First published online October 26, 2007
doi: 10.1242/10.1242/dev.009167
Development 134, 4033-4041 (2007)
Published by The Company of Biologists 2007
FGF signaling acts upstream of the NOTCH and WNT signaling pathways to control segmentation clock oscillations in mouse somitogenesis
Matthias B. Wahl1,
Chuxia Deng2,
Mark Lewandoski3 and
Olivier Pourquié1,4,*
1 Stowers Institute for Medical Research, Kansas City, MO 64110, USA.
2 Genetics of Development and Diseases Branch, National Institutes of Diabetes
and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD
20892, USA.
3 Laboratory of Cancer and Developmental Biology, NCI-Frederick, National
Institutes of Health, Frederick, MD 21702, USA.
4 Howard Hughes Medical Institute, Kansas City, MO 64110, USA.
*
Author for correspondence (e-mail:
olp{at}stowers-institute.org)
Accepted 23 August 2007
 |
SUMMARY
|
|---|
Fibroblast growth factor (FGF) signaling plays a crucial role in vertebrate
segmentation. The FGF pathway establishes a posterior-to-anterior signaling
gradient in the presomitic mesoderm (PSM), which controls cell maturation and
is involved in the positioning of segmental boundaries. In addition, FGF
signaling was shown to be rhythmically activated in the PSM in response to the
segmentation clock. Here, we show that conditional deletion of the FGF
receptor gene Fgfr1 abolishes FGF signaling in the mouse PSM,
resulting in an arrest of the dynamic cyclic gene expression and ultimately
leading to an arrest of segmentation. Pharmacological treatments disrupting
FGF signaling in the PSM result in an immediate arrest of periodic WNT
activation, whereas NOTCH-dependent oscillations stop only during the next
oscillatory cycle. Together, these experiments provide genetic evidence for
the role of FGF signaling in segmentation, and identify a signaling hierarchy
controlling clock oscillations downstream of FGF signaling in the mouse.
Key words: FGF, Somite, Segmentation, Clock, Oscillation, Vertebra
 |
INTRODUCTION
|
|---|
The striking segmented pattern of the human spine is established during
embryogenesis when somites are rhythmically added to the forming posterior
part of the embryo. Current models of somitogenesis are based on the clock and
wavefront model in which a temporal periodicity generated by the clock in
presomitic mesoderm (PSM) cells is translated into the periodic array of
somites at the wavefront level (Cooke and
Zeeman, 1976
; Pourquie,
2003
). In the mouse, the clock is a molecular oscillator driving
periodic pulses of notch, fibroblast growth factor (FGF) and Wnt signaling in
the PSM, with a periodicity matching that of somite production
(Aulehla et al., 2003
;
Dequeant et al., 2006
;
Palmeirim et al., 1997
). The
wavefront has been shown to involve a posterior gradient of Wnt and FGF/MAPK
activity opposed to a retinoic acid (RA) gradient, which regresses posteriorly
in concert with the formation of posterior structures
(Aulehla et al., 2003
;
Diez del Corral and Storey,
2004
; Dubrulle et al.,
2001
; Dubrulle and Pourquie,
2004b
; Sawada et al.,
2001
). This traveling gradient defines a threshold of FGF
signaling (the determination front) in the PSM, below which cells become
competent to respond to the clock signal
(Dubrulle and Pourquie,
2004a
). When cells reach the anterior PSM, the FGF-mediated
repression is relieved, allowing activation of genes controlling the
segmentation program, such as Mesp2, in response to the clock signal
(Delfini et al., 2005
). In this
model, the size of a segment depends on the distance traveled by the wavefront
during one oscillation cycle. Therefore, interference with the FGF gradient
results in modification of somite size
(Diez del Corral et al., 2003
;
Dubrulle et al., 2001
;
Sawada et al., 2001
;
Vermot and Pourquie, 2005
).
Thus far, this model is based essentially on gain-of-function experiments or
pharmacological blockade of the FGF/MAPK pathway in chick, frog and fish
(Diez del Corral et al., 2003
;
Dubrulle et al., 2001
;
Sawada et al., 2001
;
Vermot and Pourquie, 2005
). No
direct genetic evidence for the clock and wavefront model has been provided,
partly due to the fact that the FGF pathway is required during gastrulation.
Thus, null mutation of genes, such as Fgf8 or Fgfr1 in the
mouse, results in a severe gastrulation defect and the quasi absence of
paraxial mesoderm, thus precluding studies of the segmentation process
(Deng et al., 1994
;
Sun et al., 1999
). Here, we
analyze the effect of a conditional deletion in the mesoderm of
Fgfr1, the only FGF receptor expressed in the mouse paraxial
mesoderm. We show that this mutation disrupts normal cyclic gene expression in
the PSM and results in abnormal segmentation of somites and vertebrae. Also,
we observe that inhibition of the FGF/MAPK pathway in cultured mouse embryos
blocks oscillations of the Wnt and Notch cyclic genes with
different kinetics. These experiments provide genetic evidence for the role of
FGF signaling in positioning the determination front in mouse, and suggest
that FGF acts upstream of the Wnt and Notch pathways to control the
segmentation clock oscillations.
 |
MATERIALS AND METHODS
|
|---|
Generation of mutant embryos
Males carrying one conditional allele for Fgfr1
(Fgfr1f/+) (Xu et al.,
2002
) and positive for the T-Cre transgene
(Perantoni et al., 2005
) (both
on a C57BL/6 genetic background) were mated to homozygous floxed
Fgfr1 females (Fgfr1f/f) in order to generate
Fgfr1f/f;T-Cre progeny. To analyze the status of RA
signaling, mice were crossed to the RARE (also known as
Rare1 - Mouse Genome Informatics)-lacZ mice
(Rossant et al., 1991
) and
ß-gal staining was performed using X-Gal as substrate. The floxed
Fgfr1 allele was genotyped using primer F: CTGGTATCCTGTGCCTATC and
primer R: CAATCTGAT CCCAAGACCAC; T-Cre using primer F:
CCTCATCCCGATCTCGGTGCTCCTT and primer R: GCCTGGCGATCCCTGAACATGTCCA; and
RARE-lacZ mice using primer F: TGGCGTTACCCAACTTAATCG and primer R:
ACGAGGACAGTATCGGCCTC.
