|
|
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | ||||
First published online October 26, 2007
doi: 10.1242/10.1242/dev.010850



Institut de Biologie du Développement de Marseille Luminy (IBDML), CNRS-UMR6216/Université de la Méditerranée Aix-Marseille, F-13288 Marseille Cedex 9, France.
Authors for correspondence (e-mails:
rothbach{at}ibdml.univ-mrs.fr;
lemaire{at}ibdml.univ-mrs.fr)
Accepted 23 August 2007
| SUMMARY |
|---|
|
|
|---|
Key words: Ectoderm, Ciona intestinalis, Ascidian, GATA, Ets, ß-catenin
| INTRODUCTION |
|---|
|
|
|---|
Several key vertebrate maternal axial determinants and a few of their
direct zygotic targets have also been identified in Xenopus and fish
(reviewed by Heasman, 2006a
;
Schier and Talbot, 2005
),
which has led to the initiation of the reconstruction of gene regulatory
networks for the mesendoderm (Koide et
al., 2005
; Loose and Patient,
2004
). These networks are at present very incomplete. First, some
maternal determinants are most likely missing. Second, deciphering the precise
cis-regulatory logic that enables combinations of maternal factors to activate
their targets in distinct territories has proved difficult owing largely to
the size and complexity of the vertebrate genomes. As an additional
difficulty, the early genetic program can significantly differ between
amphibians and fishes. For example, the zebrafish orthologue of the major
Xenopus maternal determinant of vegetal territories, VegT, is not
expressed in early fish embryos (Ruvinsky
et al., 1998
).
In this context, studies on ascidians, members of the chordate phylum, have
recently emerged as particularly informative. First, ascidian embryos have an
early gastrula fate map and tadpole structure remarkably similar to lower
vertebrates (Kowalevsky, 1866
;
Kowalevsky, 1871
;
Kourakis and Smith, 2005
), yet
use a particular mode of development based on a fixed cell lineage
(Conklin, 1905
;
Nishida and Satoh, 1985
;
Nishida, 1987a), extensive use of maternal determinants
(Chabry 1887
; Nishida, 1987b;
Nishida and Sawada, 2001
) and
very local inductions (reviewed by
Nishida, 2005
;
Tassy et al., 2006
).
Comparison of the ascidian and vertebrate strategies should therefore allow
discrimination between crucial events expected to be shared, and adaptations
to specific modes of developments. Second, studies on the ascidian Ciona
intestinalis have progressed at an impressive pace since the release of
the draft sequence of its genome (Dehal et
al., 2002
), culminating recently in the first whole embryo draft
zygotic gene regulatory network in a metazoan
(Imai et al., 2006
). This
progress was made possible by a low level of genetic redundancy
(Dehal et al., 2002
), the
availability of efficient gene gain- and loss-of-function strategies
(Corbo et al., 1997
;
Satou et al., 2001
), and the
ease of identifying the cis-regulatory modules that drive zygotic gene
expression. These advances open the way to an understanding of the
developmental genetic program at a similar resolution level to that in flies
(e.g. Bertrand et al.,
2003
).
In ascidians, the third cleavage separates the ectoderm, which occupies the
animal half of the embryo, from the mesendoderm, which occupies its vegetal
half (reviewed by Nishida,
1997a
). Imai and colleagues
(Imai et al., 2000
) showed
that maternal ß-catenin progressively accumulates in the vegetal nuclei
of cleaving Ciona embryos where it acts as a key determinant of the
vegetal territories. Their work also suggested candidate direct zygotic
targets of this determinant (Imai,
2003
). As in vertebrates, little is known about animal
specification. Fusion of animal egg fragments to isolated vegetal blastomeres
of eight-cell embryos drove epidermal development in the vegetal host cell,
suggesting the existence of localized epidermal determinants (reviewed by
Nishida, 1997b
). These
experiments also showed that rearrangements following fertilization
redistribute and concentrate the epidermis determinants to the animal region.
Extensive microarray analyses have, however, failed to detect maternal mRNAs
enriched in early animal blastomeres, suggesting that the animal determinants
are not encoded by localized mRNAs (Yamada
et al., 2005
).
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
fog (friend of GATA, ci0100149797) regulatory sequences covering
1981 bp upstream of the ATG (pfog-2000) were isolated by PCR from sperm
genomic DNA with primers 5'P-pFOG
aaaactgcagGCAACTATTGTAACACCACACG and 3'B-pFOG
cgcggatccTATGTGTGTTATTTTTGTATAGACC (flanking PstI or
BamHI sites, underlined) using AccuPrime Taq DNA Polymerase
(Invitrogen). The pfog-566::NLS-lacZ construct contains sequences
downstream of an endogenous SspI site at position -566 and includes
the conserved block, as shown in Fig.
