin-promoter-factor 1 is required for pancreas development in mice. Nature 371,606 -609.[CrossRef][Medline]
Katoh, Y. and Katoh, M. (2005). Comparative genomics on FGF7, FGF10, FGF22 orthologs, and identification of fgf25. Int. J. Mol. Med. 16,767 -770.[Medline]
Kawaguchi, Y., Cooper, B., Gannon, M., Ray, M., MacDonald, R. J. and Wright, C. V. (2002). The role of the transcriptional regulator Ptf1a in converting intestinal to pancreatic progenitors. Nat. Genet. 32,128 -134.[CrossRef][Medline]
Kim, S. K., Hebrok, M. and Melton, D. A. (1997). Notochord to endoderm signaling is required for pancreas development. Development 124,4243 -4252.[Abstract]
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B. and Schilling, T. F. (1995). Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253 -310.[Medline]
Korzh, S., Emelyanov, A. and Korzh, V. (2001). Developmental analysis of ceruloplasmin gene and liver formation in zebrafish. Mech. Dev. 103,137 -139.[CrossRef][Medline]
Korzh, V., Edlund, T. and Thor, S. (1993). Zebrafish primary neurons initiate expression of the LIM homeodomain protein Isl-1 at the end of gastrulation. Development 118,417 -425.[Abstract]
Korzh, V., Sleptsova, I., Liao, J., He, J. and Gong, Z. (1998). Expression of zebrafish bHLH genes ngn1 and nrd defines distinct stages of neural differentiation. Dev. Dyn. 213,92 -104.[CrossRef][Medline]
Kumar, M. and Melton, D. (2003). Pancreas specification: a budding question. Curr. Opin. Genet. Dev. 13,401 -407.[CrossRef][Medline]
Kumar, M., Jordan, N., Melton, D. and Grapin-Botton, A. (2003). Signals from lateral plate mesoderm instruct endoderm toward a pancreatic fate. Dev. Biol. 259,109 -122.[CrossRef][Medline]
Lammert, E., Cleaver, O. and Melton, D. (2003). Role of endothelial cells in early pancreas and liver development. Mech. Dev. 120,59 -64.[CrossRef][Medline]
Li, H., Arber, S., Jessell, T. M. and Edlund, H. (1999). Selective agenesis of the dorsal pancreas in mice lacking homeobox gene Hlxb9. Nat. Genet. 23, 67-70.[Medline]
Li, Z., Manna, P., Kobayashi, H., Spilde, T., Bhatia, A., Preuett, B., Prasadan, K., Hembree, M. and Gittes, G. K. (2004). Multifaceted pancreatic mesenchymal control of epithelial lineage selection. Dev. Biol. 269,252 -263.[CrossRef][Medline]
Lin, J. W., Biankin, A. V., Horb, M. E., Ghosh, B., Prasad, N. B., Yee, N. S., Pack, M. A. and Leach, S. D. (2004). Differential requirement for ptf1a in endocrine and exocrine lineages of developing zebrafish pancreas. Dev. Biol. 270,474 -486.[CrossRef][Medline]
Mavropoulos, A., Devos, N., Biemar, F., Zecchin, E., Argenton, F., Edlund, H., Motte, P., Martial, J. A. and Peers, B. (2005). sox4b is a key player of pancreatic alpha cell differentiation in zebrafish. Dev. Biol. 285,211 -223.[CrossRef][Medline]
Milewski, W. M., Duguay, S. J., Chan, S. J. and Steiner, D.
F. (1998). Conservation of PDX-1 structure, function, and
expression in zebrafish. Endocrinology
139,1440
-1449.
Miralles, F., Czernichow, P., Ozaki, K., Itoh, N. and
Scharfmann, R. (1999). Signaling through fibroblast growth
factor receptor 2b plays a key role in the development of the exocrine
pancreas. Proc. Natl. Acad. Sci. USA
96,6267
-6272.
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures
of the tyrosine kinase domain of fibroblast growth factor receptor in complex
with inhibitors. Science
276,955
-960.