Mouse tail culture
E9.5 embryo tails were cultured in 10% FBS in DMEM-F12 or 50% rat serum in
DMEM-F12 at 37°C in 5% CO2
(Correia and Conlon, 2000
)
either in 0.1% DMSO or in the presence of the pharmaceutical inhibitors U0126,
100 µM (Promega) or SU5402, 100 µM (Pfizer) in 0.1% DMSO. Explants were
cultured for periods ranging from 1-6 hours and were then fixed in 4%
formaldehyde and processed for in situ hybridization.

View larger version (55K):
[in this window]
[in a new window]
|
Fig. 1. Expression of Fgf ligands. In situ hybridization for
(A) Fgf3, (B) Fgf4,(C) Fgf8,
(D) Fgf17 and (E) Fgfr1, in E9.0 embryos.
Fgf3, Fgf8 and Fgf17 are expressed in a gradient in the
posterior PSM. Fgf4 expression is restricted to a small cell
population in the tail bud, which also expresses the other FGF ligands.
|
|

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 2. Progressive disruption of segmentation in the
Fgfr1f/f;T-Cre mutant embryos. (A,B)
Skeletons stained with Alizarin Red (bone) and Alcian Blue (cartilage).
(C-H) Uncx4.1 staining in Fgfr1f/+;T-Cre
control (C,E,G) and Fgfr1f/f;T-Cre mutant embryos (D,F,H);
C and D show whole mounts of E9.5 embryos and E and F are higher
magnifications of the somite region at E10.0. (G,H) Sagittal sections through
Uncx4.1-stained embryos. The posterior-most Uncx4.1-positive
region is shown at the same magnification for both. In the
Fgfr1f/f;T-Cre mutant embryos (H), somites fail to
separate and a giant somite spanning over the region normally covering two
somites is formed. Arrowheads indicate the boundaries between somites.
|
|
Real-time PCR
RNA from the posterior region of E8.5 mouse tails at the 5- to 9-somite
stage was extracted using Trizol reagent (Invitrogen). Embryos were cut in the
middle of the PSM and the posterior part was used for RNA isolation and the
remaining embryo was subject to genotyping. cDNA was synthesized using
SuperScript II (Invitrogen) and for each gene, three independent real-time PCR
reactions (each in duplicate) were performed using TaqMan (7900 Fast System,
Applied Biosystems) with probes for Hprt (Mm01545399_m1),
Erm (Mm00465816_m1) and Pea3 (Mm00465816_m1).
Skeletal examination
Preparation of skeletons and staining with Alizarin Red (bone) and Alcian
Blue (cartilage) were performed as described previously
(Kessel et al., 1990
).
In situ hybridization
In situ hybridization was performed as described previously
(Henrique et al., 1995
). All
probes for in situ hybridization were either amplified by RT-PCR
[Fgfr1 (primer F: ATGCACTCCCATCCTCGGAA, primer R:
GGATCTGGACATACGGCAAG and primer F: GGTCTTAGGCAAACCACTTG, primer R:
CCTAAACAGAAACCTCACGG); Msgn1 (primer F: ATGGACAACCTGGGTGAGAC, primer
R: TCACACACTCTGTGGCCTGG); Paraxis (primer F: TGCTGAGCGAGGACGAGGAGAA,
primer R: CCTCCCCGATTTGCTCACAT); Raldh2 (primer F:
ACTCAGAGAGTGGGAGAGTG, primer R: AATGAAGAAGCCCTTCCTTC); Sox2 (primer
F: CCCAGCGCCCGCATGTATAA, primer R: TCCCCTTCTCCAGTTCGCAG); Spry2
(primer F: GGAAAGAAGGAAAAAGTTTGCATCA, primer R: TTTTTACAACGACAACCCGG);
Sef (primer F: CAGGAACAGCGGACTGCACA; primer R: GCCACAGAAATCTTGCAGGA)]
or have been previously described in the literature (Axin2, Cyp26,
Dkk1-intronic, Dll1, Dll3, Dusp6, Erm, Fgf3, Fgf4, Fgf8, Fgf17, Gbx2,
Lfng, Lfng-intronic, Mesp2, Notch1, Pea3, Shh, Snail1, T, Uncx4.1,
Wnt3a). Mouse Genome Informatics lists some of the above genes with
different names and symbols; they are, Paraxis as Tcf15,
Raldh2 as Aldh1a2, Sef as Il17rd, Cyp26 as Cyp26a1,
Erm as Etv5 and Pea3 as Etv3.
 |
RESULTS
|
|---|
Conditional deletion of Fgfr1 in the paraxial mesoderm disrupts segmentation
A difficulty in genetically studying FGF loss of function is the high
redundancy of FGF pathway members. For example, the genes coding for the FGF
ligands Fgf3, Fgf4, Fgf8 and Fgf17, are expressed in the
mouse PSM or its precursors in the primitive streak and tail bud
(Crossley and Martin, 1995
;
Mansour et al., 1993
;
Maruoka et al., 1998
;
Niswander and Martin, 1992
).
Accordingly, conditional deletion of Fgf8 in the primitive streak
and/or PSM does not lead to a segmentation phenotype, suggesting that these
other ligands might act redundantly in this process
(Perantoni et al., 2005
).
Here, we have carefully compared the expression of Fgf3, Fgf4 and
Fgf17 to that of Fgf8 in the mouse PSM
(Fig. 1A-D). We observed that
only Fgf4 is not expressed in a gradient in the posterior PSM
(Fig. 1B). Fgf4
expression is restricted to a small cell population in the tail bud, which
also expresses the other FGF ligands. By contrast, Fgfr1 is the only
known FGF receptor we could detect by in situ hybridization in the PSM
(Fig. 1E). Since mice
homozygous for a null Fgfr1 allele do not form PSM or somites because
of a gastrulation defect (Deng et al.,
1994
), we used a conditional Fgfr1 allele in which exons
9-13 are flanked by LoxP sites (Xu et al.,
2002
). This mouse line was crossed to the T-Cre line in
which Cre is controlled by the T primitive streak enhancer,
which promotes recombination in most primitive streak descendants including
somites, PSM and tail bud (data not shown)
(Perantoni et al., 2005
).