1. Construct pfog-300-bpbra::NLS-lacZ contains
evolutionarily conserved FOG 5' sequences between nucleotides -566
(SspI site) and -213 (HindIII site) cloned with
SalI-BamHI upstream of the basal promoter of
Ci-Brachyury (bpbra, -68/+26 fragment)
(Yagi et al., 2004
). Deletion
constructs within this conserved region were obtained by Gateway technology
(Invitrogen) using attB1 and attB2 flanked PCR primers. FOG-specific sequences
at the 5' end of constructs were: pfog-530: AGAAAACAACCTTGTTATTACTC;
pfog-354: CAAGCAGTAACGAGAAAACAAG; pfog-314: CTGGAGAAGACCAAGATAAAG; pfog-m314:
CTGGAGAAGACCAACATAAAGTATTTC (mutations in GATA binding
sites, underlined), pfog-290: CTCAAAATTCAGGAAACGGTC, whereas the 3' end
was generated with a Gateway version of 3'B-pFOG. The dINT construct
(positions -314 to -85) is as pfog-314 at the 5' end and deletes intron
1 and downstream sequences at the 3' end by using the pfog-specific
reverse primer sequence: 5' TGTGACCACCTGCCTTGTC 3'. 2GdINT is a
modification of dINT where the two endogenous Ci-fog GATA sites were
replaced by GATA sites from the otx neural a-element and contains the
sequence CAATATCTAAGATAGGAAAATTCAGGAAACGGTCCAAG at its
5' end (GATA sites underlined). The G-12 construct, under the control of
bpbra, contained the following GATA site multimer XhoI and
HindIII (inspired from the otx a-element)
(Bertrand et al., 2003
):
CGTTATCTCTCAATATCTAAGATAGGACGTTATCTCTCAATATCTAAGATAGGACGTTATCTCTCAATATCTAAGATAGGACGTTATCTCTCAATATCTAAGATAGGAG.
The 12X TCF sequence was isolated from the dTF12 vector (N. Perrimon Lab)
(DasGupta et al., 2005
) using
ScaI and SmaI sites and inserted into a
HindIII-blunted site upstream pfog-215::NLS-lacZ (basal
promoter with an activity slightly weaker than pfog-290).
To generate constructs with heterologous enhancers upstream of the
fog basal promoter, the following enhancer sequences were inserted
into XhoI and HindIII sites, upstream of
pfog-290::lacZ: the reduced otx neural a-element
(Bertrand et al., 2003
), the
Ets site mutated a-element
CGTTATCTCTAACaGAAGTTTTCGAAAAaGAAATTGTTCAATATCTAAGATAGGA
(GATA and Ets sites underlined, mutations in lower case letters), or the
Ci-bra enhancer (eBra) covering position -470 to -62, using forward
and reverse primers 5'CCGCTCGAGAACACACCCAACGTACAATAAAAC3' and
5'CCCAAGCTTCTTCTTTTTGAAATTTTATGTTTG3'.
RACE PCR was performed with GeneRacer (version D; Invitrogen) according to the manufacturer's instructions from total RNA of 64-cell Ciona intestinalis embryos using nested reverse primers dINT and -143rev 5'attB2AAACTGCCTTCTTCTCTTGTC3'.
Embryo handling, electroporation and injection
Animal handling, electroporations and injections were as described
previously (Bertrand et al.,
2003
). Embryos were treated with bFGF (100 ng/ml; Sigma),
cytochalasin B (4 µg/ml; Sigma) or U0126 (5 µM; Calbiochem) as
previously described (Hudson et al.,
2003
; Hudson and Lemaire,
2001
), or 50-300 mM LiCl
(Yoshida et al., 1998
). For
electroporations, volumes were scaled to half and for microinjections, 20-50
ng/µl DNA plasmid, 0.5 mM morpholino oligonucleotides (MO; Gene tools, LLC)
and 0.3-0.5 µg/µl synthetic mRNA were used.
GATAa mRNA, EnR-GATAa mRNA, GATAa-MO and
Ci-ß-catenin-MO were as described previously
(Bertrand et al., 2003
;
Satou et al., 2001
). The
CiTCF-MO (against ci0100131330) was TCATCCGAGTTTAACTGAGGCATTC. The GATAb-MO
(against ci0100136326) was GTTGCTCGCTACTTGTTGGCATCAT (ATGs
underlined). The ATG for GATAb was determined according to the
conservation to vertebrate GATA2 and GATA3 protein and Ciona savignyi
cDNA sequences and upon verification by RT-PCR (details available upon
request).
In situ hybridization and reporter assays
In situ hybridizations and ß-galactosidase (ß-gal) reporter
assays (X-Gal stain) were performed as described previously
(Bertrand et al., 2003
) with
digoxigenin-labeled probes generated from the following clones: lacZ
(pSP1.72-lacZ) (Corbo et al.,
1997
), Ci-fog (GR1 cieg033m14), Ci-GATAa
(Bertrand et al., 2003
),
Ci-epiB (GenBank AL666073) and Ci-epi1
(Hudson et al., 2003
). pfoxD
is p(-3.6)Cs-FoxD/lacZ (Imai et al.,
2002
).
| RESULTS |
|---|
|
|
|---|
Phylogenetic footprinting of pfog-2000 between Ciona intestinalis
and Ciona savignyi pointed to the presence of a 294 bp highly
conserved fragment (Fig. 1D). A
566 bp fragment including this region and extending up to the ATG of
Ci-fog, pfog-566, had similar activity to pfog-2000, whereas deletion
of the conserved region suppressed this activity (pfog-215). A construct,
pfog300-bpbra::NLS-lacZ, in which this conserved fragment was placed
upstream of the unrelated Ci-bra basal promoter
(Erives et al., 1998
) drove
animal ß-gal expression. The conserved fragment, therefore, contains all
the information required to drive early animal expression.