Norton, W. H., Ledin, J., Grandel, H. and Neumann, C. J.
(2005). HSPG synthesis by zebrafish Ext2 and Extl3 is required
for Fgf10 signalling during limb development.
Development 132,4963
-4973.
Ober, E. A., Verkade, H., Field, H. A. and Stainier, D. Y. (2006). Mesodermal Wnt2b signalling positively regulates liver specification. Nature 442,688 -691.[CrossRef][Medline]
Odenthal, J. and Nusslein-Volhard, C. (1998). fork head domain genes in zebrafish. Dev. Genes Evol. 208,245 -258.[CrossRef][Medline]
Oulad-Abdelghani, M., Chazaud, C., Bouillet, P., Sapin, V., Chambon, P. and Dolle, P. (1997). Meis2, a novel mouse Pbx-related homeobox gene induced by retinoic acid during differentiation of P19 embryonal carcinoma cells. Dev. Dyn. 210,173 -183.[CrossRef][Medline]
Pictet, R. L., Clark, W. R., Williams, R. H. and Rutter, W. J. (1972). An ultrastructural analysis of the developing embryonic pancreas. Dev. Biol. 29,436 -467.[CrossRef][Medline]
Roy, S., Qiao, T., Wolff, C. and Ingham, P. W. (2001). Hedgehog signaling pathway is essential for pancreas specification in the zebrafish embryo. Curr. Biol. 11,1358 -1363.[CrossRef][Medline]
Sagerstrom, C. G., Kao, B. A., Lane, M. E. and Sive, H. (2001). Isolation and characterization of posteriorly restricted genes in the zebrafish gastrula. Dev. Dyn. 220,402 -408.[CrossRef][Medline]
Spooner, B. S., Walther, B. T. and Rutter, W. J.
(1970). The development of the dorsal and ventral mammalian
pancreas in vivo and in vitro. J. Cell Biol.
47,235
-246.
Wan, H., Korzh, S., Li, Z., Mudumana, S. P., Korzh, V., Jiang, Y. J., Lin, S. and Gong, Z. (2006). Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter. Exp. Cell Res. 312,1526 -1539.[CrossRef][Medline]
Wendik, B., Maier, E. and Meyer, D. (2004). Zebrafish mnx genes in endocrine and exocrine pancreas formation. Dev. Biol. 268,372 -383.[CrossRef][Medline]
Westerfield, M. (1995). The Zebrafish Book: Guide for the Laboratory Use of Zebrafish (Danio Rerio). Eugene, OR: University of Oregon Press.
Ye, F., Duvillie, B. and Scharfmann, R. (2005). Fibroblast growth factors 7 and 10 are expressed in the human embryonic pancreatic mesenchyme and promote the proliferation of embryonic pancreatic epithelial cells. Diabetologia 48,277 -281.[CrossRef][Medline]
Yoshitomi, H. and Zaret, K. S. (2004).
Endothelial cell interactions initiate dorsal pancreas development by
selectively inducing the transcription factor Ptf1a.
Development 131,807
-817.
Zecchin, E., Mavropoulos, A., Devos, N., Filippi, A., Tiso, N., Meyer, D., Peers, B., Bortolussi, M. and Argenton, F. (2004). Evolutionary conserved role of ptf1a in the specification of exocrine pancreatic fates. Dev. Biol. 268,174 -184.[CrossRef][Medline]
Zhang, X., Rowan, S., Yue, Y., Heaney, S., Pan, Y., Brendolan, A., Selleri, L. and Maas, R. L. (2006). Pax6 is regulated by Meis and Pbx homeoproteins during pancreatic development. Dev. Biol. 300,748 -757.[CrossRef][Medline]
Related articles in Development:
This article has been cited by other articles:
![]() |
K. S. Zaret and M. Grompe Generation and Regeneration of Cells of the Liver and Pancreas Science, December 5, 2008; 322(5907): 1490 - 1494. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||