Fetuses homozygous for the floxed allele of Fgfr1 and positive for
the T-Cre transgene (hereafter called
Fgfr1f/f;T-Cre) survive up to birth, but die neonatally.
Skeletal preparations from Fgfr1f/f;T-Cre fetuses and
neonates clearly showed, in all specimens, axial truncations in the sacral and
tail regions, whereas the anterior segments were formed
(Fig. 2A,B). We also observed
rudimentary hind limbs as previously reported (data not shown)
(Verheyden et al., 2005
).
Although cervical vertebrae appeared to be normal, more posteriorly, vertebrae
and ribs became progressively fused (Fig.
2B and data not shown). Irregular skeletal elements corresponding
to fused lumbar and sacral vertebral elements were present, but the caudal
region did not form. These observations are consistent with a progressive
disruption of the segmentation process in Fgfr1f/f;T-Cre
mutants.

View larger version (114K):
[in this window]
[in a new window]
|
Fig. 3. Expression of different marker genes in E9.0
Fgfr1f/f;T-Cre mutant embryos. Expression of
(A,B) Sox2, (C,D) Wnt3a,
(E,F) T,(G,H)
Uncx4.1/Msgn1,(I,J) Fgf8,(K,L)
Dll1,(M,N) Notch1,(O,P)
Dll3, (Q,R) Paraxis and (S,T)
Mesp2 in Fgfr1f/+;T-Cre control and
Fgfr1f/f;T-Cre mutant embryos, respectively.
|
|
To trace the origin of these defects, we analyzed segmentation in detail in
mutant embryos between E8.5 and E10.5. Somite formation was first examined
using the Uncx4.1 probe which marks the posterior compartment of
formed somites (Mansouri et al.,
1997
). Whereas approximately the first 10-13 somites appeared
relatively normal in the mutant embryos
(Fig. 2C-F and data not shown),
larger irregular somites were often seen in Fgfr1f/f;T-Cre
embryos at the level of somites 10-15 (n=6/6;
Fig. 2G,H, arrowheads).
Surprisingly, Uncx4.1 expression was not always found in the
posterior compartment of these larger somites
(Fig. 2H). Posterior to this
region, no clear segmented structures were observed
(Fig. 2D,F and data not shown),
and the region appeared abnormal, with an enlarged neural tube expressing
Sox2 and a thinner PSM (Fig.
3A,B and data not shown). Shh expression was weaker, but
nevertheless detected all along the notochord and the floor plate, suggesting
a normal differentiation of axial structures (data not shown). Wnt3a
expression was maintained in the tail bud
(Fig. 3C,D), and its downstream
targets involved in PSM patterning, including T
(Fig. 3E,F), Msgn1
(Fig. 3G,H), Fgf8
(Fig. 3I,J) and Dll1
(Fig. 3K,L) were expressed in
the posterior PSM. The expression domain of Msgn1 was, nevertheless,
much smaller than in wild-type embryos and was confined to the posterior-most
region of the PSM (Fig. 3G,H).
Dll1 is normally expressed in an anterior-to-posterior gradient in
the PSM (Fig. 3K) but in the
mutant embryos, the expression gradient was reversed, with the strongest
expression found in the tail bud (Fig.
3L), suggesting that FGF represses Dll1 transcription.
Mesp2, which marks the future segment territory at the determination
front level was severely downregulated in the region failing to form somites
in the mutants (Fig. 3S,T).
Interestingly, the somitic marker Uncx4.1 is nevertheless expressed
in the posterior unsegmented region, indicating that paraxial mesoderm
maturation still proceeds in the absence of somite formation
(Fig. 2D,F).

View larger version (125K):
[in this window]
[in a new window]
|
Fig. 4. Progressive downregulation of FGF target genes in
Fgfr1f/f;T-Cre mutant embryos after the 6-somite
stage. (A-D) Pea3 is normally expressed in control (A) and
Fgfr1f/f;T-Cre (B) embryos at the 5-somite stage, and in
7-somite control embryos (C), but it becomes progressively downregulated in
the posterior PSM/tail bud of 7-somite Fgfr1f/f;T-Cre
mutant embryos (D). (E) Real-time PCR for FGF target genes Erm
and Pea3 in the posterior tail of Fgfr1f/f;T-Cre
mutant embryos and Fgfr1f/+;T-Cre control embryos at
somite stages 5 (n=1/1), 6 (n=3/5), 7 (n=2/2) and 9
(n=1/1). Both genes become progressively downregulated from somite
stages 6 onward. Levels of Erm and Pea3 were normalized to
the housekeeping gene Hprt and values are given as the mean change in
crossing points (CT) in Fgfr1f/f; T-Cre mutant
embryos. (F-O) For other target genes (F,G) Erm, (H,I)
Gbx2, (J,K) Dusp6, (L,M) Spry2 and (N,O)
Sef, the expression in the posterior PSM and the tail bud of E8.75
Fgfr1f/f;T-Cre mutant embryos is lost, whereas the
expression in the anterior PSM and the adjacent structures is normal.
|
|
To relate the somitogenesis defect to FGF activation, we first carefully
mapped the timing of loss of FGF signaling in the conditional mutants by in
situ hybridization for the known FGF target Pea3
(Fig. 4A-D)
(Chotteau-Lelievre et al.,
2001
). Between the 5- to 7-somite stage, the expression level of
Pea3 became strongly downregulated in the posterior PSM and tail bud,
suggesting that FGF signaling in the posterior paraxial mesoderm begins to
decrease around this time (Fig.
4A-D and data not shown). To confirm this, we analyzed the
expression levels of the two FGF target genes Pea3 and Erm
in the posterior embryo, including the posterior PSM and the tail bud, by
quantitative real-time PCR. Expression of these genes decreased progressively
from the 5-somite stage onward (Fig.