Maternal GATAa is necessary and sufficient for animally restricted gene expression
Through 5' deletion analysis of the 566 bp fragment, we narrowed down
the animal cis-regulatory region to a minimal fragment. This region, pfog-314
(Fig. 2), contains two
consensus binding sites for GATA transcription factors conserved between the
genomes of Ciona intestinalis and Ciona savignyi. Deletion
or point mutation of these sites abolished all activity
(Fig. 2A). Thus, GATA binding
sites are critically involved in animal gene expression. Injection of mRNA for
a dominant negative form of GATA (fusion of the GATAa-DNA binding domain to
the engrailed-repressor domain) (Bertrand
et al., 2003
) blocked endogenous Ci-fog expression (92%
Ci-fog-negative embryos, n=12), confirming that GATA factors
are required for its activation.
We next tested whether GATA-binding sites, placed in front of a basal
promoter, are sufficient to drive early pan-animal expression. We previously
reported that a synthetic construct carrying six GATA-binding sites in front
of the Ci-bra basal promoter drove FGF-dependent expression in animal
neural precursors only, starting from the 32-cell stage
(Bertrand et al., 2003
). To
analyze whether an earlier, weaker, GATA activity existed, we constructed a
more efficient sensor, G12-bpbra::NLS-lacZ (or G12 in short), in
which 12 GATA-binding sites were placed in front of the Ci-bra basal
promoter. This construct drove an early animal-wide expression, which strongly
resembled the pfog-314::NLS-lacZ expression. By the late 32-cell
stage, two levels of expression could be observed: a strong expression in the
animal neural precursors (a6.5 and b6.5) as well as a weaker pan-animal
activity (other a and b cells), which appeared stronger in posterior animal
lineages (b cells) (Fig. 2D).
This pan-animal activity was detected from the 16-cell stage onwards
(Fig. 4A), prior to the
activation of FGF signaling in the embryo, and suggesting that it was FGF
signaling independent. Consistently, in embryos grown in the MEK inhibitor
U0126, which blocks the FGF signaling cascade, G12 activity was unchanged in
uninduced animal blastomeres (a6.6-6.8 and b6.6-6.8, yellow and light purple,
respectively, in Fig. 2D), and
reduced in FGF-induced neural precursors (a6.5 and b6.5, red and dark purple)
to the level found in the uninduced blastomeres
(Fig. 2D, compare left and
right panels). We conclude that, in addition to the previously identified
FGF-dependent GATA activity in neural lineages, an earlier FGF-independent
GATA activity exists throughout the animal hemisphere.
|
Taken together, these results indicate that GATAa is a maternal factor that is necessary and sufficient to drive animal gene expression before, and independently of, neural induction. GATAa has thus two distinct roles in the embryo, an early FGF-independent role throughout the entire animal region, including Ci-fog activation, and a later, FGF-dependent function in the neural precursors, leading to Ci-otx expression.
GATAa is required for overall ectoderm differentiation
We next tested whether GATAa is required for the specification of the whole
ectoderm. As GATAa activity is known to be required for neural tissue
formation in the animal hemisphere
(Bertrand et al., 2003
), we
focused on the role of GATAa in the formation of the other major ectodermal
derivative, the epidermis. We injected a repressor version of GATAa
(EnR-GATAa) into oocytes and analyzed the resulting embryos for
epidermal marker expression at neurula stages. To better identify neural and
epidermal precursors in these embryos, we arrested cleavage at the 64-cell
stage using cytochalasin and tested for epiB or epi1
epidermal marker expression. Uninjected control embryos showed strong
epiB and epi1 expression in epidermal precursors at the
equivalent of the neurula stage (Fig.
3A). By contrast, EnR-GATAa-injected embryos had severely
reduced expression of both epidermal markers
(Fig. 3A). A similar result was
obtained in normally cleaving, EnR-GATAa-injected neurula (not shown,
0/23 embryos expressed epiB, and 15/25 embryos weakly expressed
epi1). At the tailbud stage, the epi1 residual expression
was not maintained in normally cleaving, EnR-GATAa-injected embryos
(Fig. 3A), indicating that GATA
function is strictly required for epidermis formation.
To assess whether GATAa and GATAb can both contribute to epidermis formation we inactivated GATA function with either GATAa-MO, GATAb-MO or a combination of both (Fig. 3B). Individual MO injection reduced epiB expression, with a strong reduction in 29% of the injected embryos for GATAa-MO and 46% for GATAb-MO. Co-injection of both GATA MOs synergistically blocked the epidermal marker in 100% of embryos. Thus, GATAa and GATAb are both required for epidermal differentiation in the animal region of ascidians.
|
The gradual exclusion of GATAa activity from the vegetal hemisphere
parallels the progressive accumulation of the vegetal determinant
ß-catenin in the vegetal nuclei (Imai
et al., 2000
). Analysis of the onset of activity of the regulatory
sequences of the direct ß-catenin target foxD
(Imai et al., 2002
), or of a
12-mer of DNA binding sites for the ß-catenin co-factor TCF
(DasGupta et al., 2005
) placed
in front of the Ci-bra basal promoter (12xTCF;
Fig. 4A, right panel) revealed
that the progressive restriction of GATAa activity to the animal hemisphere
had the same kinetics as the increase in ß-catenin transcriptional
activity in the vegetal hemisphere (Fig.
4A,B). This perfect temporal and spatial correlation suggests that
GATAa and ß-catenin may cross regulate each other.
We first tested whether accumulating ß-catenin could block GATAa in the vegetal region, thereby restricting its activity to the animal hemisphere. For this, we injected a morpholino against ß-catenin into eggs and monitored GATAa activity using the G12-bpbra::NLS-lacZ reporter. This construct, normally restricted to the animal hemisphere, became ectopically expressed in the vegetal region when ß-catenin translation was blocked from before fertilization, showing that ß-catenin normally represses GATA activity in the vegetal hemisphere (Fig. 5A,B). Bringing further support for this notion, a morpholino targeted against the ß-catenin cofactor TCF, also derepressed G12 in the vegetal region (Fig. 5A,B). Finally, activation of the ß-catenin pathway by lithium treatment led to the suppression of G12 activity (Fig. 5C) indicating that ectopic activation of the ß-catenin pathway is sufficient to block GATAa activity.
Conversely, we also tested whether GATAa could antagonize ß-catenin transcriptional activity (Fig. 5D). For this, we lowered GATAa levels in the embryo with GATAa-MO or raised them by GATAa mRNA injection and monitored ß-catenin-TCF activity with pfoxD::lacZ. Modified GATAa levels had, however, no significant influence on ß-catenin-mediated gene expression.
Thus, early animal-vegetal patterning results from the progressive definition of a vegetal domain of activity of ß-catenin, which restricts the activity of the initially ubiquitous GATAa to the animal territory, where it activates the animal program.
Mechanism of differential readout of GATAa activity in pan-animal versus neural territories
Finally, we addressed the molecular mechanism by which GATAa is able to
sequentially activate Ci-fog and Ci-otx in nested
territories. We were particularly puzzled by the lack of early pan animal
activation of the Ci-otx neural element (a-element), in spite of its
containing three GATA sites.
The simplest explanation would be a qualitative difference in the GATA
binding sites present in the Ci-otx and Ci-fog regulatory
sequences. We tested this by replacing 17 bp containing the two GATA sites and
flanking sequence of pfog-314 (nucleotides -303 to -286) with a 17 bp fragment
harboring two GATA sites and flanking sequence from the neural element of
Ci-otx (nucleotides -1434 to -1418 of potx)
(Bertrand et al., 2003
). This
permutation maintained early-animal-wide expression
(Fig. 6B), suggesting that
differences in the GATA sites present in the two genes cannot explain their
differential activation.
|
|
|
Taken together, these results indicate that a major determinant of the
differential responsiveness of Ci-fog and Ci-otx to GATAa is
the presence of Ets binding sites in the a-element. Before the onset of neural
induction and in uninduced animal cells, these sites cause active repression
of the a-element. In response to the neural inducing FGF signal, Ets binding
sites become activating cis-elements and synergize with GATAa sites to turn on
Ci-otx in a6.5 and b6.5 neural precursors
(Bertrand et al., 2003
).
| DISCUSSION |
|---|
|
|
|---|
On the existence of a maternal determinant for Ciona ectoderm
We found that the early animal-specific gene Ci-fog is directly
activated by maternal Ci-GATAa, that a multimer of GATA sites is sufficient to
drive animal-specific expression, and is selectively activated by GATAa but
not GATAb, whereas inhibition of GATAa activity represses both epidermal and
neural fates. The mRNA for this factor is, however, ubiquitously distributed
and we have no indication of differential translation of this message by the
16-cell stage when its target gene Ci-fog is specifically activated
in animal territories (Bertrand et al.,
2003
). In addition, GATAa activity appears permissive rather than
instructive as interference with GATAa function has no effect on the early
vegetal program as measured by the activation of the ß-catenin target
gene Ci-foxD. Notably, ectopic GATAa does not impose the ectodermal
program on vegetal cells. Ci-GATAa can thus be considered a permissive
maternal activator of the ectodermal program.