4E). We also analyzed the expression of other known FGF target
genes including Erm, Gbx2, Dusp6, Spry2 and Sef by in situ
hybridization and observed that they are also downregulated in the posterior
PSM and tail bud of Fgfr1f/f;T-Cre embryos after the 5- to
8-somite stage (Fig. 4F-O).
Together, this suggests that FGF signaling becomes progressively downregulated
in the paraxial mesoderm posterior to somite 5, approximately. These
observations indicate that the progressive failure of somite boundary
formation in these mutants parallels the progressive loss of FGF signaling in
the forming PSM.

View larger version (104K):
[in this window]
[in a new window]
|
Fig. 5. FGF signaling is not sufficient to position the RA-responsive domain in
the PSM. (A,B) Cyp26 expression in the posterior
region of the Fgfr1f/f;T-Cre (B) mutant is downregulated
compared with that in Fgfr1f/+;T-Cre control (A) embryos.
(C,D) There is a lack of significant change in RA activity, as
detected by crossing to RARE-lacZ reporter mice, in
Fgfr1f/f;T-Cre mutant (D) compared with the
Fgfr1f/+;T-Cre control (C) embryos. (E,F)
Expression of Raldh2 is not significantly changed in the PSM of
Fgfr1f/f;T-Cre mutant embryos (F) compared with control
Fgfr1f/+;T-Cre (E) embryos.
|
|
Loss of FGF signaling does not alter the positioning of the RA-responsive domain in the PSM but disrupts cyclic gene oscillations
The posterior FGF signaling gradient has been shown to be antagonized by an
opposing RA gradient resulting from the production of RA by its biosynthetic
enzyme RALDH2 in the segmented region of the embryo
(Diez del Corral et al.,
2003
). In Fgfr1f/f;T-Cre embryos, expression
of the transcript for the RA-degrading enzyme Cyp26 that is normally found in
the tail bud region, is strongly downregulated
(Fig. 5A,B). This is expected
to lead to a gain of function of RA signaling and hence, a posterior extension
of the RA-responsive domain. However, no significant difference in the
positioning of the RA-responsive domain was detected between the wild-type and
mutant mice using the RARE-lacZ mouse reporter
(Rossant et al., 1991
)
(Fig. 5C,D). Consistently,
expression of genes normally expressed in the RA-responsive domain, such as
Paraxis (Fig. 3Q,R) or
Raldh2 (Fig. 5E,F) was
not significantly disrupted in the Fgfr1f/f;T-Cre embryos.
A progressive shrinking of the Msgn1-positive,
Uncx4.1-negative domain in the posterior PSM is nevertheless observed
after the E9.5-somite stage (compare the posterior Uncx4.1-negative
domain in Fig. 2E,F, or the
size of the Msgn1 domain in Fig.
3G,H). Therefore, FGF signaling is not necessary to position the
RA-responsive domain in the anterior PSM.
Oscillations of FGF signaling targets, such as Spry2 in the mouse
PSM, have recently implicated this pathway in the segmentation clock
mechanism, and this pulse of FGF signaling occurs in phase with Notch
signaling (Dequeant et al.,
2006
). However, in chick embryo cultures, short-term treatments
with pharmacological inhibitors of FGF signaling or the MAPK pathway do not
block oscillations of the Notch cyclic genes
(Delfini et al., 2005
;
Dubrulle et al., 2001
), and
Spry2 expression remains dynamic in the mouse Notch mutant for
RBPjk9 (also known as Rbpj -Mouse Genome Informatics)
(Dequeant et al., 2006
). This
suggests that whereas NOTCH and FGF oscillate synchronously, their
oscillations are controlled largely independently. To evaluate this further,
we examined the expression of cyclic genes in
Fgfr1f/f;T-Cre mutant embryos. Prior to the 8-somite stage
when FGF signaling is maintained in the posterior PSM of
Fgfr1f/f;T-Cre mutant embryos, the NOTCH cyclic gene
Lfng, the WNT cyclic genes Dkk1 and Axin2, as well
as the FGF cyclic genes Spry2 and Snail1, show different
expression patterns, suggesting that the clock function is essentially normal
(data not shown). However, in embryos with more than 10 somites, all cyclic
genes show abnormal expression patterns
(Fig. 6A-H). Lfng
(n=15, Fig. 6B),
intronic Lfng (n=4, data not shown) and Spry2
(n=10, Fig. 6D)
display an anterior-to-posterior expression gradient with no expression in the
tail bud. Axin2 (n=18,
Fig. 6F), Dkk1
(n=7, data not shown) and Snail1 (n=4,
Fig. 6H) have an opposite
expression pattern, with strong staining in the tail bud but virtually no
expression in the PSM. Disruption of the NOTCH cyclic gene oscillations is
accompanied by abnormal expression in the PSM of several genes of the NOTCH
pathway including Dll1 (Fig.
3K,L), Dll3 (Fig.
3O,P) and Notch1 (Fig.
3M,N). Both Notch1 and Dll1 are upregulated in
the tail bud and posterior PSM, while Dll3 is severely downregulated,
showing a faint `salt-and-pepper' expression
(Fig. 3O,P). Therefore, FGF
signaling is required for oscillations of cyclic genes of the WNT, NOTCH and
FGF pathway in the PSM.
Pharmacological inhibition of FGF signaling in mouse embryos disrupts Wnt and Notch oscillations with different kinetics
To further confirm the disruption of cyclic gene oscillations in the
absence of FGF signaling, we cultured mouse tails in the presence of either
the FGF receptor 1 inhibitor SU5402
(Mohammadi et al., 1997
) or
the MKK1 inhibitor U0126 (DeSilva et al.,
1998
) (which blocks ERK phosphorylation) and analyzed the dynamic
expression of Spry2, Axin2 and Lfng
(Table 1 and data not shown).