|
The permissive nature of GATA signaling is in keeping with the finding that
the down regulation of ß-catenin leads to the formation of ectopic
epidermis in the vegetal territories (Imai
et al., 2000
). However, our results are surprising in light of
embryological experiments carried out in another ascidian, Halocynthia
roretzi, which suggested that an instructive animal maternal determinant
was distributed as a gradient along the animal vegetal hemisphere of
fertilized eggs (Nishida,
1997b
). Although we cannot exclude that additional localized
animal determinants may act in ascidians, or that the Ciona and
Halocynthia logics may differ, our discovery that vegetally localized
maternal ß-catenin represses GATAa activity may be sufficient to solve
this apparent paradox. By analogy to the Xenopus, fish and sea urchin
situation, ß-catenin is probably also activated in ascidians
(Yoshida et al., 1998
) as a
result of the action of cortically localized factors such as dishevelled
(Miller et al., 1999
;
Rothbächer et al., 2000
;
Weitzel et al., 2004
). The
Halocynthia experiments were carried out by fusing egg fragments to
vegetal blastomeres, and therefore led to the local replacement of the vegetal
cortex by cortex of a more animal nature. This may have led to the local lack
of activation of ß-catenin, and thus to the local derepression in the
vegetal cells of GATAa.
Overall, our study suggests that ascidian ectoderm is established permissively and that an instructive maternal animal determinant may not exist in ascidians. It also highlights that ectoderm is a ground state that needs to be repressed by vegetal ß-catenin for other germlayers to form.
A direct repression of GATAa transcriptional activity by ß-catenin-TCF in the vegetal hemisphere?
In a previous study (Bertrand et al.,
2003
) we found that ectopic GATAa-GFP was transiently restricted
to the animal hemisphere during the late 32-cell stage, at the time of neural
induction. This protein was, however, ubiquitously distributed up to the
16-cell stage, at the time when Ci-fog expression becomes restricted
to the animal hemisphere. Regulation of protein stability is thus unlikely to
be crucial for the early definition of the animal hemisphere. Instead, our
results suggest an interference with the transcriptional activity of GATAa. We
do not know at present whether this is achieved at the level of its ability to
bind DNA or to activate transcription.
The ß-catenin-TCF complex usually functions in transcriptional activation and the simplest mechanism would be that it activates a zygotic repressor of GATAa activity in the vegetal territory. This would, however, result in a restriction of GATAa activity occurring later than the activation of the primary ß-catenin-TCF transcriptional targets. In contrast, we found that the animal restriction of GATAa activity, measured by G12 and Ci-fog activation, is simultaneous to the activation of two direct targets of ß-catenin, 12xTCF and Ci-foxD. This goes against a transcriptional relay mechanism and suggests that the ß-catenin-TCF complex may directly repress GATAa activity. It will be interesting to test, in the future, whether these proteins are found in a single complex.
Transcriptional logic underlying successive target selection by Ci-GATAa
In addition to turning on target genes such as Ci-otx in the
FGF-induced a6.5 and b6.5 neural progenitors at the 32-cell stage
(Bertrand et al., 2003
), we
found that Ci-GATAa has earlier pan animal targets such as Ci-fog.
Our analysis further allowed us to shed light on the transcriptional logic for
the selection of different target genes in nested territories at successive
developmental time points (Fig.
7).
Our results point to a major role for the two Ets sites in this process. In
the absence of FGF signaling, Ets sites act as repressive elements for the
Ci-otx neural enhancer. Our previous analysis
(Bertrand et al., 2003
)
indicated that upon reception of an FGF signal, they act as positive
transcriptional elements and synergize with the neighboring GATA sites. Thus,
conversion of Ets sites from ongoing repressive elements in uninduced cells to
activating elements in individually induced cells is a key determinant of the
activation of Ci-otx. Conversion of Ets factors from repressor to
activator upon MAPK signaling has been described in vertebrates
(Maki et al., 2004
) and
insects (Rebay and Rubin,
1995
). It will therefore be interesting to examine in the future
whether Ci-Ets1/2, which mediates the activation of Ci-otx in
FGF-induced cells, also acts as a repressor in uninduced cells or whether the
repressive function is achieved by another Ciona Ets factor.
Interestingly, there does not seem to be a sharp transition between the maternal and zygotic programs, rather, distinct combinations of maternal factors are sufficient to collaborate with overlapping early zygotic signals to directly turn on distinct zygotic genes at successive developmental stages in nested territories of the ascidian ectoderm. This situation is somewhat reminiscent of the feed forward loops at work in the early regulatory network that sets the Drosophila anterior posterior axis, in which combinations of maternal factors collaborate with their first broadly expressed zygotic targets, the gap genes, to activate pair rule and segment polarity genes in smaller territories.
Evolutionary considerations
It is interesting to compare the ascidian ectodermal logic with that of
other bilaterians. Our data point to a GATA network for epidermis formation in
ascidians, where a maternal role for GATAa (GATA4/5/6) is complemented by
probable zygotic ectodermal GATAb (GATA1/2/3). A large body of evidence is
arising to give support to the idea that GATAb orthologues are implicated at
various levels in epidermis formation across bilaterians
(Gillis et al., 2007
). The
function of GATAb can be therefore considered a conserved feature. The novel
role of maternal GATAa in the initiation of the ectodermal program, and its
restriction/repression by ß-catenin, has not been demonstrated
before.
Ascidians are phylogenetically close to vertebrates, a relatedness apparent
in the shared early gastrula fate map and larval body plan (reviewed by
Nishida, 2005
). Yet, the
vertebrate situation appears to differ significantly from the ascidian one.
The transition between maternal information and the zygotic program has been
best studied in lower vertebrates, and in particular in Xenopus and
zebrafish. Although maternal vegetal determinants may differ between these two
systems, they converge at the level of the activation of nodal signaling,
which is the major pathway inducing both mesoderm and endoderm (reviewed by
Schier and Talbot, 2005
;
Heasman, 2006a
). Analysis of
the animal region of Xenopus or fish embryos identified several
maternal mRNAs, such as zic2, the soxB1 family gene
sox3 and ectodermin functioning in maternal inhibition of
nodal signaling (Houston and Wylie,
2005
; Zhang et al.,
2004
; Dupont et al.,
2005
). They act via different strategies and are crucial to set
the position of the boundary between mesendoderm and ectoderm in the animal
hemisphere. These results suggest that maternal repressors of nodal signaling
are necessary for the vertebrate ectoderm to form. In ascidians, Nodal is not
a major inducer of endoderm and mesoderm
(Hudson and Yasuo, 2006
),
which may explain why such a strategy has not been conserved between ascidians
and vertebrates. It should be noted, however, that in sea urchin embryos
maternal SoxB1, repressed by vegetal ß-catenin is probably required for
ectodermal development (Angerer et al.,
2005
), although nodal has so far only been shown to be involved in
oral ectoderm rather than mesendodermal induction
(Duboc et al., 2004
).
As no regulatory sequences driving early vertebrate ectodermal gene
expression have been reported, it remains unclear whether inhibition of Nodal
signaling is sufficient for the definition of the ectoderm in vertebrates, or
if additional molecules are involved. At first sight, the GATAa orthologues
GATA4, 5 and 6, seem unlikely candidates, as they have been shown to be
important for the formation of the endoderm rather than the ectoderm (reviewed
by Patient and McGhee, 2002
;
Loose and Patient, 2004
). This
is, however, a zygotic function of these proteins, which is probably an
ancestral deuterostome feature (Gillis et
al., 2007
) as ascidian Ci-GATAa, sea urchin and starfish
gatae are zygotically expressed throughout the endoderm
(Imai et al., 2004
;
Hinman et al., 2003
) and sea
urchin and starfish GATAe function is crucial for endoderm formation
(Hinman et al., 2003
). In
addition to this conserved zygotic function, however, Xenopus GATA5
is expressed maternally (Partington et
al., 1997
). It will be important to carefully test the effect of
the early loss of function of GATA4, 5 and 6 proteins on the vertebrate
ectodermal program.
Conclusion
Our work constitutes a unique example of direct regulatory interactions
linking maternal factors and the cis-regulatory elements of genes transcribed
in the ectoderm of a chordate. Together with the recently published zygotic
Ciona whole embryo gene regulatory network
(Imai et al., 2006
), it
constitutes a base to reconstruct the ectodermal gene regulatory network.
Comparison of ascidian and vertebrate networks should permit the
identification of crucial conserved features, and also an assessment of the
extent of deviation that is compatible with the adoption of a common body
plan. Comparison with the urchin networks may point to deuterostome-specific
traits.
| ACKNOWLEDGMENTS |
|---|
| Footnotes |
|---|
Present address: Department of Biochemistry and Molecular Biophysics,
Columbia University Medical Center, New York, NY 10032, USA ![]()
| REFERENCES |
|---|
|
|
|---|
Angerer, L. M., Newman, L. A. and Angerer, R. C.
(2005). SoxB1 downregulation in vegetal lineages of sea urchin
embryos is achieved by both transcriptional repression and selective protein
turnover. Development
132,999
-1008.
Bertrand, V., Hudson, C., Caillol, D., Popovici, C. and Lemaire, P. (2003). Neural tissue in ascidian embryos is induced by FGF9/16/20, acting via a combination of maternal GATA and Ets transcription factors. Cell 115,615 -627.[CrossRef][Medline]
Chabry, L. M. (1887). Contributions a l'embryologie normale tératologique des ascidies simples. J. Anat. Physiol. Norm. Pathol. 23,167 -321.
Conklin, E. G. (1905). Mosaic development in ascidian eggs. J. Exp. Zool. 2, 145-223.[CrossRef]
Corbo, J. C., Levine, M. and Zeller, R. W. (1997). Characterization of a notochord-specific enhancer from the Brachyury promoter region of the ascidian, Ciona intestinalis. Development 124,589 -602.
DasGupta, R., Kaykas, A., Moon, R. T. and Perrimon, N.
(2005). Functional genomic analysis of the Wnt-wingless signaling
pathway. Science 308,826
-833.
Dehal, P., Satou, Y., Campbell, R. K., Chapman, J., Degnan, B.,
De Tomaso, A., Davidson, B., Di Gregorio, A., Gelpke, M., Goodstein, D. M. et
al. (2002). The draft genome of Ciona intestinalis: insights
into chordate and vertebrate origins. Science
298,2157
-2167.