We used two different culture conditions (i.e. hanging drop culture in 10% FBS
in DMEM-F12 or hanging drop culture in 50% rat serum in DMEM-F12) with E9.5
mouse tails (Correia and Conlon,
2000
) and examined, by in situ hybridization, the expression of
FGF target genes as a control for each batch of cultured embryos. As expected,
the FGF target Spry2 is rapidly downregulated in the posterior PSM
after SU5402 or U0126 treatment for 2 hours, whereas control tails cultured in
DMSO maintained dynamic expression patterns for Spry2 (n=18,
data not shown). Distinct patterns of Axin2 were evident in
DMSO-cultured control tails, but the expression of Axin2 in the PSM
of the treated embryos was downregulated after 2 hours in more than 80% of the
explants, whereas it was always expressed in the tail bud
(Table 1 and data not shown).
This rapid downregulation of Axin2 in the PSM, which occurs during
the first oscillation cycle after treatment, suggests that Axin2
might be directly regulated by FGF signaling through the MAPK pathway.
Strikingly, a different situation was observed for Lfng. Whereas no
significant change in expression was detected after 2 hours in culture, most
embryos treated with SU5402 or U0126 began to show a similar pattern after 3
hours, a time corresponding to one clock oscillation period in these culture
conditions (Table 1 and data
not shown). This pattern was evident as a single stripe located in the
anterior PSM and resembling phase III of the normal cycle
(Pourquie and Tam, 2001
) (data
not shown). Therefore, blocking FGF signaling in vitro using pharmacological
inhibitors disrupts the first cycle of Axin2 oscillations but acts
only after a one cycle delay on Lfng oscillations.
View this table:
[in this window]
[in a new window]
|
Table 1. Summary of the expression of FGF target genes in tail cultures in the
absence (DMSO control) and presence of either the FGFR1 inhibitor SU5402 or
the MAPK inhibitor U0126
|
|

View larger version (115K):
[in this window]
[in a new window]
|
Fig. 6. Disruption of cyclic gene expression in the
Fgfr1f/f;T-Cre mutant embryos. (A-H) Comparison
of expression of the cyclic genes of the Notch (Lfng), FGF
(Spry2, Snail1) and Wnt (Axin2) signaling pathways at stages
E8.75 (A-F) and E9.0 (G,H). All genes show dynamic expression in heterozygous
Fgfr1f/+;T-Cre control embryos (A,C,E,G). Oscillations in
Fgfr1f/f;T-Cre mutant embryos are lost (B,D,F,H). Lateral
views are shown for Fgfr1f/+;T-Cre in A,E,G and dorsal
views are shown in C. For Fgfr1f/f;T-Cre mutant (B,D,F,H),
a lateral view is shown in the left panels, whereas dorsal views are shown in
the right panels.
|
|
 |
DISCUSSION
|
|---|
Here, we show that a conditional deletion of Fgfr1, the only FGF
receptor expressed in the mouse PSM, blocks somite formation. Therefore, this
provides a genetic demonstration for the role of FGF signaling in vertebrate
segmentation. In the mutants, however, FGF signaling remains active during
formation of the first somites that appear essentially normal
(Fig. 2D,
Fig. 7). This delay is somehow
surprising because the T-Cre driver has been shown to be active from
the earliest stages of gastrulation
(Perantoni et al., 2005
). The
delayed progressive onset of the phenotypes observed could be explained by the
stability of the Fgfr1 transcript and protein. Following the
formation of the first five somites or so, gradual downregulation of the FGF
targets is observed in the PSM, indicating a progressive downregulation of the
pathway activation. In the mutants, however, the first 10-13 somites appear
essentially normal. In the mouse, the PSM contains around six presumptive
somites (Tam, 1986
), meaning
that the precursors of somites 10-13 were already located in the posterior PSM
when the downregulation of FGF signaling began. This suggests that enough FGF
signaling was still available to allow proper specification of these somites.
Posterior to somites 10-13, transient formation of a few larger irregular
somites was observed (Fig. 2H),
a phenotype similar to that observed in fish or chick following treatments
with drugs blocking FGF signaling, such as SU5402
(Dubrulle et al., 2001
;
Sawada et al., 2001
). Such a
phenotype is predicted by the clock and wavefront model, since downregulating
FGF signaling triggers a posterior shift of the wavefront, which is expected
to lead to the formation of larger somites
(Dubrulle and Pourquie,
2004a
). Surprisingly, Uncx4.1 whose expression is
normally restricted to the posterior compartment of the somites, was sometimes
found in the middle or in the anterior part of these larger somites,
supporting the idea that rostrocaudal patterning can be uncoupled from segment
formation (Nomura-Kitabayashi et al.,
2002
). No segments form posterior to the larger somites in mutant
embryos, despite the continuous production of paraxial mesoderm from the tail
bud. This paraxial mesoderm matures and differentiates into axial skeleton,
but no somite boundaries form, although some coarse segmental pattern of the
skeletal elements is, nevertheless, observed. This disruption of segmentation
follows the level where arrest of the oscillations of the segmentation clock
begins, further supporting the role of cyclic gene oscillations in the
segmentation process (Fig. 6).
Thus, our data provide genetic evidence for the role of FGF signaling in
controlling the wavefront progression, a process involved in somite boundary
positioning.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 7. Summary of the onset of the phenotypes observed in
Fgfr1f/f;T-Cre mutant embryos. FGF target genes become
downregulated in the posterior PSM of Fgfr1f/f;T-Cre
mutant embryos at the 5- to 7-somite stage, followed by the arrest of cyclic
gene expression between somites 8 and 10. Normal somites and corresponding
vertebrae elements are observed up to somites 10 to 13; however, abnormal
skeletal elements derived from paraxial mesoderm posterior to somite 13 were
present.
|
|
RALDH2, the RA biosynthetic enzyme, is expressed in the segmented region of
the embryo and establishes an anterior-to-posterior signaling gradient that is
involved in the control of cell differentiation and segmentation
(Diez del Corral and Storey,
2004
; Sirbu and Duester,
2006
; Vermot et al.,
2005
). In the mouse, expression of the RA-signaling reporter
RARE-lacZ is only detected in the anterior somites, suggesting that
the RA signaling only acts early in the embryo in anterior somite precursors
(Sirbu and Duester, 2006
;
Vermot et al., 2005
). This is
further supported by the fact that posterior somite formation in
Radlh2-null mutants can be rescued by early RA treatment
(Sirbu and Duester, 2006
).