Duboc, V., Rottinger, E., Besnardeau, L. and Lepage, T. (2004). Nodal and BMP2/4 signaling organizes the oral-aboral axis of the sea urchin embryo. Dev. Cell 6, 397-410.[CrossRef][Medline]
Dupont, S., Zacchigna, L., Cordenonsi, M., Soligo, S., Adorno, M., Rugge, M. and Piccolo, S. (2005). Germ-layer specification and control of cell growth by Ectodermin, a Smad4 ubiquitin ligase. Cell 121,87 -99.[CrossRef][Medline]
Erives, A., Corbo, J. C. and Levine, M. (1998). Lineage-specific regulation of the Ciona snail gene in the embryonic mesoderm and neuroectoderm. Dev. Biol. 194,213 -225.[CrossRef][Medline]
Gillis, W. J., Bowerman, B. and Schneider, S. Q. (2007). Ectoderm- and endomesoderm-specific GATA transcription factors in the marine annelid Platynereis dumerilli. Evol. Dev. 9,39 -50.[Medline]
Goldstein, B. and Freeman, G. (1997). Axis specification in animal development. BioEssays 19,105 -116.[CrossRef][Medline]
Heasman, J. (2006a). Maternal determinants of embryonic cell fate. Semin. Cell Dev. Biol. 17, 93-98.[CrossRef][Medline]
Heasman, J. (2006b). Patterning the early
Xenopus embryo. Development
133,1205
-1217.
Hinman, V. F., Nguyen, A. T., Cameron, R. A. and Davidson, E.
H. (2003). Developmental gene regulatory network architecture
across 500 million years of echinoderm evolution. Proc. Natl. Acad.
Sci. USA 100,13356
-13361.
Houston, D. W. and Wylie, C. (2005). Maternal
Xenopus Zic2 negatively regulates Nodal-related gene expression
during anteroposterior patterning. Development
132,4845
-4855.
Hudson, C. and Lemaire, P. (2001). Induction of anterior neural fates in the ascidian Ciona intestinalis. Mech. Dev. 100,189 -203.[CrossRef][Medline]
Hudson, C. and Yasuo, H. (2006). A signalling
relay involving Nodal and Delta ligands acts during secondary notochord
induction in Ciona embryos. Development
133,2855
-2864.
Hudson, C., Darras, S., Caillol, D., Yasuo, H. and Lemaire,
P. (2003). A conserved role for the MEK signalling pathway in
neural tissue specification and posteriorisation in the invertebrate chordate,
the ascidian Ciona intestinalis. Development
130,147
-159.
Imai, K. S. (2003). Isolation and characterization of beta-catenin downstream genes in early embryos of the ascidian Ciona savignyi. Differentiation 71,346 -360.[CrossRef][Medline]
Imai, K., Takada, N., Satoh, N. and Satou, Y. (2000). (beta)-catenin mediates the specification of endoderm cells in ascidian embryos. Development 127,3009 -3020.[Abstract]
Imai, K. S., Satoh, N. and Satou, Y. (2002). An essential role of a FoxD gene in notochord induction in Ciona embryos. Development 129,3441 -3453.[Medline]
Imai, K. S., Hino, K., Yagi, K., Satoh, N. and Satou, Y.
(2004). Gene expression profiles of transcription factors and
signaling molecules in the ascidian embryo: towards a comprehensive
understanding of gene networks. Development
131,4047
-4058.
Imai, K. S., Levine, M., Satoh, N. and Satou, Y.
(2006). Regulatory blueprint for a chordate embryo.
Science 312,1183
-1187.
Koide, T., Hayata, T. and Cho, K. W. (2005).
Xenopus as a model system to study transcriptional regulatory networks.
Proc. Natl. Acad. Sci. USA
102,4943
-4948.
Kourakis, M. J. and Smith, W. C. (2005). Did the first chordates organize without the organizer? Trends Genet. 21,506 -510.[CrossRef][Medline]
Kowalevsky, A. (1866). Entwicklungsgeschichte der einfachen Ascidien. Mem. Acad. Sci. St Petersbourg 10, 1-19.
Kowalevsky, A. O. (1871). Weitere Studien über die Entwicklung der einfachen Ascidien. Arch. Mikrosc. Anat. 7,101 -130.
Lamy, C., Rothbacher, U., Caillol, D. and Lemaire, P.
(2006). Ci-FoxA-a is the earliest zygotic determinant of the
ascidian anterior ectoderm and directly activates Ci-sFRP1/5.
Development 133,2835
-2844.
Loose, M. and Patient, R. (2004). A genetic regulatory network for Xenopus mesendoderm formation. Dev. Biol. 271,467 -478.[CrossRef][Medline]
Maki, K., Arai, H., Waga, K., Sasaki, K., Nakamura, F., Imai,
Y., Kurokawa, M., Hirai, H. and Mitani, K. (2004).
Leukemia-related transcription factor TEL is negatively regulated through
extracellular signal-regulated kinase-induced phosphorylation. Mol.
Cell. Biol. 24,3227
-3237.
Miller, J. R., Rowning, B. A., Larabell, C. A., Yang-Snyder, J.