However, these observations are difficult to reconcile with the fact that
expression of Raldh2 in the segmented region and of Cyp26 in
the tail bud extend all along the AP axis
(Fujii et al., 1997
;
Niederreither et al., 1997
).
Moreover, a Cyp26 null mutation in the mouse leads to axis truncation
at the lumbar level, suggesting that RA plays a role in the formation of
posterior somites as well (Sakai et al.,
2001
). In the chick embryo, FGF signaling has been shown to
antagonize the RA gradient and to maintain the undifferentiated state of cells
in the posterior part of the embryo throughout somitogenesis
(Diez del Corral and Storey,
2004
; Mathis et al.,
2001
; Vermot and Pourquie,
2005
). Experiments in chick and frog have led to the proposal that
in the PSM these mutually antagonistic gradients are necessary for the
appropriate positioning of the determination front
(Diez del Corral et al., 2003
;
Moreno and Kintner, 2004
;
Vermot and Pourquie, 2005
).
This hypothesis, however, is challenged by the observation that mouse
Raldh2 null mutants and vitamin A-deficient quail embryos (which
cannot synthesize RA) form smaller, yet reasonably normal somites
(Maden et al., 2000
;
Niederreither et al., 1999
).
Thus, in amniotes, RA signaling plays a role in refining the positioning of
the determination front but is not critically required for boundary formation.
Our results indicate that up to E9, the Raldh2- and the
RARE-lacZ-positive domains in the PSM are not significantly extended
posteriorly in Fgfr1 conditional mutants despite the absence of the
RA-degrading enzyme CYP26 in the posterior part of the embryo. This argues
that in contrast to the situation in chick and frog, in the mouse FGF
signaling antagonism is insufficient to explain the anterior positioning of
the RA signaling domain (Diez del Corral
et al., 2003
; Moreno and
Kintner, 2004
). WNT signaling has also been shown to establish a
posterior-to-anterior gradient that plays a role in the positioning of the
determination front in the mouse (Aulehla
et al., 2003
). In the conditional mutants, Wnt3a
(Fig. 3C,D) and its downstream
targets T (Fig. 3E,F)
and Axin2 (Fig. 6E,F)
are still expressed posteriorly, suggesting that WNT signaling is still active
in the PSM. Thus, WNT signaling could act redundantly with FGF signaling to
antagonize RA signaling in the PSM. Alternatively, the smaller somite size
observed in Raldh2 mutants has been proposed to result indirectly
from an early antagonistic effect of RA on FGF signaling in the node and
posterior neural plate (Sirbu and Duester,
2006
). Such an effect is likely to be intact in the Fgfr1
mutants, because the T promoter fragment does not drive expression in
the node at these stages, and thus could account for the lack of effect on the
positioning of the later RA domain seen in Fgfr1 conditional mutants
(Perantoni et al., 2005
).
Oscillations of downstream targets of FGF signaling, such as Spry2
or Dusp6 (Dequeant et al.,
2006
), combined with our observations that FGF signaling is
required for oscillations of cyclic genes of the WNT, NOTCH and FGF pathway in
the PSM, provide evidence for a cyclic activation of the pathway in the PSM.
On the other hand, graded distribution of the ligands and of the downstream
effectors such as phosphorylated ERK
(Delfini et al., 2005
;
Sawada et al., 2001
) and AKT
(Dubrulle and Pourquie, 2004b
)
shows that FGF signaling is also activated in a graded fashion along the PSM.
A similar situation is also observed for WNT signaling which was shown to be
periodically activated in the PSM and forms a signaling gradient in the tissue
(Aulehla et al., 2003
).
Although at first glance these observations seem difficult to reconcile,
several possible explanations can be envisioned to account for this situation.
First, it could be that the pathway shows an overall graded yet periodic
activation in the posterior PSM (Aulehla et
al., 2003
). These fluctuations could be sufficient to elicit
periodic transcript production, but not to be detected biochemically using
tools such as anti-phosphorylated ERK antibodies. We previously showed that
phosphorylated ERK is extremely unstable in the mouse embryo PSM and hence,
detecting small cyclic fluctuations might be technically very challenging
(Delfini et al., 2005
).
Alternatively, it could be that FGF signaling is distributed uniformly in a
graded fashion and is essentially required permissively for cyclic gene
oscillations and its periodic transcription would be controlled independently
of FGF signaling.
Oscillations of Lfng, Spry2 and Axin2 are also disrupted
in cultures of mouse tails in the presence of pharmacological inhibitors of
FGF signaling. In these experiments, the WNT cyclic gene Axin2 and
the FGF cyclic gene Spry2 are rapidly downregulated in the PSM after
inhibitor treatment, whereas Lfng expression continues to oscillate
for one cycle. The observation that Lfng oscillations are halted in
the vestigial tail mouse mutant led to the suggestion that in the
mouse, the WNT pathway acts upstream of NOTCH oscillations
(Aulehla et al., 2003
). These
data are therefore consistent with FGF indirectly controlling NOTCH
oscillations via the WNT pathway. In summary, these data provide direct
genetic evidence supporting the role of FGF signaling in the wavefront, which
is involved in positioning somite boundaries in the PSM and in establishing a
hierarchy in the NOTCH, WNT and FGF signaling pathways involved in the control
of oscillatory expression of cyclic genes in the PSM.
 |
ACKNOWLEDGMENTS
|
|---|
We thank members of the Pourquié lab for discussions and comments,
Stowers Institute Core Facilities, Joanne Chatfield for help on the manuscript
and Silvia Esteban for artwork. This work was supported by Stowers Institute
for Medical Research. O.P. is a Howard Hughes Medical Investigator.
 |
REFERENCES
|
|---|
Aulehla, A., Wehrle, C., Brand-Saberi, B., Kemler, R., Gossler,
A., Kanzler, B. and Herrmann, B. G. (2003). Wnt3a plays a
major role in the segmentation clock controlling somitogenesis.
Dev. Cell 4,395
-406.[CrossRef][Medline]
Chotteau-Lelievre, A., Dolle, P., Peronne, V., Coutte, L., de
Launoit, Y. and Desbiens, X. (2001). Expression patterns of
the Ets transcription factors from the PEA3 group during early stages of mouse
development. Mech. Dev.