A., Bates, R. L. and Moon, R. T. (1999). Establishment of the
dorsal-ventral axis in Xenopus embryos coincides with the dorsal enrichment of
dishevelled that is dependent on cortical rotation. J. Cell
Biol. 146,427
-437.
Nishida, H. (1987). Cell lineage analysis in ascidian embryos by intracellular injection of a tracer enzyme. III. Up to the tissue restricted stage. Dev. Biol. 121,526 -541.[CrossRef][Medline]
Nishida, H. (1997a). Cell lineage and timing of fate restriction, determination and gene expression in ascidian embryos. Semin. Cell Dev. Biol. 8, 359-365.[CrossRef][Medline]
Nishida, H. (1997b). Cell fate specification by localized cytoplasmic determinants and cell interactions in ascidian embryos. Int. Rev. Cytol. 176,245 -306.[Medline]
Nishida, H. (2005). Specification of embryonic axis and mosaic development in ascidians. Dev. Dyn. 233,1177 -1193.[CrossRef][Medline]
Nishida, H. and Satoh, N. (1985). Cell lineage analysis in ascidian embryos by intracellular injection of a tracer enzyme. II. The 16- and 32-cell stages. Dev. Biol. 110,440 -454.[CrossRef][Medline]
Nishida, H. and Sawada, K. (2001). macho-1 encodes a localized mRNA in ascidian eggs that specifies muscle fate during embryogenesis. Nature 409,724 -729.[CrossRef][Medline]
Nüsslein-Volhard, C. (1995). The identification of genes controlling development in flies and fishes. In Nobel Lectures, Physiology or Medicine 1991-1995 (ed. N. Ringertz), pp. 285-306. Singapore: World Scientific.
Partington, G. A., Bertwistle, D., Nicolas, R. H., Kee, W. J., Pizzey, J. A. and Patient, R. K. (1997). GATA-2 is a maternal transcription factor present in Xenopus oocytes as a nuclear complex which is maintained throughout early development. Dev. Biol. 181,144 -155.[CrossRef][Medline]
Patient, R. K. and McGhee, J. D. (2002). The GATA family (vertebrates and invertebrates). Curr. Opin. Genet. Dev. 12,416 -422.[CrossRef][Medline]
Rebay, I. and Rubin, G. M. (1995). Yan functions as a general inhibitor of differentiation and is negatively regulated by activation of the Ras1/MAPK pathway. Cell 81,857 -866.[CrossRef][Medline]
Rothbächer, U., Laurent, M. N., Deardorff, M. A., Klein, P. S., Cho, K. W. and Fraser, S. E. (2000). Dishevelled phosphorylation, subcellular localization and multimerization regulate its role in early embryogenesis. EMBO J. 19,1010 -1022.[CrossRef][Medline]
Ruvinsky, I., Silver, L. M. and Ho, R. K. (1998). Characterization of the zebrafish tbx16 gene and evolution of the vertebrate T-box family. Dev. Genes Evol. 208,94 -99.[CrossRef][Medline]
Satou, Y., Imai, K. S. and Satoh, N. (2001). Action of morpholinos in Ciona embryos. Genesis 30,103 -106.[CrossRef][Medline]
Schier, A. F. and Talbot, W. S. (2005). Molecular genetics of axis formation in zebrafish. Annu. Rev. Genet. 39,561 -613.[CrossRef][Medline]
Tassy, O., Daian, F., Hudson, C., Bertrand, V. and Lemaire, P. (2006). A quantitative approach to the study of cell shapes and interactions during early chordate embryogenesis. Curr. Biol. 16,345 -358.[CrossRef][Medline]
Weitzel, H. E., Illies, M. R., Byrum, C. A., Xu, R.,
Wikramanayake, A. H. and Ettensohn, C. A. (2004).
Differential stability of beta-catenin along the animal-vegetal axis of the
sea urchin embryo mediated by dishevelled. Development
131,2947
-2956.
Yagi, K., Satou, Y. and Satoh, N. (2004). A
zinc finger transcription factor, ZicL, is a direct activator of Brachyury in
the notochord specification of Ciona intestinalis.
Development 131,1279
-1288.
Yamada, L., Kobayashi, K., Satou, Y. and Satoh, N. (2005). Microarray analysis of localization of maternal transcripts in eggs and early embryos of the ascidian, Ciona intestinalis. Dev. Biol. 284,536 -550.[Medline]
Yoshida, S., Marikawa, Y. and Satoh, N. (1998). Regulation of the trunk-tail patterning in the ascidian embryo: a possible interaction of cascades between lithium/beta-catenin and localized maternal factor pem. Dev. Biol. 202,264 -279.[CrossRef][Medline]
Zhang, C., Basta, T., Hernandez-Lagunas, L., Simpson, P., Stemple, D. L., Artinger, K. B. and Klymkowsky, M. W. (2004). Repression of nodal expression by maternal B1-type SOXs regulates germ layer formation in Xenopus and zebrafish. Dev. Biol. 273, 23-37.[CrossRef][Medline]
Related articles in Development:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||