108,191
-195.[CrossRef][Medline]
Cooke, J. and Zeeman, E. C. (1976). A clock and
wavefront model for control of the number of repeated structures during animal
morphogenesis. J. Theor. Biol.
58,455
-476.[CrossRef][Medline]
Correia, K. M. and Conlon, R. A. (2000).
Surface ectoderm is necessary for the morphogenesis of somites.
Mech. Dev. 91,19
-30.[CrossRef][Medline]
Crossley, P. H. and Martin, G. R. (1995). The
mouse Fgf8 gene encodes a family of polypeptides and is expressed in
regions that direct outgrowth and patterning in the developing embryo.
Development 121,439
-451.[Abstract]
Delfini, M. C., Dubrulle, J., Malapert, P., Chal, J. and
Pourquie, O. (2005). Control of the segmentation process by
graded MAPK/ERK activation in the chick embryo. Proc. Natl. Acad.
Sci. USA 102,11343
-11348.[Abstract/Free Full Text]
Deng, C. X., Wynshaw-Boris, A., Shen, M. M., Daugherty, C.,
Ornitz, D. M. and Leder, P. (1994). Murine FGFR-1 is required
for early postimplantation growth and axial organization. Genes
Dev. 8,3045
-3057.[Abstract/Free Full Text]
Dequeant, M. L., Glynn, E., Gaudenz, K., Wahl, M., Chen, J.,
Mushegian, A. and Pourquie, O. (2006). A complex oscillating
network of signaling genes underlies the mouse segmentation clock.
Science 314,1595
-1598.[Abstract/Free Full Text]
DeSilva, D. R., Jones, E. A., Favata, M. F., Jaffee, B. D.,
Magolda, R. L., Trzaskos, J. M. and Scherle, P. A. (1998).
Inhibition of mitogen-activated protein kinase kinase blocks T cell
proliferation but does not induce or prevent anergy. J.
Immunol. 160,4175
-4181.[Abstract/Free Full Text]
Diez del Corral, R. and Storey, K. G. (2004).
Opposing FGF and retinoid pathways: a signalling switch that controls
differentiation and patterning onset in the extending vertebrate body axis.
BioEssays 26,857
-869.[CrossRef][Medline]
Diez del Corral, R., Olivera-Martinez, I., Goriely, A., Gale,
E., Maden, M. and Storey, K. (2003). Opposing FGF and
retinoid pathways control ventral neural pattern, neuronal differentiation,
and segmentation during body axis extension. Neuron
40, 65-79.[CrossRef][Medline]
Dubrulle, J. and Pourquie, O. (2004a). Coupling
segmentation to axis formation. Development
131,5783
-5793.[Abstract/Free Full Text]
Dubrulle, J. and Pourquie, O. (2004b). fgf8
mRNA decay establishes a gradient that couples axial elongation to patterning
in the vertebrate embryo. Nature
427,419
-422.[CrossRef][Medline]
Dubrulle, J., McGrew, M. J. and Pourquie, O.
(2001). FGF signaling controls somite boundary position and
regulates segmentation clock control of spatiotemporal Hox gene activation.
Cell 106,219
-232.[CrossRef][Medline]
Fujii, H., Sato, T., Kaneko, S., Gotoh, O., Fujii-Kuriyama, Y.,
Osawa, K., Kato, S. and Hamada, H. (1997). Metabolic
inactivation of retinoic acid by a novel P450 differentially expressed in
developing mouse embryos. EMBO J.
16,4163
-4173.[CrossRef][Medline]
Henrique, D., Adam, J., Myat, A., Chitnis, A., Lewis, J. and
Ish-Horowicz, D. (1995). Expression of a Delta homologue in
prospective neurons in the chick. Nature
375,787
-790.[CrossRef][Medline]
Kessel, M., Balling, R. and Gruss, P. (1990).
Variations of cervical vertebrae after expression of a Hox-1.1 transgene in
mice. Cell 61,301
-308.[CrossRef][Medline]
Maden, M., Graham, A., Zile, M. and Gale, E.
(2000). Abnormalities of somite development in the absence of
retinoic acid. Int. J. Dev. Biol.
44,151
-159.[Medline]
Mansour, S. L., Goddard, J. M. and Capecchi, M. R.
(1993). Mice homozygous for a targeted disruption of the
proto-oncogene int-2 have developmental defects in the tail and inner ear.
Development 117,13
-28.[Abstract/Free Full Text]
Mansouri, A., Yokota, Y., Wehr, R., Copeland, N. G., Jenkins, N.
A. and Gruss, P. (1997). Paired-related murine homeobox gene
expressed in the developing sclerotome, kidney, and nervous system.
Dev. Dyn. 210,53
-65.[CrossRef][Medline]
Maruoka, Y., Ohbayashi, N., Hoshikawa, M., Itoh, N., Hogan, B.
L. and Furuta, Y. (1998). Comparison of the expression of
three highly related genes, Fgf8, Fgf17 and Fgf18, in the mouse embryo.
Mech. Dev. 74,175
-177.[CrossRef][Medline]
Mathis, L., Kulesa, P. M. and Fraser, S. E.
(2001). FGF receptor signalling is required to maintain neural
progenitors during Hensen's node progression. Nat. Cell
Biol. 3,559
-566.[CrossRef][Medline]
Mohammadi, M., McMahon, G., Sun, L., Tang, C., Hirth, P., Yeh,
B. K., Hubbard, S. R. and Schlessinger, J. (1997). Structures
of the tyrosine kinase domain of fibroblast growth factor receptor in complex
with inhibitors. Science
276,955
-960.[Abstract/Free Full Text]
Moreno, T. A. and Kintner, C. (2004).
Regulation of segmental patterning by retinoic acid signaling during Xenopus
somitogenesis. Dev. Cell
6, 205-218.[CrossRef][Medline]
Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P. and
Dolle, P. (1997). Restricted expression and retinoic
acid-induced downregulation of the retinaldehyde dehydrogenase type 2
(RALDH-2) gene during mouse development. Mech. Dev.
62, 67-78.[CrossRef][Medline]
Niederreither, K., Subbarayan, V., Dolle, P. and Chambon, P.
(1999). Embryonic retinoic acid synthesis is essential for early
mouse post-implantation development. Nat. Genet.
21,444
-448.[CrossRef][Medline]
Niswander, L. and Martin, G. R. (1992). Fgf-4
expression during gastrulation, myogenesis, limb and tooth development in the
mouse. Development 114,755
-768.[Abstract]
Nomura-Kitabayashi, A., Takahashi, Y., Kitajima, S., Inoue, T.,
Takeda, H. and Saga, Y. (2002). Hypomorphic Mesp
allele distinguishes establishment of rostrocaudal polarity and segment border
formation in somitogenesis. Development
129,2473
-2481.[Medline]
Palmeirim, I., Henrique, D., Ish-Horowicz, D. and
Pourquié, O. (1997). Avian hairy gene expression
identifies a molecular clock linked to vertebrate segmentation and
somitogenesiss. Cell 91,639
-648.[CrossRef][Medline]
Perantoni, A. O., Timofeeva, O., Naillat, F., Richman, C.,
Pajni-Underwood, S., Wilson, C., Vainio, S., Dove, L. F. and Lewandoski,
M. (2005). Inactivation of FGF8 in early mesoderm reveals an
essential role in kidney development. Development
132,3859
-3871.[Abstract/Free Full Text]
Pourquie, O. (2003). The segmentation clock:
converting embryonic time into spatial pattern.
Science 301,328
-330.[Abstract/Free Full Text]
Pourquie, O. and Tam, P. P. (2001). A
nomenclature for prospective somites and phases of cyclic gene expression in
the presomitic mesoderm. Dev. Cell
1, 619-620.[CrossRef][Medline]
Rossant, J., Zirngibl, R., Cado, D., Shago, M. and Giguere,
V. (1991). Expression of a retinoic acid response
element-hsplacZ transgene defines specific domains of transcriptional activity
during mouse embryogenesis. Genes Dev.
5,1333
-1344.[Abstract/Free Full Text]
Sakai, Y., Meno, C., Fujii, H., Nishino, J., Shiratori, H.,
Saijoh, Y., Rossant, J. and Hamada, H. (2001). The retinoic
acid-inactivating enzyme CYP26 is essential for establishing an uneven
distribution of retinoic acid along the anterio-posterior axis within the
mouse embryo. Genes Dev.
15,213
-225.[Abstract/Free Full Text]
Sawada, A., Shinya, M., Jiang, Y. J., Kawakami, A., Kuroiwa, A.
and Takeda, H. (2001). Fgf/MAPK signalling is a crucial
positional cue in somite boundary formation.
Development 128,4873
-4880.[Abstract/Free Full Text]
Sirbu, I. O. and Duester, G. (2006).
Retinoic-acid signalling in node ectoderm and posterior neural plate directs
left-right patterning of somitic mesoderm. Nat. Cell
Biol. 8,271
-277.[CrossRef][Medline]
Sun, X., Meyers, E. N., Lewandoski, M. and Martin, G. R.
(1999). Targeted disruption of Fgf8 causes failure of cell
migration in the gastrulating mouse embryo. Genes Dev.
13,1834
-1846.[Abstract/Free Full Text]
Tam, P. P. (1986). A study of the pattern of
prospective somites in the presomitic mesoderm of mouse embryos. J.
Embryol. Exp. Morphol. 92,269
-285.[Medline]
Verheyden, J. M., Lewandoski, M., Deng, C., Harfe, B. D. and
Sun, X. (2005). Conditional inactivation of Fgfr1 in
mouse defines its role in limb bud establishment, outgrowth and digit
patterning. Development
132,4235
-4245.[Abstract/Free Full Text]
Vermot, J. and Pourquie, O. (2005). Retinoic
acid coordinates somitogenesis and left-right patterning in vertebrate
embryos. Nature 435,215
-220.[CrossRef][Medline]
Vermot, J., Llamas, J. G., Fraulob, V., Niederreither, K.,
Chambon, P. and Dolle, P. (2005). Retinoic acid controls the
bilateral symmetry of somite formation in the mouse embryo.
Science 308,563
-566.[Abstract/Free Full Text]
Xu, X., Qiao, W., Li, C. and Deng, C. X.
(2002). Generation of Fgfr1 conditional knockout mice.
Genesis 32,85
-86.[CrossRef][Medline]

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in Development:
- FGF keeps segmentation clock ticking
Development 2007 134: e2204.
[Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
V. Wilson, I. Olivera-Martinez, and K. G. Storey
Stem cells, signals and vertebrate body axis extension
Development,
May 15, 2009;
136(10):
1591 - 1604.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Feller, A. Schneider, K. Schuster-Gossler, and A. Gossler
Noncyclic Notch activity in the presomitic mesoderm demonstrates uncoupling of somite compartmentalization and boundary formation
Genes & Dev.,
August 15, 2008;
22(16):
2166 - 2171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Oginuma, Y. Niwa, D. L. Chapman, and Y. Saga
Mesp2 and Tbx6 cooperatively create periodic patterns coupled with the clock machinery during mouse somitogenesis
Development,
August 1, 2008;
135(15):
2555 - 2562.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Zhang, C. Kendrick, D. Julich, and S. A. Holley
Cell cycle progression is required for zebrafish somite morphogenesis but not segmentation clock function
Development,
June 15, 2008;
135(12):
2065 - 2070.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. T. Shifley, K. M. VanHorn, A. Perez-Balaguer, J. D. Franklin, M. Weinstein, and S. E. Cole
Oscillatory lunatic fringe activity is crucial for segmentation of the anterior but not posterior skeleton
Development,
March 1, 2008;
135(5):
899 - 908.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Wahl, C. Deng, M. Lewandoski, and O. Pourquie
FGF signaling acts upstream of the NOTCH and WNT signaling pathways to control segmentation clock oscillations in mouse somitogenesis
J. Cell Sci.,
November 15, 2007;
120(22):
e1 - e1.
[Full Text]
|
 |
|